RESUMO
Objective: To evaluate the effect on bleeding volume and postoperative recovery of regional cerebral oxygen saturation (rSO(2)) guides controlled hypotension in elderly patients with hypertension undergoing spinal surgery. Methods: One hundred and twenty elderly patients who underwent spinal surgery in the department of anesthesiology of Qingdao Municipal Hospital and the Affiliated Hospital of Qingdao University from January 2017 to December 2019 were selected and divided into 2 groups according to the random number table method (n=60): rSO(2) guides the controlled hypotension group (group A) and control group (group C). Both groups were performed with endotracheal intubation for general anesthesia, maintain anesthesia with sevoflurane and remifentanil, rSO(2) were monitored throughout the procedure. If necessary, sodium nitroprusside or esmolol were used to control blood pressure. In group A, the goal of controlled hypotension was that rSO(2) decreased ≤ 10% of the basic value or maintained at 64±3 and the moderate operative field bleeding. Group C underwent routine anesthesia management. Intraoperative blood loss and urine output, the incidence of hypothermia after operation, postoperative delirium, chills, nausea and vomiting, the PACU residence time, postoperative drainage volume, eating time, postoperative hospital stay were compared between the two groups. Results: Compared with group C, the blood loss [(589±157) vs (764±213) ml] and urine output [(778±121) vs (1 079±239) ml] of group A were decreased (t=-5.120, -8.712, all P<0.05). The rates of hypothermia after operation (26.7% vs 45.0%), postoperative delirium (18.3% vs 36.7%), chills (10.0% vs 25.0%), nausea and vomiting (21.7% vs 40.0%) of group A were decreased (χ(2)=4.385, 5.057, 4.675, 4.728, all P<0.05) . The PACU residence time [(56±9) vs (63±11) min], postoperative drainage volume [(217±66) vs (289±81) ml], eating time [(17.8±2.8) vs (22.3±4.1) h] and numbers of days in hospital [(7.2±2.7) vs (8.2±2.9) d] were decreased of group A (t=-3.399, -5.334, -7.000, -2.031, all P<0.05). Conclusion: The guidance of controlled hypotension with rSO(2) monitoring can reduce the blood loss and infusion volume during spinal surgery in elderly patients with hypertension, reduce postoperative related complications and enhance recovery after surgery.
Assuntos
Hipertensão , Hipotensão Controlada , Idoso , Humanos , Oxigênio , Período Pós-Operatório , SevofluranoRESUMO
Objective: To evaluate the effect of dual-tube epidural segmental injection of lidocaine analgesia on the delivery outcome and maternal and infant complications of persistent posterior occipital position postpartum or lateral occipital position postpartum patients with protracted active phase. Methods: The full and single-term primiparas (n=216, 37 to 42 weeks gestation, 22 to 35 years) diagnosed as persistent posterior or lateral occipital position during the active period were selected from the Department of Obstetrics of Qingdao Municipal Hospital from January 2015 to October 2019. The subjects were randomly assigned into two groups: double-tube epidural block group (n=108) and single-tube epidural block group (n=108), 1% lidocaine was used for epidural analgesia respectively under ultrasound guidance. Senior midwife or obstetricians implement new partogram, and guide women to perform position management, and push or rotate the fetal head in a timely manner. Observation indicators: general condition, the use of non-pharmacological analgesic measures, analgesia related conditions and pain visual analogue scale (VAS) score, delivery-related indicator, cesarean section indication, anesthesia-related indicator, maternal and child complications. Results: (1) General condition: the age, weight, height, gestational age, the ratio of persistent lateral or posterior occipital position, cephalic score, and neonatal birth weight between the two groups of women were not statistically significant (all P>0.05). (2) The use of non-pharmacological analgesic measures: the women's Lamaze breathing method, Doula delivery companionship, percutaneous electrical stimulation, and other measures between two groups were compared, and there were not significant differences (all P>0.05). (3) Analgesia related conditions and VAS scores of women undergoing vaginal delivery: compared with the single-tube epidural block group (n=40), the second-partum time of the women in the double-tube epidural block group (n=59) was significantly shortened [(124±44) vs (86±33) minutes, P<0.01]; after 30 minutes of analgesia (4.4±0.5 vs 0.9±0.5, P<0.01), during forced labor in the second stage of labor (5.7±0.6 vs 1.3±0.4, P<0.01), the VAS scores of pain were also significantly reduced (P<0.01). (4) Labor-related indicators: compared with the single-tube epidural block group, the natural delivery rate (21.3% vs 49.1%) and the delivery experience satisfaction rate (51.9% vs 98.1%) of women in the double-tube epidural block group were significantly increased (all P<0.01), cesarean section rate (63.0% vs 45.4%), instrument assisted rate (15.7% vs 5.6%) decreased significantly (all P<0.05). (5) Cesarean section indications: compared with the single-tube epidural block group, the cesarean section rate caused by prolonged labor or protracted active phase of women in the double-tube epidural block group was significantly reduced (38.0% vs 22.2%ï¼ P<0.05), and the fetal distress, intrauterine infection, and social factors caused by cesarean section between the two groups were compared, while the differences were not statistically significant (all P>0.05).(6) Anesthesia related indexes: the block planes of the maternal upper tube administration in the double-tube epidural block group were mostly T7, T8, T9-L2 and L3,While,the block planes in the single-tube epidural block group were mostly T10, T11-S1, S2, S3, and the modified Bromage score were all 0. (7) Maternal and child complications: compared with the single-tube epidural block group, the postpartum hemorrhage rate (18.5% vs 7.4%), the perineal lateral cut rate (20.4% vs 5.6%), the neonatal asphyxia rate (12.0% vs 3.7%), ICU rate of transferred neonates (13.9% vs 4.6%) in the double-tube epidural block group were significantly reduced (all P<0.05). Soft birth canal injury rate, puerperal disease rate and neonatal birth rate between two groups were compared, and there were not statistically significant differences (all P>0.05). Conclusion: Dual-tube epidural segmental injection of lidocaine analgesia could increase the natural delivery rate of women with posterior occipital or lateral occipital position with active stagnation, reduce the rate of cesarean section and the rate of transvaginal instruments, and reduce the complications of mother and child.
Assuntos
Analgesia Epidural/métodos , Analgesia Epidural/estatística & dados numéricos , Analgesia Obstétrica/métodos , Analgesia Obstétrica/estatística & dados numéricos , Anestesia Epidural/métodos , Cesárea/estatística & dados numéricos , Parto Obstétrico/estatística & dados numéricos , Trabalho de Parto/efeitos dos fármacos , Lidocaína/administração & dosagem , Adulto , Analgesia Epidural/efeitos adversos , Analgesia Obstétrica/efeitos adversos , Feminino , Humanos , Recém-Nascido , Dor , Gravidez , Resultado da Gravidez , Resultado do TratamentoRESUMO
BACKGROUND AND AIMS: The brachial-ankle pulse wave velocity (baPWV) is a marker for early atherosclerotic changes. Serum total bilirubin (TB) is an effective antioxidant and has been associated with carotid intima-media thickness, cardiovascular disease, stroke and peripheral arterial disease, all of which may be caused by arteriosclerosis. This study aimed to investigate the association of TB with arterial stiffness. METHODS AND RESULTS: In this cross-sectional study, we investigated the relationship between TB and baPWV in 2207 participants (1331 men, 876 women) in a general health examination. Different metabolic parameters were compared across TB quartiles. Age-adjusted mean values of baPWV gradually decreased with TB quartiles in men (Q1 = 1348, Q2 = 1266, Q3 = 1215, and Q4 = 1154 cm/s). However, the age-adjusted means of baPWV had no significance in women according to TB quartiles. Univariate analysis showed that age, smoking status, BMI, SBP, DBP, AST, ALT, GGT, TB, TG, and HDL-C were significantly associated with baPWV in men, whereas only age, BMI, SBP, DBP, TG and FPG were significantly associated with baPWV in women. In addition, BMI, SBP, TB, age, TG, and AST were significant factors in the multivariate model with baPWV in men; only BMI and FPG were significant factors with baPWV in women. CONCLUSION: The findings show that serum total bilirubin concentration is negatively correlated to arterial stiffness in Chinese men. Early detection of abnormal bilirubin levels could potentially serve as an early biomarker for arterial stiffness.
Assuntos
Bilirrubina/sangue , Doenças Cardiovasculares/etiologia , Rigidez Vascular , Adulto , Análise de Variância , Índice Tornozelo-Braço , Biomarcadores/sangue , Doenças Cardiovasculares/sangue , Doenças Cardiovasculares/fisiopatologia , Distribuição de Qui-Quadrado , China , Estudos Transversais , Regulação para Baixo , Feminino , Humanos , Modelos Lineares , Masculino , Pessoa de Meia-Idade , Valor Preditivo dos Testes , Análise de Onda de Pulso , Medição de Risco , Fatores de Risco , Fatores SexuaisRESUMO
Common bean (Phaseolus vulgaris) is one of the most economically important vegetable crops in China. In November 2011, symptoms with thickening and crumpling of leaves and stunting were observed on common bean with incidence rate of 50 to 70% in the fields of Huaibei, northern Anhui Province, China. Diseased common bean plants were found to be infested with large population of whiteflies (Bemisia tabaci), which induced leaf crumple symptoms in healthy common beans, suggesting begomovirus etiology. To identify possible begomoviruses, 43 symptomatic leaf samples from nine fields were collected and total DNA of each sample was extracted. PCR was performed using degenerate primers PA and PB to amplify a specific region covering AV2 gene of DNA-A and part of the adjacent intergenic region (2). DNA fragments were successfully amplified from 37 out of 43 samples and PCR amplicons of 31 samples were used for sequencing. Sequence alignments among them showed that the nucleotide sequence identity ranged from 99 to 100%, which implied that only one type of begomovirus might be present. Based on the consensus sequences, a primer pair MB1AbF (ATGTGGGATCCACTTCTAAATGAATTTCC) and MB1AsR (GCGTCGACAGTGCAAGACAAACTACTTGGGGACC) was designed and used to amplify the circular viral DNA genome. The complete genome (Accession No. JQ326957) was 2,781 nucleotides long and had the highest sequence identity (over 99%) with Tomato yellow leaf curl virus (TYLCV; Accession Nos. GQ352537 and GU199587). These samples were also examined by dot immunobinding assay using monoclonal antibody against TYLCV and results confirmed that TYLCV was present in the samples. These results demonstrated that the virus from common bean is an isolate of TYLCV, a different virus from Tomato yellow leaf curl China virus (TYLCCNV). TYLCV is a devastating pathogen causing significant yield losses on tomato in China since 2006 (4). The virus has also been reported from cowpea in China (1) and in common bean in Spain (3). To our knowledge, this is the first report of TYLCV infecting common bean in China. References: (1) F. M. Dai et al. Plant Dis. 95:362, 2011. (2) D. Deng et al. Ann. Appl. Biol. 125:327, 1994. (3) J. Navas-Castillo et al. Plant Dis. 83:29, 1999. (4) J. B. Wu et al. Plant Dis. 90:1359, 2006.
RESUMO
OBJECTIVE: Drug-related problems (DRPs) are common in hospitalized patients receiving Key Monitoring Drugs. Clinical pharmacy services have the potential to minimize drug-related harm and improve patient care. The aim of this study is to standardize the clinical application of Key Monitoring Drugs and reduce drug-related problems (DRPs) and associated costs, using clinical pharmacist interventions. PATIENTS AND METHODS: Clinical pharmacists formulate management measures for Key Monitoring Drugs using evidence-based medicine and analyze the DRPs of Key Monitoring Drugs in China at the Shandong Provincial Third Hospital over a period of five years, from 2015 to 2019. RESULTS: In 2019, the total cost of the use of Key Monitoring Drugs decreased by 10.12 million CNY, in comparison with the cost in 2015. The proportion of revenue generated from Key Monitoring Drugs also decreased by 11.49% compared with 2015. In addition, the cost per capita of Key Monitoring Drugs has gradually decreased; this resulted in a saving of 580.07 CNY per capita in 2019 compared with 2015. Over this time, the DRPs associated with Key Monitoring Drugs decreased by 45.50%. Through administrative intervention, prescription review, information management, and pharmaco-economic evaluation, a scientific management system for Key Monitoring Drugs has been established over this time, which standardizes the use of Key Monitoring Drugs and reduces their associated costs. CONCLUSIONS: Clinical pharmacists' interventions can assist in the early detection of drug-related problems associated with Key Monitoring Drugs and prevent any resulting harm to patients.
Assuntos
Monitoramento de Medicamentos/economia , Erros de Medicação/economia , Preparações Farmacêuticas/economia , Farmacêuticos/economia , Serviço de Farmácia Hospitalar/economia , China , HumanosRESUMO
Administration of interleukin 12 (IL-12) into mice bearing CSA1M, OV-HM, Meth A, or MCH-1-A1 tumor induced complete regression of CSA1M and OV-HM tumors but induced only a slight growth inhibition of Meth A and MCH-1-A1 tumors. These effects of IL-12 were associated with high and only marginal levels of T-cell infiltration into CSA1M/OV-HM and Meth A/MCH-1-A1 tumor masses, respectively. Here, we investigated the role of IL-12 in the induction of T-cell migration. Spleen cells from untreated or IL-12-treated CSA1M-bearing mice were stained in vitro with a fluorescein chemical and transferred i.v. into IL-12-untreated CSA1M-bearing mice. Migration of donor cells was quantitated by counting the number of fluorescent cells on cryostat sections of tumor masses. Although only a slight migration was detected for spleen cells from IL-12-untreated CSA1M-bearing as well as IL-12-treated or untreated normal mice, enhanced migration was observed for cells from IL-12-treated CSA1M-bearing mice. A similar enhanced migration was observed for the OV-HM model. In contrast, such an enhancement was only marginal in the Meth A and MCH-1-A1 models. Immunohistochemical studies of tumors from IL-12-treated mice revealed that the predominant T-cell subset was CD4+ in CSA1M and CD8+ in OV-HM tumor masses. Consistent with this observation, the dominant subset of migrating T cells was found to be CD4+ in the CSA1M and CD8+ in the OV-HM models. T-cell migration was inhibited by pretreatment of recipients with either combination of anti-very late antigen 4 + anti-vascular cell adhesion molecule 1 or anti-lymphocyte function-associated antigen 1 + anti-intercellular adhesion molecule 1 monoclonal antibody. These results indicate that IL-12 can confer T cells with a capacity to migrate to tumor sites through very late antigen 4/lymphocyte function-associated antigen 1 adhesion pathways and that the in vivo acquisition of such a capacity following IL-12 treatment correlates with the induction of tumor regression.
Assuntos
Interleucina-12/farmacologia , Linfócitos do Interstício Tumoral/efeitos dos fármacos , Neoplasias Experimentais/imunologia , Linfócitos T/efeitos dos fármacos , Animais , Anticorpos Bloqueadores/imunologia , Anticorpos Monoclonais/imunologia , Antígenos CD4/imunologia , Antígenos CD8/imunologia , Movimento Celular/imunologia , Feminino , Imuno-Histoquímica , Integrina alfa4beta1 , Integrinas/imunologia , Molécula 1 de Adesão Intercelular/imunologia , Antígeno-1 Associado à Função Linfocitária/imunologia , Masculino , Camundongos , Camundongos Endogâmicos BALB C , Camundongos Endogâmicos C3H , Camundongos Endogâmicos , Transplante de Neoplasias , Receptores de Retorno de Linfócitos/imunologia , Baço/citologia , Baço/transplante , Subpopulações de Linfócitos T/imunologia , Células Tumorais Cultivadas , Molécula 1 de Adesão de Célula Vascular/imunologiaRESUMO
Interleukin (IL) 12 has been shown to elicit tumor regression when this cytokine induces the migration of T cells to tumor sites. The present study investigates the role of a peritumoral stromal reaction in IL-12-induced T-cell migration. In the CSA1M and OV-HM tumor models, IL-12 treatment induced tumor regression that is associated with T-cell migration. Neither T-cell migration nor tumor regression was observed in the Meth A and MCH-1-A1 models. Stromal tissue containing neovascular blood vessels developed at the peritumoral area of the former two IL-12-responsive tumors but not at the peritumoral area of the latter two IL-12-unresponsive tumors. The significance of stroma development was investigated using a pair of tumor models (CSA1M and a subline derived from CSA1M designated the CSA1M variant), both of which exhibit the same tumor immunogenicity. In contrast to the parental CSA1M cell line, the variant cell line was not responsive to IL-12, and neither stroma development nor T-cell migration was observed, even after IL-12 treatment. Histological analyses revealed that the parental cell line had peritumoral stroma with intrastromal vessels but only a few vessels in tumor parenchyma, whereas the variant cell line showed no stroma but had abundant vasculature in the tumor parenchyma. Most importantly, only stromal vessels in the parental tumors expressed detectable and enhanced levels of vascular cell adhesion molecule 1 (VCAM-1)/ intercellular adhesion molecule 1 (ICAM-1) before and after IL-12 treatment, respectively. In contrast, parenchymal vasculature in the variant cell line failed to express VCAM-1/ICAM-1 even after IL-12 treatment. When transferred into recipient tumor-bearing mice, IL-12-stimulated T cells from the parental CSA1M-bearing or the variant CSA1M-bearing mice migrated into the parental but not into the variant tumor mass. Together with our previous finding that T-cell migration depends on the VCAM-1/ICAM-1 adhesive interactions, the present results indicate a critical role for peritumoral stroma/stromal vasculature in the acceptance of tumor-infiltrating T cells that is a prerequisite for IL-12-induced tumor regression.
Assuntos
Interleucina-12/uso terapêutico , Neoplasias Experimentais/irrigação sanguínea , Linfócitos T/fisiologia , Animais , Movimento Celular , Feminino , Molécula 1 de Adesão Intercelular/análise , Masculino , Camundongos , Camundongos Endogâmicos BALB C , Camundongos Endogâmicos C3H , Camundongos Endogâmicos C57BL , Neoplasias Experimentais/imunologia , Neoplasias Experimentais/terapia , Células Tumorais Cultivadas , Molécula 1 de Adesão de Célula Vascular/análiseRESUMO
Administration of recombinant interleukin 12 (IL-12) induces tumor regression that is associated with T-cell infiltration in the OV-HM ovarian carcinoma and CSA1M fibrosarcoma models. After confirming the blocking of regression by injection of anti-IFN-gamma monoclonal antibody (mAb), we investigated the mechanisms underlying the requirement of IFN-gamma in T-cell migration and tumor regression. T-cell migration was inhibited by injection of anti-IFN-gamma mAb to OV-HM tumor-bearing mice prior to IL-12 treatment. We examined, using the lymphoid cell migration assay, whether IFN-gamma is required for enhancing the migratory capacity of T cells or the T cell-accepting potential of tumor masses during IL-12 treatment. Spleen cells from IL-12-treated or untreated OV-HM-bearing mice were stained in vitro with a fluorescein chemical and transferred i.v. into OV-HM-bearing mice that were not treated with IL-12. Migration of donor cells was quantitated by counting the number of fluorescent cells on cryostat sections of tumor masses from recipient mice. Compared to spleen cells from OV-HM-bearing mice that were not treated with IL-12, enhanced migration was observed for cells from IL-12-treated OV-HM-bearing mice. Anti-IFN-gamma pretreatment of donor mice before IL-12 treatment did not reduce the migratory capacity of T cells, whereas migration was markedly inhibited in recipient mice injected with anti-IFN-gamma. Anti-IFN-gamma pretreatment decreased vascular cell adhesion molecule-1 (VCAM-1)-/intercellular adhesion molecule-1 (ICAM-1)-positive blood vessels at tumor sites. Consistent with this, migration was also inhibited by treatment of recipient mice with either anti-VCAM-1 or anti-ICAM-1 mAb. In contrast to the OV-HM model, T-cell migration was not affected in the CSA1M model following preinjection of anti-IFN-gamma mAb. In this model, VCAM-1-/ICAM-1-positive blood vessels existed even after anti-IFN-gamma treatment, although tumor regression was completely inhibited. These results indicate that IFN-gamma plays two distinct roles in expressing the antitumor efficacy of IL-12: one is to support the T-cell acceptability of tumor masses, and the other is to mediate the antitumor effects of migrated T cells.
Assuntos
Antineoplásicos/uso terapêutico , Interferon gama/fisiologia , Interleucina-12/uso terapêutico , Neoplasias Experimentais/tratamento farmacológico , Animais , Anticorpos Monoclonais , Movimento Celular/efeitos dos fármacos , Regulação para Baixo , Feminino , Fibrossarcoma/irrigação sanguínea , Fibrossarcoma/tratamento farmacológico , Fibrossarcoma/patologia , Molécula 1 de Adesão Intercelular/biossíntese , Masculino , Camundongos , Camundongos Endogâmicos BALB C , Camundongos Endogâmicos C57BL , Neoplasias Experimentais/irrigação sanguínea , Neoplasias Experimentais/patologia , Neovascularização Patológica , Neoplasias Ovarianas/irrigação sanguínea , Neoplasias Ovarianas/tratamento farmacológico , Neoplasias Ovarianas/patologia , Ratos , Indução de Remissão , Linfócitos T/efeitos dos fármacos , Células Tumorais Cultivadas , Molécula 1 de Adesão de Célula Vascular/biossínteseRESUMO
Administration of recombinant interleukin-12 (rIL-12) into CSA1M fibrosarcoma-bearing mice results in complete regression of growing tumors. This tumor regression is associated with massive lymphoid cell infiltration to tumor sites and is completely blocked by injection of anti-interferon-gamma (IFN-gamma) monoclonal antibody (mAb). We investigated whether anti-IFN-gamma mAb exerts its suppressive effect on tumor regression by blocking the IL-12-induced lymphoid cell migration to tumor sites or by inhibiting the secondary effects of IFN-gamma produced by infiltrating cells. Injection of anti-IFN-gamma mAb to CSA1M-bearing mice before IL-12 treatment prevented the induction of tumor regression, whereas this treatment affected only marginally the infiltration of lymphoid cells to tumor masses. In accordance with this, IFN-gamma mRNA was expressed inside tumor masses by infiltrating cells after IL-12 therapy irrespective of whether anti-IFN-gamma mAb was injected. However, anti-IFN-gamma mAb treatment almost completely abrogated the in situ expression of inducible nitric oxide synthase (iNOS) as well as IFN-inducible protein-10 (IP-10) genes as examples of IFN-gamma-inducible genes. Immunohistochemical analyses also revealed that the expression of iNOS protein was completely inhibited by anti-IFN-gamma injection. These results suggest that the implementation of in situ IFN-gamma activity and its secondary induction of anti-tumor pathways such as iNOS and IP-10 expression are important processes in the IL-12-induced tumor regression.
Assuntos
Anticorpos Monoclonais/farmacologia , Quimiocinas CXC , Fibrossarcoma/imunologia , Fibrossarcoma/terapia , Interferon gama/biossíntese , Interferon gama/imunologia , Interleucina-12/uso terapêutico , Linfócitos do Interstício Tumoral/imunologia , Transcrição Gênica/efeitos dos fármacos , Animais , Quimiocina CXCL10 , Quimiocinas/biossíntese , Sondas de DNA , DNA Complementar , Fibrossarcoma/patologia , Linfócitos do Interstício Tumoral/patologia , Masculino , Camundongos , Camundongos Endogâmicos BALB C , Testes de Neutralização , Óxido Nítrico Sintase/biossíntese , Reação em Cadeia da Polimerase , RNA Mensageiro/biossíntese , Proteínas Recombinantes/uso terapêuticoRESUMO
We previously demonstrated that proliferation of terminally differentiated Th1 clones depends primarily on an interleukin-12 (IL-12)-paracrine mechanism mediated by their interactions with antigen-presenting cells (APC) rather than on an IL-2-autocrine mechanism. Such a Th1 clone (4-86, C57BL/6 origin) was cultured with recombinant IL-12 (rIL-12) in the absence of either antigen or APC. Some cells survived for several passages of culture with only rIL-12, and by limiting dilution, several clones highly reactive to rIL-12 alone were obtained. One of these clones, designated 2D6, was found to proliferate strongly in response to less than 1 pg/mL of rIL-12. This clone exhibited the following surface phenotypes: CD3+, T cell receptor (TCR) alpha beta+, Vbeta11+, NK-1.1-; CD4-CD8-; LFA-1+, ICAM-1+; and CD28+, CD80+, CD86+, CTLA-4-. In accordance with high responsiveness to IL-12, 2D6 cells were also found to express IL-12 receptor (IL-12R) as detected by incubation with rIL-12 and then staining with anti-IL-12 monoclonal antibody (mAb). Stimulation of 2D6 with rIL-12 resulted in the expression of interferon-gamma (IFN-gamma) and IL-10 mRNAs and production of these cytokines. The 2D6 clone responded to IL-2 (vigorously), IL-7 (moderately), and IL-4 (mildly) in addition to IL-12. However, the Ab capture assay using anti-IL-12 mAb enabled us to quantify IL-12-specific activity contained in a given sample. Thus, this study describes the unique features of the IL-12-responsive T cell clone and demonstrates the utilization of this clone in the quantitation of a specific IL-12 activity.
Assuntos
Interleucina-12/farmacologia , Receptores de Interleucina/metabolismo , Células Th1/efeitos dos fármacos , Animais , Bioensaio , Agregação Celular , Divisão Celular , Linhagem Celular , Citocinas/metabolismo , Interleucina-12/metabolismo , Camundongos , Camundongos Endogâmicos C57BL , Fenótipo , Receptores de Interleucina-12 , Células Th1/citologia , Células Th1/metabolismoRESUMO
We previously found a novel endogenous factor in rat liver cytosol, named ATP-stimulated glucocorticoid-receptor-translocation promoter (ASTP), that increased the binding of activated glucocorticoid-receptor to nuclei in the presence of ATP. In this work, we immunized rabbits with the purified ASTP protein and characterized the antibodies with regard to titer, cross-reactivity and specificity. An IgG fraction from sera of the immunized rabbits contained specific antibodies to ASTP. The anti-ASTP IgG could precipitate the ASTP protein without the activity. Immunoblot analysis revealed a major band of 48 kDa in rat liver cytosol that migrated to the same position as the purified ASTP protein by SDS-PAGE, and an additional minor band of about 50 kDa. Monospecific antibodies purified from the IgG fraction using the antigen (the purified 48-kDa ASTP protein) immobilized on a polyvinylidene difluoride membrane also reacted with both the 48-kDa ASTP protein and the 50-kDa protein in rat liver cytosol, suggesting that this 50-kDa protein is immunologically related to the 48-kDa ASTP protein. Densitometric quantification of immunoblots demonstrated that the rat kidney cytosol contained ASTP protein at a concentration of about 20% of that of liver cytosol. Other tissues such as brain, skeletal muscle, heart, and lung, contained neither the ASTP protein nor the activity.
Assuntos
Trifosfato de Adenosina/farmacologia , Proteínas de Transporte , Proteínas de Ligação a DNA/análise , Animais , Especificidade de Anticorpos , Centrifugação com Gradiente de Concentração , Reações Cruzadas , Citosol/química , Glicerol Quinase , Immunoblotting , Imunoquímica , Rim/química , Fígado/química , Especificidade de Órgãos/fisiologia , RatosRESUMO
We previously purified macromolecular-translocation inhibitor-III (MTI-III), which inhibits the binding of the activated glucocorticoid-receptor complex (GR) to nuclei, to homogeneity from rat liver, and we found that the purified MTI-III bound to partially purified activated GR under low salt conditions at slightly acidic pH [Liu, G., Okamoto, K., and Isohashi, F. (1993) Eur. J. Biochem. 218, 679-687]. This was the first direct evidence that the inhibitor acts through a direct interaction with the activated GR. In this study, we examined whether the purified MTI-III could interfere with the binding of GR to a DNA fragment containing a specific glucocorticoid-response element (GRE). Under nearly isotonic salt conditions at neutral pH, the activated GR bound to the GRE but not to nonspecific DNA. Under similar conditions, the activated GR also bound to the purified MTI-III. The resulting GR/MTI-III complex did not bind to the GRE. We also found that addition of MTI-III to the GR/GRE complex resulted in time-dependent disruption of the GR/GRE complex and formation of the GR/MTI-III complex. The half-life of the GR/GRE complex in the presence of MTI-III was about 13 min. These results suggest that MTI-III enhances the release of GR from the GR/GRE complex and immediately forms a stable GR/MTI-III complex.
Assuntos
Extratos Celulares , DNA/metabolismo , Substâncias Macromoleculares , Receptores de Glucocorticoides/metabolismo , Sequências Reguladoras de Ácido Nucleico , Animais , Sequência de Bases , Concentração de Íons de Hidrogênio , Técnicas In Vitro , Fígado/metabolismo , Masculino , Dados de Sequência Molecular , Ligação Proteica , Ratos , Triancinolona Acetonida/metabolismoRESUMO
We investigated changes in whole-cell currents, cell volume, and intracellular calcium concentration ([Ca2+]i) during hypotonic stimulation in whole-cell clamped cultured amphibian renal cells (A6 cells). Upon being exposed to hypotonic solution (80% osmolality), the A6 cells swelled and peaked in the first 5 min, which was followed by a progressive decrease in cell volume termed regulatory volume decrease (RVD). Following the cell swelling, there were large increases in both outward- and inward-currents, which seemed to be carried by K+ efflux and Cl- efflux, respectively. A K+ channel blocker (TEA or quinine) or a Cl- channel blocker (NPPB or SITS) significantly inhibited both currents and RVD, suggesting that the inward- and outward-currents are highly correlated with each other and essential to RVD. Hypotonic stimulation also induced a transient [Ca2+]i increase, of which the time course was essentially similar to that of the currents. When internal and external Ca2+ were deprived to eliminate the Ca2+ transient increase, whole-cell currents and RVD were strongly inhibited. On the other hand, channel blockers TEA and NPPB, which inhibited whole-cell currents and RVD, did not inhibit the [Ca2+]i increase. It is concluded that hypotonic stimulation to A6 cells first induces cell swelling, which is followed by [Ca2+]i increase that leads to the coactivation of K+ and Cl- channels. This coactivation may accelerate K+ and Cl- effluxes, resulting in RVD.
Assuntos
Bloqueadores dos Canais de Cálcio/farmacologia , Cálcio/metabolismo , Tamanho Celular/efeitos dos fármacos , Citoplasma/metabolismo , Soluções Hipotônicas/farmacologia , Animais , Linhagem Celular , Canais de Cloreto/antagonistas & inibidores , Citoplasma/efeitos dos fármacos , Concentração Osmolar , Técnicas de Patch-Clamp , Bloqueadores dos Canais de Potássio , Xenopus laevisRESUMO
Acetylsalvianolic acid A (ASAA) is an semisynthetic analogue of salvianolic acid A, isolated from Danshen (Salvia miltiorrhiza Bunge). In in vitro experiments, ASAA showed marked inhibitory effect on rat and rabbit platelet aggregation induced by ADP, collagen, arachidonic acid (AA) and thrombin. In ex vivo experiments with ADP, collagen, and AA as inducers, ASAA was also shown to inhibit platelet aggregation remarkably. The effect lasted more than two hours. In addition, ASAA was found to have suppressive effect on collagen induced platelet 5-HT release while inhibiting aggregation. The above results seemed to suggest that ASAA may be a widely effective inhibitor of platelet function.
Assuntos
Ácidos Cafeicos/farmacologia , Lactatos/farmacologia , Inibidores da Agregação Plaquetária/farmacologia , Agregação Plaquetária/efeitos dos fármacos , Animais , Plaquetas/metabolismo , Masculino , Coelhos , Ratos , Serotonina/sangueRESUMO
With radio thin layer chromatography and autoradiogram, the effect of acetylsalvianolic acid A (ASAA) on 14C-arachidonic metabolism by platelets was studied in vitro. ASAA was found to enhance the formation of PGE2 and PGF2 alpha remarkably while inhibiting the formation of TXB2. However, it showed no effect on the formation of 12-HETE and arachidonic utility rate. Therefore, we deduce that ASAA may be a thromboxane synthetase inhibitor.
Assuntos
Ácidos Cafeicos/farmacologia , Lactatos/farmacologia , Tromboxano-A Sintase/antagonistas & inibidores , Tromboxanos/metabolismo , Animais , Plaquetas/metabolismo , Dinoprosta/metabolismo , Dinoprostona/metabolismo , CoelhosRESUMO
Sodium ferulate (SF) is one of the antiplatelet ingredients in Radix Angleica sinensis. The effect of SF on 14C-arachidonic acid metabolism in washed intact rabbit platelets was studied with radiochromatography and radioautography. SF (0.1-3.2 mmol/L) inhibited the generation of platelet thromboxane B2 in a dose-dependent manner (reduced by 16.7-93.8%) and the IC50 was shown to be 0.762 mmol/L. Simultaneously with the reduction of TXB2 generation, the formation of PGE2 and PGF2 alpha was also reduced significantly after treatment with SF. Using radioimmunoassay SF (0.145-2.32 mmol/L) was found to inhibit rabbit platelet TXB2 formation in a dose-dependent manner. SF (0.58-2.32 mmol/L) also suppressed aortic tissue 6-keto-PGF1 alpha generation in rabbits. At the same concentrations the inhibitory effect of SF on platelet TXB2 formation was greater than that on aortic tissue 6-keto-PGF1 alpha generation. These results indicate that the cyclo-oxygenase activity may be inhibited by SF.