Food-derived peptides unleashed: emerging roles as food additives beyond bioactivities.

Innovating food additives stands as a cornerstone for the sustainable evolution of future food systems. Peptides derived from food proteins exhibit a rich array of physicochemical and biological attributes crucial for preserving the appearance, flavor, texture, and nutritional integrity of foods. Leveraging these peptides as raw materials holds great promise for the development of novel food additives. While numerous studies underscore the potential of peptides as food additives, existing reviews predominantly focus on their biotic applications, leaving a notable gap in the discourse around their abiotic functionalities, such as their physicochemical properties. Addressing this gap, this review offers a comprehensive survey of peptide-derived food additives in food systems, accentuating the application of peptides' abiotic properties. It furnishes a thorough exploration of the underlying mechanisms and diverse applications of peptide-derived food additives, while also delineating the challenges encountered and prospects for future applications. This well-time review will set the stage for a deeper understanding of peptide-derived food additives.

Extraction and application of lipids from edible insects.

Research on new food sources is a worldwide challenge due to the constant increase in the global population. In this scenario, insects and bug based products have been investigated as feasible food alternatives. They are nutritionally healthy and environmentally sustainable. Eating insects (entomophagy) or utilizing their macronutrients in food formulations can efficiently solve the demand for nutritious food. The benefits of insect-based foods are reported in the literature, mainly because they are viable sources of fat (∼38%) and proteins (∼68%). Fats and oils are recognized as essential nutrients in human nutrition, as they provide a concentrated source of energy and act as structural components of cell membranes and signaling pathways. The high levels of fats/oils of edible insects open the perspective in the food industry to be used as ingredients in the enrichment of several products, such as cookies, biscuits, butter, and margarine, among others, thus contributing to consumer acceptance. Insect fat/oil can be obtained using extraction techniques, such as solvent and supercritical CO2 methods. The method depends on the insect species, fat/oil yield, and process costs. Thus, this review aims to provide current information on the consumption, application, and extraction of edible insect oils.

A systematic literature review and future research agenda to study consumer acceptance of novel foods and beverages.

In response to the rising global demand for healthier and more sustainable food resources, novel and unconventional food and beverages are being developed and incorporated into our diets. However, existing literature provides a limited understanding of consumers' acceptance of these innovations. This study undertakes a systematic literature review to examine the dynamics between consumers and novel foods and beverages. The objectives are to uncover the factors that influence consumer choices of these products, identify future research needs, and contribute to the development of effective marketing strategies for novel food and beverage adoption. This systematic review analyses 99 research papers, selected from an initial pool of 4,280, sourced from Scopus and Web of Science databases. The papers were published between 2011 and 2023 in journals listed by Australian Business Deans Council and classified as Q1 in the SJR journal ranking. The articles have been reviewed using PRISMA (Preferred Reporting Items for Systematic Reviews and Meta-Analysis) protocol and TCCM (Theory, Context, Characteristics and Methodology) framework. The findings highlight a reliance on data-driven methods and suggest that integrating relevant theories could enhance future research outcomes. Most studies focused on the acceptance of technology-based innovations in developed countries, indicating a need to explore novel foods and beverages in developing regions. Consumer-related factors, especially psychological aspects, were the primary focus, suggesting opportunities to investigate additional variables, such as product-related and situational factors, that influence acceptance. Finally, the predominance of quantitative research indicates a potential benefit in incorporating qualitative and multi-method approaches to gain deeper insights into consumer attitudes and motivations.

Cultivating curiosity: Consumer responses to ethical and product benefits in cultured foods.

Cultured foods have the potential to profoundly transform the food industry. However, most current research focuses on cultured meat, neglecting other cultured products and begging the question of whether different promotional approaches are suited for certain types of cultured food products than others. To bridge this knowledge gap, we carried out two studies to explore how product type (cultured meat vs. cultured fruit) and benefit type (ethical vs. product attributes such as sensory and nutritional advantages) interact in determining consumers' willingness to try the products. Study 1 findings indicate that emphasizing ethical benefits is more effective for promoting cultured meat, whereas highlighting product benefits is more effective for promoting cultured fruit. We found that curiosity, a strong behavioral motivator, mediates the interactive effect of product type and benefit type on willingness to try. This research underscores the need for marketing messages to be tailored to the distinct cultured product types and enriches the literature on curiosity as an important mechanism in the context of cultured food acceptance.

Consumers of insect-based foods: a cross-cultural study between Belgium and Gabon.

Human consumption of insects has previously been examined in cross-cultural studies. However, such studies rarely include African countries and willingness-to-pay for insect-based food has never been assessed in cross-cultural studies. The current study presents a cross-cultural study conducted with 409 urban dwellers from Belgium (191 males; 218 females) and 412 urban dwellers from Gabon (219 males; 193 females). Each respondent was surveyed with a questionnaire following the Knowledge, Attitude, and Practices model and included questions relative to willingness-to-pay for 2 insect-based foods (insect baguette and insect burger). More than 90% of respondents from both countries were familiar with edible insects. However, acceptance of entomophagy was lower in respondents from Gabon than in respondents from Belgium. Intercultural differences were also recorded between Gabonese ethnic groups. Most respondents who accepted entomophagy were willing to eat the insect baguette and/or the insect burger. These findings confirm that entomophagy could further develop in Belgium and Gabon. Willingness-to-pay varied between countries and between insect-based foods. In Belgium, the average prices of comparable conventional foods (i.e., same foods but without insects) were lower than the average willingness-to-pay for insect-based foods. In Gabon, respondents were not willing to pay extra for insect-based foods. Setting the right price for insect-based foods is a necessary step to promote more frequent insect consumption.

A review on the safety of growth factors commonly used in cultivated meat production.

Growth factors are commonly added to cell culture media in cellular agriculture to mimic the endogenous process of proliferation and differentiation of cells. Many of these growth factors are endogenous to humans and known to be present in the edible tissues and milk of food animals. However, there is little or no information on the use of growth factors intentionally added in food production before the advent of cultivated meat. Ten commonly used growth factors have been reviewed to include information on their mode of action, bioavailability, occurrence in food and food animals, endogenous levels in humans, as well as exposure and toxicological information drawn from relevant animal studies and human clinical trials with a focus on oral exposure. In addition, a comparison of homology of growth factors was done to compare the sequence homology of growth factors from humans and domestic animal species commonly consumed as food, such as bovine, porcine, and poultry. This information has been gathered as the starting point to determine the safety of use of growth factors in cultivated meat meant for human consumption. The change in levels of growth factors measured in human milk and bovine milk after pasteurization and high-temperature treatment is discussed to give an indication of how commercial food processing can affect the levels of growth factors in food. The concept of substantial equivalence is also discussed together with a conservative exposure estimation. More work on how to integrate in silico assessments into the routine safety assessment of growth factors is needed.

Allergic to bureaucracy? Regulatory allergenicity assessments of novel food: Motivations, challenges, compromises, and possibilities.

New sources of proteins are essential to meet the demands of the growing world population and evolving food trends. Assessing the allergenicity of proteins in novel food (NF) poses a significant food safety regulatory challenge. The Codex Alimentarius Commission presented an allergenicity assessment protocol for genetically modified (GM) foods, which can also be adapted for NF. Since no single laboratory test can adequately predict the allergenic potential of NF, the protocol follows a weight-of-evidence approach, evaluated by experts, as part of a risk management process. Regulatory bodies worldwide have adopted this safety protocol, which, among other things, promotes global harmonization. This review unravels the reliability and various motivations, terms, concepts, and approaches of allergenicity assessments, aiming to enhance understanding among manufacturers and the public. Health Canada, Food Safety Commission JAPAN, and Food Standards Australia New Zealand were surveyed, focusing on the European Food Safety Authority and the US Food Safety Administration for examples of scientific opinions regarding allergenicity assessments for novel and GM foods, from 2019 to 2023. According to our findings, current regulatory allergenicity assessments for NF approval primarily rely on literature reviews. Only a few of the NF assessments proactively presented additional tests. We recommend conducting bioinformatic analyses on NF when a panel of experts deems that there is insufficient prior scientific research.

[Microbiological and parasitological risk analysis of novel food sources obtained with the use of insects].

The problem of food safety being an important component of the country's food security, provides not only for continuous improvement of the methodology of hygienic standardization, but also for the formation of requirements for novel food, in particular, those obtained from non-traditional sources. The accumulated practical and theoretical competence in the food hygiene area, as well as knowledge of current trends of the food base broadening, allow us to analyze the risks associated with novel food obtained of insects. The purpose of the research was to analyze the microbiological and parasitological risk of novel food sources obtained with the use of insects, suggest the effective risk management measures. Material and methods. The analytical part of the work included literature search, collection of information and statistical materials published in domestic and foreign scientific editions. The search was carried out using the Google Academy retrieval system and electronic databases (PubMed, MEDLINE, EMBASE, Scopus, Web of Science, eLIBRARY), mainly in the last 25 years, using the keywords: Hermetia illucens, Tenebrio molitor, Acheta domesticus, insects, parasite, nematode, pathogen, cysts. Results. Based on the published materials' analysis, a systematization of microbiological and parasitological factors potentially capable of colonizing edible insects has been carried out. There were identified representatives of 24 groups of pathogenic and 18 opportunistic microorganisms and helminths related to microbial and parasitic pathogens, the spread of which is significantly influenced by inappropriate conditions of feeding and keeping insects. As there are currently no veterinary requirements for insect breeding and farming conditions, contamination of end products with infectious and parasitic pathogens can vary over a very wide range. Conclusion. The use of native insect biomass carries certain risks associated with its microbial and parasitic contamination, and the development of measures to prevent them requires significant resources. The possibility of deep processing of such raw materials can be considered as one of the solutions to mitigate these risks. For use in the food industry, insects should be subjected to processing similar to that currently used for soybean seeds, which includes separation of protein (entomoprotein), fat and chitin fractions, each of which would have an independent use. Thus, at present, insects should be considered as a source of novel food ingredients, first of all, complete protein of animal origin.

Utilizing proteomics to identify and optimize microalgae strains for high-quality dietary protein: a review.

Algae-derived protein has immense potential to provide high-quality protein foods for the expanding human population. To meet its potential, a broad range of scientific tools are required to identify optimal algal strains from the hundreds of thousands available and identify ideal growing conditions for strains that produce high-quality protein with functional benefits. A research pipeline that includes proteomics can provide a deeper interpretation of microalgal composition and biochemistry in the pursuit of these goals. To date, proteomic investigations have largely focused on pathways that involve lipid production in selected microalgae species. Herein, we report the current state of microalgal proteome measurement and discuss promising approaches for the development of protein-containing food products derived from algae.

'My voice, my choice': Impact of food technology conditions and message framing on sense of agency and purchase intent.

Evaluations consumers apply towards the way food technologies are framed is an important overlooked domain of food communication and advertising. We explore two distinct conditions of food technologies-technologies that manipulate external environments (i.e., robotics) and technologies that manipulate food internally (i.e., gene editing). The current research demonstrates that food manipulated in an external environment (vs. internal manipulation) has higher purchase intent (Study 1). Further, we explore how food technologies may be framed differently in messages to influence consumers' sense of agency. Study 2 demonstrates that food technologies that manipulate the food environment induce a higher sense of agency, whilst in contrast food technologies that manipulate food internally influence a lower sense of agency, impacting purchase intent. Study 3 explores a unique way in which sense of agency can be increased for food technologies with internal manipulations through framing the technology as agency-supportive. Investigating the impact of food technologies and how they may be framed to influence consumer psychology, and more specifically sense of agency, has rarely been explored. However, as food technologies have important upstream consequences on downstream advertising, their role on consumer psychology warrants investigation.

Precision cellular agriculture: The future role of recombinantly expressed protein as food.

Cellular agriculture is a rapidly emerging field, within which cultured meat has attracted the majority of media attention in recent years. An equally promising area of cellular agriculture, and one that has produced far more actual food ingredients that have been incorporated into commercially available products, is the use of cellular hosts to produce soluble proteins, herein referred to as precision cellular agriculture (PCAg). In PCAg, specific animal- or plant-sourced proteins are expressed recombinantly in unicellular hosts-the majority of which are yeast-and harvested for food use. The numerous advantages of PCAg over traditional agriculture, including a smaller carbon footprint and more consistent products, have led to extensive research on its utility. This review is the first to survey proteins currently being expressed using PCAg for food purposes. A growing number of viable expression hosts and recent advances for increased protein yields and process optimization have led to its application for producing milk, egg, and muscle proteins; plant hemoglobin; sweet-tasting plant proteins; and ice-binding proteins. Current knowledge gaps present research opportunities for optimizing expression hosts, tailoring posttranslational modifications, and expanding the scope of proteins produced. Considerations for the expansion of PCAg and its implications on food regulation, society, ethics, and the environment are also discussed. Considering the current trajectory of PCAg, food proteins from any biological source can likely be expressed recombinantly and used as purified food ingredients to create novel and tailored food products.

[Alternative protein sources: bacteria Methylococcus capsulatus concentrate, characteristic of composition and biological value].

A promising growth vector of food protein production in the context of the Russian Federation's food sovereignty security is the use of microbial synthesis. Taking into consideration the proven promising use of biotechnological processes in the production of alternative protein sources, modern scientific research is focused, among other issues, on improving the technology of obtaining food microbial protein using a variety of substrates and strains-producers, as well as evaluating the consumer properties, food, biological value and safety of such products. The purpose of the research was to study and comparatively evaluate protein concentrate (PC) from bacteria Methylococcus capsulatus and basic food of animal and plant origin within the development of the technology of optimal in nutritional and biological value PC production. Material and methods. Analysis of the nutritional and biological value of PC obtained from denucleinized and purified from cell walls biomass of methanoxidizing bacteria Methylococcus capsulatus (strain GSB-15) was carried out on 46 indicators, including estimation of protein content and amino acid composition, fat content and fatty acid composition, ash and moisture. Biological studies based on measuring of net protein ratio / net protein utilization were performed on 28 growing (between 25-50 days of life) male Wistar rats. Rats in the control group (n=14) received a semi-synthetic casein diet with a protein content of ~12% in calories, the test group (n=14) received a diet including an equivalent amount of PC protein. Body weight, feed intake, and fecal and urine nitrogen losses were measured during the experiment. The biological value and digestibility of protein were judged by coefficients of protein efficiency ratio, net protein ratio, true protein digestibility, true protein biological value, true net protein utilization. Results. The nutritional value study of PC showed high protein content - 69.0%, the share of fat, moisture and ash, accounted for 0.17, 9.5 and 14.4%, respectively. The carbohydrate content was 7.0% (of which mono- and disaccharides were <0.1%). The results of a comparative assessment of Methylococcus capsulatus protein amino acid profile and basic food of animal and plant origin showed a balanced content of the most amino acids, the level of which is comparable with the protein of chicken egg, which is traditionally a standard of quality of complete protein. At the same time, the content of the essential amino acid tryptophan in PC was an order of magnitude lower than in chicken egg protein; the content of this amino acid in PC is comparable with incomplete plant proteins (sunflower, flax, rapeseed). The results of the biological value evaluation of the Methylococcus capsulatus protein in the experiment on rats indicate a relatively low biological value of the microbial synthesis protein, that is caused, most likely, by tryptophan deficiency. Rats of the test group had a significant decrease in body weight gain, feed/protein intake, coefficient of protein efficiency ratio, coefficient of net protein ratio, true protein biological value, true net protein utilization. Conclusion. The results of a comparative evaluation of PC from methanotrophic bacteria Methylococcus capsulatus denucleinized biomass and basic food of animal and plant origin indicate its relatively high nutritional value. However, the characteristics of this PC sample were not optimal in regard of protein biological value by reason of tryptophan deficiency. A single amino acid deficiency is not a valid argument for not using microbially synthesized protein in human nutrition, considering the capabilities of the modern food industry, including ways to enrich foodstuffs with missing components. In addition, there is every cause to believe that adjusting the hydrolysis technology used in the production of PC will allow to eliminate the essential amino acid loss, thereby increasing the biological value of this product.

[Comparative characteristics of the amino acid composition of protein from traditional sources and entomoprotein: calculated data].

The growth of the world population leads to an increase in demand for food consumption. Along with the projected reduction in demand for meat products, a search is underway for a new type of food ("novel food"), one of the promising options for which are insects. In 2023 the European Commission has registered flour made from house cricket (Acheta domesticus) as a "novel food" for human consumption. Currently, the amino acid composition of both new types of food and the diet that includes them is not regulated. Accordingly, the potential amino acid imbalance in the diet when entomoprotein is included need to be further investigated. The aim of the study was to characterize the amino acid composition of a simulated diet using protein obtained from house cricket. Material and methods. To assess the balance of diets in terms of amino acid composition, a comparative analysis was made of the actual diet containing protein from traditional foods (scenario 1) and the diet with the likely replacement of beef, pork and poultry with a product containing A. domesticus protein (entomoprotein) (scenario 2). The volume of food consumption has been calculated based on the results of the assessment of a sample survey of household budgets. The study included foods with an established value of annual consumption, that was calculated as daily consumption. The content of essential amino acids in food sources of protein, as well as in the domestic cricket protein, was evaluated using the data from relevant sources. Dietary balance was assessed by calculating its digestibility using data on amino acid scoring, the utility of essential amino acids, the excess content of individual essential amino acids, and the comparable excess content of essential amino acids. Results. We determined the daily consumption volumes of basic foods, formed consumption scenarios, including with the potential use of a protein product based on entomoprotein. Comparative analysis of the amino acid composition of the diet showed significantly higher content (from 1.4 up to 2.9 times) of amino acids in the diet in scenario 2. The results of calculating the amino acid score and utility coefficient showed that a diet using entomoprotein could provide a better usage of amino acids for protein synthesis compared to the «traditional¼ diet, however, the digestibility of protein from the traditional diet is higher compared to entomoprotein (96.8 vs 89.1%). Conclusion. Despite the fact that the utility of essential amino acids in the scenario of replacing meat products with a product containing A. domesticus entomoprotein is higher, while the digestibility of protein is lower, the differences identified are insignificant.

[Monitoring methods for novel insect-derived food: the PCR protocol for the detection and identification of Hermetia Illucens insects based on the HEI-COI probe and primer system].

Forwarding development of identification methods for novel foods, derived from edible insects, is necessary to ensure control over their marketing within the framework of the current legislation's requirements. The purpose of the research was the development and validation of a monoplex TaqMan-PCR assay protocol (a real-time polymerase chain reaction with TaqMan technology) for the insect Hermetia Illucens' taxon-specific DNA detection and identification in food raw materials and foods. Material and methods. Studies were performed using samples containing the target DNA sequence (dried whole larvae of H. Illucens as well as H. Illucens in oilcake meal and powdered capsule forms) and inherently not containing the target DNA sequence (other insect species, mammals, plants, microorganisms as well as multicomponent food: meat, dairy and plant food). DNA extraction and purification were performed by CTAB methods [commercial kits "Sorb-GMO-B" (Syntol, Russia) and "DNeasy mericon Food Kit" (QIAGEN, Germany)]. For amplification of the target sequence, which was a fragment of the cytochrome c oxidase subunit I mitochondrial gene, we used primers and the probe: Hei-COI-F (CCTGAGCTGGTATAGTGGGAAC); Hei-COI-R (AATTTGGTCATCTCCAATTAAGC); Hei-COI-P (FAM-CGAGCCGAATTAGGTCATCCAGG-BHQ-1). PCR conditions were optimized using CFX96TM Real-Time PCR System (Bio-Rad, USA) and Rotor-Gene Q (QIAGEN, Germany) amplifiers by empirical selection of primer and probe concentrations and amplification of the time/temperature profile. Specificity and limit of detection were evaluated as part of method validation. Results and discussion. The optimized reaction mixture included 2.5-fold of Master Mix B [KCl, TrisCl (pH 8.8), 6.25 mM MgCl2], SynTaq DNA-polymerase, dNTP, glycerol, Tween 20, of each primers - 550 nM, probe - 100 nM. The time/temperature profile of the reaction: 95 °C - 180 s (95 °C - 15 s, 57 °C - 60 s), 40 cycles. The detection limit of the method was 0.19 ng of H. illucens DNA per reaction. The specificity of primer system and probe were experimentally confirmed in studies with DNA of other insects, animals, plants and microorganisms. Conclusion. A protocol of a monoplex TaqMan-PCR assay for the taxon-specific DNA of insect Hermetia Illucens' detection and identification in food raw materials and foods has been developed. Validity of the method has been confirmed by laboratory tests which allows to recommend it for use in surveillance of Hermetia Illucens-derived raw materials.

Trends in functional food development with three-dimensional (3D) food printing technology: prospects for value-added traditionally processed food products.

One of the recent, innovative, and digital food revolutions gradually gaining acceptance is three-dimensional food printing (3DFP), an additive technique used to develop products, with the possibility of obtaining foods with complex geometries. Recent interest in this technology has opened the possibilities of complementing existing processes with 3DFP for better value addition. Fermentation and malting are age-long traditional food processes known to improve food value, functionality, and beneficial health constituents. Several studies have demonstrated the applicability of 3D printing to manufacture varieties of food constructs, especially cereal-based, from root and tubers, fruit and vegetables as well as milk and milk products, with potential for much more value-added products. This review discusses the extrusion-based 3D printing of foods and the major factors affecting the process development of successful edible 3D structures. Though some novel food products have emanated from 3DFP, considering the beneficial effects of traditional food processes, particularly fermentation and malting in food, concerted efforts should also be directed toward developing 3D products using substrates from these conventional techniques. Such experimental findings will significantly promote the availability of minimally processed, affordable, and convenient meals customized in complex geometric structures with enhanced functional and nutritional values.

Baobab-Fruit Shell and Fibrous Filaments Are Sources of Antioxidant Dietary Fibers.

Since 2008, baobab-fruit dried pulp is listed as an ingredient on the European Union's Novel Food Catalogue. By pulp production, 80% of the baobab fruit is discarded, forming side streams, namely, shell, fibrous filaments, and seeds. This study explored pulp and side-stream functional properties, including total dietary fiber (TDF), total antioxidant capacity (TAC), polyphenols, and water- (WHC) and oil-holding capacities (OHC), along with endocannabinoids (ECs) and N-acylethanolamines (NAEs) in pulp, seeds, and seed oil. Shell excelled in TDF (85%), followed by fibrous filaments (79%), and showed the highest soluble and direct TAC (72 ± 0.7 and 525 ± 1.0 µmol eq. Trolox/g, respectively). Pulp was the richest in polyphenols, followed by shell, fibrous filaments, and seeds. Quercetin predominated in shell (438.7 ± 2.5 µg/g); whereas epicatechin predominated in pulp (514 ± 5.7 µg/g), fibrous filaments (197.2 ± 0.1 µg/g), and seeds (120.1 ± 0.6 µg/g); followed by procyanidin B2 that accounted for 26-40% of total polyphenols in all the products. WHC and OHC ranged between 2-7 g H2O-Oil/g, with fibrous filaments showing the highest values. ECs were not found, whereas NAEs were abundant in seed oil (2408.7 ± 11.1 ng/g). Baobab shell and fibrous filaments are sources of polyphenols and antioxidant dietary fibers, which support their use as functional food ingredients.

Toxicological Assessment of Roasted Coffee Silver Skin (Testa of Coffea sp.) as Novel Food Ingredient.

Roasted coffee silver skin is a coffee by-product, the uses of which are currently limited, e.g., as fertilizer, for energy production, or animal feed. Due to a low content of fat and carbohydrates combined with a high content of fiber, polyphenols and proteins, roasted silver skin is a valuable possible food ingredient. Potential applications include partial flour replacement in bakery products, as antioxidant and providing protein or fiber sources in sports or functional foods. As no relevant consumption of isolated silver skin occurred before 1997 in the European Union (EU), it was classified as a novel food in need of premarketing approval. Novel food applications must meet legal requirements for compositional and toxicological information. This review presents information on silver skin composition and toxicological studies. Several in vitro studies and subchronic in vivo studies are available with negative results, not suggesting a need for further studies on carcinogenic effects, reproduction, or chronic toxicity. All available studies so far concluded that no toxic effects of silver skin were found or are to be expected. For a novel food application in the EU, further in vitro studies on mutagenic potential may be needed to close a formal data gap.

Risk Assessment of Coffee Cherry (Cascara) Fruit Products for Flour Replacement and Other Alternative Food Uses.

Coffee bean harvesting incurs various by-products known for their long traditional use. However, they often still end up being a waste instead of being used to their full potential. On the European market, coffee cherry (cascara) products are not yet common, and a novel food approval for beverages made from coffee cherry pulp was issued only recently. In this article, exposure and risk assessment of various products such as juice, jam, jelly, puree, and flour made from coffee cherry pulp and husk are reviewed. Since caffeine in particular, as a bioactive ingredient, is considered a limiting factor, safe intake will be derived for different age groups, showing that even adolescents could consume limited quantities without adverse health effects. Moreover, the composition can be influenced by harvesting methods and processing steps. Most interestingly, dried and powdered coffee cherry can substitute the flour in bakery products by up to 15% without losing baking properties and sensory qualities. In particular, this use as a partial flour substitute is a possible approach to counteract rising grain prices, transport costs, and disrupted supply chains, which are caused by the Russia-Ukraine war and changing climatic conditions. Thus, the supply of affordable staple foods could be partially ensured for the inhabitants of countries that depend on imported wheat and cultivate coffee locally by harvesting both beans and by-products.

Novel Outbreak-Associated Food Vehicles, United States.

Novel outbreak-associated food vehicles (i.e., foods not implicated in past outbreaks) can emerge as a result of evolving pathogens and changing consumption trends. To identify these foods, we examined data from the Centers for Disease Control and Prevention Foodborne Disease Outbreak Surveillance System and found 14,216 reported outbreaks with information on implicated foods. We compared foods implicated in outbreaks during 2007-2016 with those implicated in outbreaks during 1973-2006. We identified 28 novel food vehicles, of which the most common types were fish, nuts, fruits, and vegetables; one third were imported. Compared with other outbreaks, those associated with novel food vehicles were more likely to involve illnesses in multiple states and food recalls and were larger in terms of cases, hospitalizations, and deaths. Two thirds of novel foods did not require cooking after purchase. Prevention efforts targeting novel foods cannot rely solely on consumer education but require industry preventive measures.

Newly defined allergens in the WHO/IUIS Allergen Nomenclature Database during 01/2019-03/2021.

The WHO/IUIS Allergen Nomenclature Database (http://allergen.org) provides up-to-date expert-reviewed data on newly discovered allergens and their unambiguous nomenclature to allergen researchers worldwide. This review discusses the 106 allergens that were accepted by the Allergen Nomenclature Sub-Committee between 01/2019 and 03/2021. Information about protein family membership, patient cohorts, and assays used for allergen characterization is summarized. A first allergenic fungal triosephosphate isomerase, Asp t 36, was discovered in Aspergillus terreus. Plant allergens contained 1 contact, 38 respiratory, and 16 food allergens. Can s 4 from Indian hemp was identified as the first allergenic oxygen-evolving enhancer protein 2 and Cic a 1 from chickpeas as the first allergenic group 4 late embryogenesis abundant protein. Among the animal allergens were 19 respiratory, 28 food, and 3 venom allergens. Important discoveries include Rap v 2, an allergenic paramyosin in molluscs, and Sal s 4 and Pan h 4, allergenic fish tropomyosins. Paramyosins and tropomyosins were previously known mainly as arthropod allergens. Collagens from barramundi, Lat c 6, and salmon, Sal s 6, were the first members from the collagen superfamily added to the database. In summary, the addition of 106 new allergens to the previously listed 930 allergens reflects the continuous linear growth of the allergen database. In addition, 17 newly described allergen sources were included.