Acid-Resistant Near-Infrared II Ag2Se Quantum Dots for Gastrointestinal Imaging.

With the development of near-infrared II (NIR-II) fluorescence imaging, Ag2Se quantum dots (QDs) have become promising label candidates due to their negligible toxicity and narrow band gap. Despite their potential for gastrointestinal (GI) imaging, the application of Ag2Se QDs still presents significant challenges due to issues such as fluorescence extinction or poor stability in the complex digestive microenvironment. Herein, we have proposed a novel approach to the continuous production of Se precursors using glutathione (GSH) as the reductant under acidic conditions, realizing the continuous growth of water-dispersible Ag2Se QDs. The Ag2Se QDs emitting at 600-1100 nm have been successfully synthesized. Meanwhile, the silver-rich surface of the synthesized NIR-II Ag2Se QDs has been passivated well with the dense GSH, resulting in exceptional colloidal stability and photostability and endowing them with acid resistance. As a result, the obtained NIR-II Ag2Se QDs have exhibited remarkable stability in gastric acid, thus enabling their utilization for long-term real-time monitoring of GI peristalsis via NIR-II fluorescence imaging. Moreover, in contrast to conventional barium meal-based X-ray imaging, NIR-II fluorescence imaging with as-prepared NIR-II Ag2Se QDs can offer clearer visualization of fine intestinal structures, with a width as small as 1.07 mm. The developed strategy has offered a new opportunity for the synthesis of acid-resistant nanocrystals, and the acid-resistant, low-toxicity, and biocompatible NIR-II Ag2Se QDs synthesized in this work show a great promise for GI imaging and diagnosis of GI diseases in vivo.

A cysteine-rich secretory protein involves in phytohormone melatonin mediated plant resistance to CGMMV.

BACKGROUND: Melatonin is considered to be a polyfunctional master regulator in animals and higher plants. Exogenous melatonin inhibits plant infection by multiple diseases; however, the role of melatonin in Cucumber green mottle mosaic virus (CGMMV) infection remains unknown. RESULTS: In this study, we demonstrated that exogenous melatonin treatment can effectively control CGMMV infection. The greatest control effect was achieved by 3 days of root irrigation at a melatonin concentration of 50 µM. Exogenous melatonin showed preventive and therapeutic effects against CGMMV infection at early stage in tobacco and cucumber. We utilized RNA sequencing technology to compare the expression profiles of mock-inoculated, CGMMV-infected, and melatonin+CGMMV-infected tobacco leaves. Defense-related gene CRISP1 was specifically upregulated in response to melatonin, but not to salicylic acid (SA). Silencing CRISP1 enhanced the preventive effects of melatonin on CGMMV infection, but had no effect on CGMMV infection. We also found exogenous melatonin has preventive effects against another Tobamovirus, Pepper mild mottle virus (PMMoV) infection. CONCLUSIONS: Together, these results indicate that exogenous melatonin controls two Tobamovirus infections and inhibition of CRISP1 enhanced melatonin control effects against CGMMV infection, which may lead to the development of a novel melatonin treatment for Tobamovirus control.

Heterogeneity in the immune microenvironment of bone metastasis in driver-positive non-small cell lung cancer.

Mutations in epidermal growth factor receptor and anaplastic lymphoma kinase are common driver events in non-small cell lung cancer (NSCLC), which are associated with a high frequency of bone metastases (BMs). While the bone marrow represents a specialized immune microenvironment, the immune repertoire of BMs remains unknown. Considering the higher incidence of BMs in driver gene-positive NSCLCs, and the unique biology of the bone, herein, we assessed the infiltrating immune cells and T cell receptor (TCR) profile of BMs in driver-positive NSCLCs. Immune profile of BMs in driver gene-positive NSCLC were assessed in 10 patients, where 6 had driver gene-positive mutation. TCR and bulk RNA sequencing were performed on malignant bone samples. The diversity and clonality of the TCR repertoire were analyzed. The cellular components were inferred from bulk gene expression profiles computationally by CIBERSORT. Although BMs were generally regarded as immune-cold tumors, immune cell composition analyses showed co-existence of cytotoxic and suppressor immune cells in driver-positive BM samples, as compared to primary lung. Analysis of the TCR repertoire indicated a trend of higher diversity and similar clonality in the driver-positive compared with the driver-negative subsets. In addition, we identified two cases that showed the opposite response to immune checkpoint blockade. A comparison of these two patients' BM samples showed more highly amplified clones, fewer M2 macrophages and more activated natural killer cells in the responder. In summary, BMs in NSCLC are heterogeneous in their immune microenvironment, which might be related to differential clinical outcomes to immune checkpoint blockade.

Comparative genomic analysis and proposal of Clostridium yunnanense sp. nov., Clostridium rhizosphaerae sp. nov., and Clostridium paridis sp. nov., three novel Clostridium sensu stricto endophytes with diverse capabilities of acetic acid and ethanol production.

OBJECTIVES: Genus Clostridium sensu stricto is generally regarded as the true Clostridium genus, which includes important human and animal pathogens and industrially relevant microorganisms. Besides, it is also a prominent member of plant-associated endophytes. However, our knowledge of endophytic Clostridium is limited. METHODS: In this study, the endophytes were isolated under anaerobic condition from the roots of Paris polyphylla Smith var. yunnanensis. Subsequently, a polyphasic taxonomic approach was used to clarify their taxonomic positions. The fermentation products were measured in the isolates with HPLC analysis. Comparative genomics was performed on these new strains and other relatives. RESULTS: In total, nine endophytic strains belonging to the genus Clostridium sensu stricto were isolated, and three of them were identified as new species. Seven of nine strains could produce acetate, propionate, and butyrate. Only two strains could produce ethanol, although genomics analysis suggested that only two of them were without genes for solventogenesis. Different from the endophytic strains, the phylogenetically closely related non-endophytic strains showed significant enrichment effects on some metabolic pathways involving environmental information processing, carbohydrate, and amino acid metabolisms, etc. It suggests that the genomes of these endophytic strains had undergone subtle changes associated with environmental adaptations. CONCLUSION: Consequently, strains YIM B02505T, YIM B02515T, and YIM B02565T are proposed to represent a new species of the genus Clostridium sensu stricto, for which the names Clostridium yunnanense sp. nov., Clostridium rhizosphaerae sp. nov., and Clostridium paridis sp. nov. are suggested.

Genome-based analyses reveal heterotypic synonyms of Streptomyces species and associated subspecies.

In the genus Streptomyces, several validly described species have been reduced to synonyms of earlier described species though additional synonyms remain to be detected given the previous dependence on traditional phenotypic methods. In this study, genome-based procedures, including DNA-DNA hybridization analyses, overall genome-related indices, such as ANI, dDDH and AAI, revealed that certain strains recorded genomic indices above the threshold values used to define species boundaries. The results of phylogenetic and phylogenomic trees based on concatenated and phylogenomic analyses showed that 33 out of 364 tested species could be assigned to 15 species groups and that 18 Streptomyces species names be reclassified as later heterotypic synonyms of earlier validly published species. Consequently, it is proposed that S. albaduncus is a later heterotypic synonym of S. griseoloalbus; S. bellus is a synonym of S. coeruleorubidus; S. gancidicus and S. rubiginosus are synonyms of S. pseudogriseolus; S. niveoruber is a synonym of S. griseoviridis; S. griseomycini is a synonym of S. griseostramineus; S. jietaisiensis is a synonym of S. griseoaurantiacus; S. pluricolorescens is a synonym of S. rubiginosohelvolus; S. nashvillensis is a synonym of S. tanashiensis; S. yerevanensis is a synonym of S. flaveus; S. durhamensis is a synonym of S. filipinensis; S. recifensis is a synonym of S. griseoluteus; S. canaries and S. olivaceoviridis are synonyms of S. corchorusii; S. melanosporofaciens is a synonym of S. antimycoticus; S. albulus is a synonym of S. noursei; and S. janthinus and S. violarus are synonyms of S. violaceus. Additionally, seven of these 18 Streptomyces species have been designated subspecies.

Neobacillus paridis sp. nov., an endophyte of Paris polyphylla Smith var. yunnanensis.

A novel endophytic strain, designated YIM B02564T, was isolated from the root of Paris polyphylla Smith var. yunnanensis obtained from Yunnan Province, southwest China. By using a polyphasic approach, cells of the strain were characterized as facultative anaerobic, Gram-positive and rod-shaped. The growth conditions of the strain were found to occur at 20-55 °C (optimum, 30 °C), pH 6.0-9.0 (optimum, pH 7.0). Strain YIM B02564T can tolerate 2% NaCl concentration. Phylogenetic analysis based on 16S rRNA gene sequences revealed that strain YIM B02564T belonged to the genus Neobacillus and the 16S rRNA gene sequence similarity values of strain YIM B02564T to the type strains of members of this genus ranged from 95.6 to 97.8%. The DNA G+C content of strain YIM B02564T calculated from the whole genome sequence was 41.6 mol%. Values of the ANI and the dDDH between strain YIM B02564T and its closely related Neobacillus species were below 77.9% and 21.5%. Strain YIM B02564T contained MK-7 as the major menaquinone, iso-C15:0 and anteiso-C15:0 as the major fatty acids. The major polar lipids were diphosphatidylglycerol, phosphatidylglycerol, phosphatidylethanolamine, an unidentified aminophospholipid and four unidentified lipids. It contained meso-diaminopimelic acid in the cell-wall peptidoglycan. On the basis of polyphasic analysis, strain YIM B02564T could be differentiated genotypically and phenotypically from recognized species of the genus Neobacillus. The isolate therefore represents a novel species, for which the name Neobacillus paridis is proposed. The type strain is YIM B02564T (= JCM 34668T = CGMCC 1.18655T).

Potential synthetic lethality for breast cancer: A selective sirtuin 2 inhibitor combined with a multiple kinase inhibitor sorafenib.

Sorafenib is a clinically useful multiple kinase inhibitor for the treatment of kidney cancer, liver cancer and acute myelocytic leukemia, while it has shown weak efficacy in suppressing breast cancer. Since sirtuin2 (SIRT2) is an important epigenetic regulator and associated with several cancer types including breast cancer, development and evaluation of new SIRT2 inhibitors to probe their therapeutic potentials is currently desirable. A highly selective SIRT2 inhibitor named I was previously developed by us, which showed activity to inhibit non-small cell lung cancer cell lines in vitro. We herein report expanded screening of I and its structurally similar inactive compound II against other cancer cell lines, and found that I had a wide spectrum of anticancer activity while II had no such effects. The I-sorafenib combination treatment exerted obvious synergistic reduction on cell viability of MCF-7 cells. We observed that the combination treatment could suppress cell proliferation, survival and migration, arrest cell cycle at G0/G1 phase, and induce apoptosis in MCF-7 cells, when compared with the single treatment. In vivo studies revealed that the combination treatment showed stronger tumor growth inhibition (87%), comparing with I-(42.8%) or sorafenib-solely-treated groups (61.1%) in MCF-7 xenograft model. In conclusion, this work clearly revealed a potential synthetic lethality effect for I combined with sorafenib, and will probably offer a new strategy at least for breast cancer treatment.

Halomonas faecis sp. nov., a halophilic bacterium isolated from human faeces.

A novel moderately halophilic, Gram-stain-negative, catalase- and oxidase-positive, strictly aerobic, non-sporulating, non-motile rod, designated strain JSM 104105 T, was isolated from human faeces. Strain JSM 104105 T was able to grow with 0.5-18% (w/v) NaCl (optimum 4-9%), at pH 6-10.5 (optimum pH 7-8) and at 10-40 °C (optimum 30 °C) in complex media. The major cellular fatty acids were C18:1ω7c, C16:0, C16:1ω7c and/or C16:1ω6c, C19:0 cyclo ω8c and C12:0 3-OH. The polar lipids consisted of diphosphatidylglycerol, phosphatidylglycerol, phosphatidylethanolamine, an unidentified aminophospholipid, an unidentified glycolipid and three unidentified phospholipids. The predominant respiratory quinone was Q-9 and the genomic DNA G + C content was 64.5 mol%. Phylogenetic analysis based on 16S rRNA gene sequences indicated that strain JSM 104105 T should be assigned to the genus Halomonas, and was most closely related to Halomonas gudaonensis SL014B-69 T (99.0% sequence similarity), followed by Halomonas azerbaijanica TBZ202T (98.6%) and Halomonas lysinitropha 3(2)T (97.3%). The whole genomic analysis showed that strain JSM 104105 T constituted a different taxon separated from the recognized Halomonas species. Combined data from phenotypic and genotypic studies demonstrated that strain JSM 104105 T represents a new species of the genus Halomonas, for which the name Halomonas faecis sp. nov. is proposed. The type strain is JSM 104105 T (= CCTCC AB 2014160 T = CGMCC 1.12945 T = KCTC 42146 T).

Janibacter endophyticus sp. nov., an Endophytic Actinobacterium Isolated from the Root of Paris polyphylla Smith var. Yunnanensis.

A novel endophytic actinobacterium, designated as strain YIM B02568T, was isolated from the root of Paris polyphylla Smith var. Yunnanensis obtained from Yunnan Province, southwest China. Strain YIM B02568T was characterized using a polyphasic approach. Phylogenetic analysis indicated that this isolate belonged to the genus Janibacter. The 16S rRNA gene sequence similarity values of strain YIM B02568T to the type strains of members of this genus ranged from 95.8 to 98.6%. However, overall genome relatedness indices were significantly lower than the widely accepted species-defined threshold. The cell wall of strain YIM B02568T contained meso-diaminopimelic acid. The major menaquinone was MK-8(H4). The main polar lipids were phosphatidylglycerol, diphosphatidylglycerol, and phosphatidylinositol. The major cellular fatty acids were comprised of iso-C16:0 and C18:1 ω9c. The DNA G + C content was 71.6 mol%. Based on the data from the polyphasic studies, we propose that strain YIM B02568T represents a novel species within the genus Janibacter, Janibacter endophyticus sp. nov. The type strain is YIM B02568T (= JCM 34639T = CGMCC 1.18658T).

Azospirillum Endophyticum sp. nov., an Endophyte of Paris Polyphylla Smith var. Yunnanensis.

A Gram-negative, facultative anaerobic bacterial strain, designated YIM B02556T, was isolated from the root of Paris polyphylla Smith var. yunnanensis collected from Yunnan Province, southwest China. By using a polyphasic approach, its taxonomic position was investigated. Phylogenetic analysis based on 16S rRNA gene sequences revealed that strain YIM B02556T belonged to the genus Azospirillum and the 16S rRNA gene sequence similarity values of strain YIM B02556T to the type strains of members of this genus ranged from 94.9 to 98.3%. Overall genome relatedness index (OGRI) analysis estimated based on average nucleotide identity (ANI) and digital DNA-DNA hybridization (dDDH) between YIM B02556T and other Azospirillum species type strains were <90.8% and <37.8%, lower than the limit of species circumscription. Cells of the strain were characterized as oxidase- and catalase-positive, with motility provided by flagella. The growth conditions of the strain were found to occur at 20-40 °C (optimum, 35 °C), and pH 6.0-9.5 (optimum, pH 7.5). Strain YIM B02556T can tolerate 2% NaCl concentration. Strain YIM B02556T contained Q-10 as the major ubiquinone. The major fatty acids were C18:1 ω7c and summed feature three (C16:1 ω7c and/or C16:1 ω6c). The major polar lipids were diphosphatidylglycerol, phosphatidylglycerol, and phosphatidylethanolamine. Based on polyphasic analysis, strain YIM B02556T could be differentiated genotypically and phenotypically from recognized species of the genus Azospirillum. Therefore, the isolate represents a novel species, for which the name Azospirillum endophyticum is proposed. The type strain is YIM B02556T (=JCM 34631T=CGMCC 1.18654T).

First report of maize yellow mosaic virus causing maize reddening in Henan,China.

A novel polerovirus maize yellow mosaic virus (MaYMV) has been discovered in Asia (Chen et al. 2016; Lim et al. 2018; Sun et al. 2019; Wang et al. 2016), East Africa (Guadie et al. 2018; Massawe et al. 2018) and South America (Gonçalves et al. 2017). MaMYV was first reported to infect maize (Zea mays L.) showing yellow mosaic symptoms on the leaves in Yunnan, Guizhou, and yellowing and dwarfing symptoms on the leaves in Anhui provinces of China in 2016 (Chen et al. 2016; Wang et al. 2016). An East African isolate of MaYMV has recently been shown to induce leaf reddening in several maize genotypes (Stewart et al. 2020). To our knowledge the leaf reddening symptoms in maize was not reported in China and MaYMV was not reported in Henan province, China. A survey of viral diseases on maize was carried out during the autumn of 2021 in Zhengzhou (Henan province), China. During the survey, the leaves showing reddening symptoms were observed on maize plants in all four fields investigated. Symptomatic leaves of 12 plants from four fields of Xingyang county, Zhengzhou (n=12) were collected and mixed for metatranscriptomics sequencing, and total RNA was extracted and subjected to an rRNA removal procedure using a Ribo-zero Magnetic kit according to the manufacturer's instructions (Epicentre, an Illumina® company). cDNA libraries were constructed using a TruSeq™ RNA sample prep kit (Illumina). Barcoded libraries were paired-end sequenced on an Illumina HiSeq X ten platform at Shanghai Biotechnology Co., Ltd. (Shanghai, China) according to the manufacturer's instructions (www.illumina.com). In total 67607392 clean reads were de novo assembled using CLC Genomics Workbench (version:6.0.4). 105796 contigs were obtained. The assembled contigs were queried by homology search tools (BLASTn and BLASTx) against public database(GenBank). One 5,457 nucleotide (nt) long contig with the most reads of 558826 was obtained and blast analysis showed it shared 99.3% nt sequence identity (99% coverage) with MaYMV Yunnan4 isolate (KU291100).. According to the sequencing data no other plant viruses except MaYMV were present in the sequencing data. To confirm the presence of this virus, twelve leaf samples showing reddening symptoms were detected by RT-PCR using specific primer pairs for CP full length open reading frame (F: ATGAATACGGGAGGTAGAAA, R: CTATTTCGGGTTTTGAACAT). Amplicons with expected size of 594 bp were gained in seven samples and three of them were cloned into pMD18T vector and sequenced. The three isolates (OM417795, OM417796, and OM417797) shared 99.16% to 99.83% nt sequence identity with MaYMV-Yunnan3 isolate (KU291100). Further P0 sequence analysis of the three samples (OM417798, OM417799, and OM417800) with primer pairs F: ATGGGGGGAGTGCCTAAAGC/R: TCATAACTGATGGAATTCCC showed they shared 99.5% to 99.62% nt sequence identity with MaYMV-Yunnan3 isolate.To our knowledge, this is the first report of the occurrence of MaYMV infecting maize in Henan, China. Besides, our finding firstly discovered reddening symptoms caused by MaYMV on maize in China which is different from the previous symptoms observed in the other three provinces of China possibly due to the different maize varieties grown in different areas. According to our investigation, maize showing reddening symptoms was common in the fields. Henan province is the main corn production area in China. Corn leaf aphid (Rhopalosiphum maidis), the insect vector of MaYMV, is an important pest of corn in Henan province, thereby the occurrence of MaYMV might cause potential threat to maize production in China.

Chryseobacterium paridis sp. nov., an endophytic bacterial species isolated from the root of Paris polyphylla Smith var. yunnanensis.

A Gram-negative, yellow-pigmented, rod-shaped bacterial strain YIM B02567T was isolated from the root of Paris polyphylla Smith var. yunnanensis in China. Strain YIM B02567T grew optimally at 25-30 °C and at pH 7.0 in the absence of NaCl on nutrient agar. Phylogenetic analyses based on 16S rRNA gene sequences revealed that strain YIM B02567T belong to the genus Chryseobacterium, and was closely related to Chryseobacterium piperi CTMT and Chryseobacterium soli DSM 19298T. Whole genome sequencing indicated that the genome size was 4,774,612 bp and with a G + C content of 34.5 mol%. Values of the ANI and the dDDH between strain YIM B02567T and its closely related Chryseobacterium species were below 81.72% and 24.7%. Strain YIM B02567T contained menaquinone-6 as the sole isoprenoid quinone, anteiso-C15:0, iso-C17:1 ω9c and iso-C17:0 3-OH as major fatty acids and phosphatidylethanolamine as major polar lipid. Based on the polyphasic analyses, strain YIM B02567T could be differentiated genotypically and phenotypically from recognized species of the genus Chryseobacterium. The isolate, therefore, represents a novel species, for which the name Chryseobacterium paridis sp. nov. is proposed. The type strain is YIM B02567T (= CGMCC 1.18657T).

Concentrations and health risks of heavy metals in five major marketed marine bivalves from three coastal cities in Guangxi, China.

Seafood consumption provides essential elements to humans while also posing risks to human health. A total of 2610 individuals of five edible marine bivalve species (Ruditapes philippinarum, Paphia undulata, Meretrix meretrix, Sinonovacula constricta and Meretrix lyrata) were randomly sampled from six farmer markets in three cities (Beihai, Qinzhou and Fangchenggang) in the southernmost coastal region of China. The concentrations of heavy metals (Cu, Pb, Zn, Cd, Cr, Hg and As) were determined by inductively coupled plasma mass spectrometry (ICP-MS). The estimated daily intake (EDI), target hazard quotient (THQ), total hazard index (HI), and target cancer risk (TR) were calculated to evaluate potential human health risks from bivalve consumption. The mean concentrations of metals in the tissues of bivalves descended in the order Zn > Cu > As > Cd > Cr >Pb > Hg in descending order, and the concentrations varied substantially among the five bivalves. Heavy metal concentrations in edible tissues of most bivalve samples were below the safety limits set by national and international regulations, and there were significant correlations between certain metal concentrations. The EDI values for each metal in each bivalve were significantly lower than the corresponding PTDI (provisional tolerable daily intake) values. Health risk assessment showed that although there is no noncarcinogenic health risk for local residents exposed to individual or combined metals from these bivalves, there is a carcinogenic risk from Cd and Cr exposure. Thus, in the long term, monitoring and controlling bivalve consumption will be important. Although current accumulation levels of bivalves are safe, continued and excessive lifetime consumption over 70 years may pose a target cancer risk.

Comparison of the Phytochemical Properties, Antioxidant Activity and Cytotoxic Effect on HepG2 Cells in Mongolian and Taiwanese Rhubarb Species.

The Mongolian rhubarb-Rheum undulatum L. (RU)-and Rumex crispus L. (RC)-a Taiwanese local rhubarb belonging to the family of Polygonaceae-are principal therapeutic materials in integrative medicine due to their rich quantities of bioactive compounds; however, their phytochemical and antioxidant properties, and anti-cancer activity is poorly investigated. Furthermore, the phytochemical characteristics of both species may be affected by their different geographical distribution and climatic variance. The current study aimed to compare RU with RC extracts in different polarity solvents (n-hexane, ethyl acetate, acetone, ethanol, and water) for their phytochemical contents including the total phenolic content (TPC), total anthraquinone content (TAC), total flavonoid content (TFC), antioxidant and free radical scavenging capacities, and anticancer ability on the HepG2 cell. Except for the n-hexane extract, all of the RU extracts had considerably higher TPCs than RC extracts, ranging from 8.39 to 11.16 mg gallic acid equivalent (GAE) per gram of dry weight, and the TPCs of each extract were also significantly correlated with their antioxidant capacities by ABTS, DPPH, and FRAP assays (p < 0.05). Moreover, there was no remarkable association between the antioxidant capacities and either TACs or TFCs in both the RU and RC extracts. Besides, high-performance liquid chromatography (HPLC) analysis revealed that both the RU and RC extracts contained chrysophanol, emodin, and physcion, and those bioactive compounds were relatively higher in the n-hexane solvent extracts. Additionally, we observed different levels of dose-dependent cytotoxic effects in all the extracts by cell viability assay. Notably, the ethanol extract of RU had a compelling cytotoxic effect with the lowest half-maximum inhibition concentration (IC50-171.94 ± 6.56 µg/mL at 48 h) among the RU extracts than the ethanol extract of RC. Interestingly, the ethanol extract of RU but not RC significantly induced apoptosis in the human liver cancer cell line, HepG2, with a distinct pattern in caspase-3 activation, resulting in increased PARP cleavage and DNA damage. In summary, Mongolian Rhubarb, RU, showed more phytochemical contents, as well as a higher antioxidant capacity and apoptotic effect to HepG2 than RC; thus, it can be exploited for the proper source of natural antioxidants and liver cancer treatment in further investigation.

Reclassification of Friedmanniella endophytica, Lysinimicrobium sediminis and Lechevalieria rhizosphaerae as Microlunatus kandeliicorticis nom. nov., Demequina sediminis comb. nov. and Lentzea rhizosphaerae comb. nov., respectively.

According to Rule 37a of the International Code of Nomenclature of Prokaryotes, the name of a taxon must be changed if the nomenclatural type of the taxon is excluded. Recently, in a transfer of actinobacterial species, three species - Friedmanniella endophytica Tuo et al. 2016, Lysinimicrobium sediminis Hamada et al. 2017 and Lechevalieria rhizosphaerae Zhao et al. 2017 - were not transferred with their type species. Therefore, to resolve these nomenclatural issues, Microlunatus kandeliicorticis nom. nov., Demequina sediminis comb. nov. and Lentzea rhizosphaerae comb. nov. are proposed, respectively.

Paenibacillus paridis sp. nov., an endophytic bacterial species isolated from the root of Paris polyphylla Smith var. yunnanensis.

A Gram-reaction-positive, endospore-forming and rod-shaped bacterial strain, designated py1325T, was isolated from the root of Paris polyphylla Smith var. yunnanensis collected from Yunnan Province, PR China, and subjected to a polyphasic taxonomic characterization. It grew optimally with 0-1 % NaCl (w/v), at pH 7 and at 30 °C. The major respiratory quinone was MK-7 and the diagnostic diamino acid in the cell-wall peptidoglycan was meso-diaminopimelic acid. The major cellular fatty acid was anteiso-C15 : 0. The polar lipids consisted of phosphatidylglycerol, diphosphatidylglycerol, phosphatidylethanolamine, two unidentified aminophospholipids, two unidentified phospholipids and two unidentified lipids. The results of 16S rRNA gene sequence analysis revealed the highest levels of sequence similarity with respect to Paenibacillus luteus R-3T (99.0 %), Paenibacillus sinopodophylli CCTCC AB 2016047T (97.9 %), Paenibacillus castaneae DSM 19417T (97.5 %) and Paenibacillus endophyticus LMG 27297T (97.2 %). The digital DNA-DNA hybridization and average nucleotide identity values between py1325T and these species ranged 20.6-53.3 % and 79.9-93.6 %. The G+C content of the genomic DNA was 47.7 mol%. According to the phylogenetic, phenotypic and chemotaxonomic evidence, strain py1325T clearly represents a novel species of the genus Paenibacillus, for which the name Paenibacillus paridis sp. nov. is proposed. The type strain is py1325T (=CCTCC AB 2015220T=LMG 29068T).

Sediminibacillus terrae sp. nov., a moderate halophile isolated from non-saline farm soil.

A Gram-stain-positive, moderately halophilic, strictly aerobic, endospore-forming, rod-shaped bacterium, strain JSM 102062T, was isolated from a non-saline farm soil sample collected from Dehang Canyon in Hunan, PR China. Growth occurred with 0.5-20 % (w/v) NaCl (optimum 4-7 %) at pH 5.5-11.0 (optimum pH 8.0) and at 20-50 °C (optimum 30-35 °C). Contained cell-wall peptidoglycan based on meso-diaminopimelic acid and possessed menaquinone-7 (MK-7) as the major respiratory isoprenoid quinone. The major cellular fatty acids were anteiso-C15 : 0, anteiso-C17 : 0 and iso-C16 : 0. The polar lipid pattern consisted of diphosphatidylglycerol, phosphatidylglycerol, five unidentified phospholipids and an unidentified glycolipid. The DNA G+C content was 44.1 mol%. Phylogeny based on 16S rRNA gene sequences indicated that strain JSM 102062T belonged to the genus Sediminibacillus, sharing high 16S rRNA gene sequence similarities to Sediminibacillus halophilus EN8dT (99.4 %) and Sediminibacillus albus NHBX5T (98.3 %). The whole genomic analysis showed that strain JSM 102062T constituted a different taxon separated from the recognized Sediminibacillus species. Combined data from phenotypic and genotypic studies demonstrated that strain JSM 102062T represents a noval species of the genus Sediminibacillus, for which the name Sediminibacillus terrae sp. nov. is proposed; the type strain is JSM 102062T (=CCTCC AB 2014166T = CGMCC 1.12957T=DSM 28949T=KCTC 33541T).

Synthesis and In Vitro Photocytotoxicity of 9-/13-Lipophilic Substituted Berberine Derivatives as Potential Anticancer Agents.

The objective of this study was to synthesize the 9-/13-position substituted berberine derivatives and evaluate their cytotoxic and photocytotoxic effects against three human cancer cell lines. Among all the synthesized compounds, 9-O-dodecyl- (5e), 13-dodecyl- (6e), and 13-O-dodecyl-berberine (7e) exhibited stronger growth inhibition against three human cancer cell lines, (HepG2, HT-29 and BFTC905), in comparison with structurally related berberine (1). These three compounds also showed the photocytotoxicity in human cancer cells in a concentration-dependent and light dose-dependent manner. Through flow cytometry analysis, we found out a lipophilic group at the 9-/13-position of berberine may have facilitated its penetration into test cells and hence enhanced its photocytotoxicity on the human liver cancer cell HepG2. Further, in cell cycle analysis, 5e, 6e, and 7e induced HepG2 cells to arrest at the S phase and caused apoptosis upon irradiation. In addition, photodynamic treatment of berberine derivatives 5e, 6e, and 7e again showed a significant photocytotoxic effects on HepG2 cells, induced remarkable cell apoptosis, greatly increased intracellular ROS level, and the loss of mitochondrial membrane potential. These results over and again confirmed that berberine derivatives 5e, 6e, and 7e greatly enhanced photocytotoxicity. Taken together, the test data led us to conclude that berberine derivatives with a dodecyl group at the 9-/13-position could be great candidates for the anti-liver cancer medicines developments.

Genome-based taxonomic classification within the family Thermoactinomycetaceae.

The family Thermoactinomycetaceaecomprises 43 validly published species, which were identified by a polyphasic taxonomic study based on molecular phylogenetics, physiological and biochemical characteristics. However, phylogenetic analysis merely based on 16S rRNA gene sequences cannot infer a robust and reliable phylogeny. For disentangling the phylogenetic relationships among members of this family, we used a large collection of genome data and the approach of phylogenomics, to re-examine their taxonomy. The topologies of phylogenomic trees are different from those of the 16S rRNA gene sequences. In addition, based on the average nucleotide identity, digital DNA-DNA hybridization, phenotypic and biochemical characteristics, we found that Laceyella sediminis should be reclassified as a later heterotypic synonym of Laceyella tengchongensis; and reclassified Thermoactinomyces guangxiensis as Paenactinomyces guangxiensis gen. nov., comb. nov.; and establish Novibacillaceae fam. nov. to accommodate the genus Novibacillus as the type genus. In addition, compared to values calculated directly from genome sequences, the genomic DNA G+C contents mentioned in some species descriptions are too imprecise; and the corrected G+C content values have a significantly better fit to the phylogeny. Thus, the corresponding emendations of species descriptions are also proposed. In this paper, phylogenomics has been used to resolve the classification of the family Thermoactinomycetaceae.

Bailinhaonella thermotolerans gen. nov., sp. nov., a new member of the order Streptosporangiales.

A Gram-positive, aerobic, non-motile actinobacterium, designated YIM 75507T, that was isolated from a soil sample collected from a dry-hot valley, was subjected to a polyphasic taxonomic study. The isolate formed branched hyphae and no fragmentation was found. Clustered spore chains were borne from aerial mycelium. The cell-wall peptidoglycan contained glutamic acid, alanine and meso-diaminopimelic acid. Whole-cell sugars were galactose, mannose, glucosamine, glucose and ribose. The major menaquinones were MK-9(H6), MK-9(H8) and MK-10(H6). The polar phospholipids contained phosphatidylmethylethanolamine, phosphatidylethanolamine and ninhydrin-positive phosphoglycolipid. Major fatty acids were iso-C16 : 0 and 10-methyl-C17 : 0. Phylogenetic analysis based on 16S rRNA gene sequences revealed that strain YIM 75507T formed a stable and distinct lineage clustered with the genus Sinosporangium in the family Streptosporangiaceae. The draft genome sequence of strain YIM 75507T exhibited low average nucleotide identity to the closest related strain, Sinosporangium album CPCC 201354T (83.97 %), well below the 95-96 % species circumscription threshold. The G+C content of the genomic DNA was 73.8 mol%. On the basis of morphological, chemotaxonomic and phylogenetic evidence, strain YIM 75507T is assigned to a novel species of a new genus, for which the name Bailinhaonella thermotolerans gen. nov., sp. nov. is proposed. The type strain of Bailinhaonella thermotolerans is YIM 75507T (=KCTC 49229T=CGMCC 4.7547T).