Your browser doesn't support javascript.
loading
تبين: 20 | 50 | 100
النتائج 1 - 20 de 70
المحددات
1.
مقالة ي صينى | WPRIM | ID: wpr-1007223

الملخص

The set of guidelines for the diagnosis and treatment of thyroid nodules and differentiated thyroid cancer (the second edition) was published in 2023 in China. Based on the first (2012) edition, the current set was revised jointly by nearly 100 experts in endocrinology, thyroid surgery, oncology, nuclear medicine, ultrasound medicine, and pathology from seven national societies for one year. The new version of the guideline is still divided into two parts, namely, thyroid nodules and differentiated thyroid cancer. The writing mode of asking clinical questions, explaining and giving recommendations is adopted, and a total of 117 recommendations are provided. This article aims to compare the variations in the differentiation of benign and malignant thyroid nodules and surgical treatment of differentiated thyroid cancer between the new and old versions from the perspective of surgery. The author's own understanding and experiences are also discussed.

2.
مقالة ي صينى | WPRIM | ID: wpr-1031065

الملخص

【Objective】 To explore the effect of physical fitness training on social adaptive behavior of children with global developmental delay (GDD), in order to provide treatment experience for GDD children. 【Methods】 From November 2021 to December 2022, a total of 60 children with GDD diagnosed and treated in the Third Affiliated Hospital of Jiamusi University were enrolled in this study, and were randomly divided into control group (n=30) and test group (n=30).The control group received routine rehabilitation treatment, and the test group received physical fitness training additionally.The intervention lasted for 12 weeks, with the frequency of 3times/week, 30min/time.All subjects were tested for physical fitness and children′s social adaptive behavior before and after training. 【Results】 Before treatment, the difference between the results of physical fitness test and social adaptive behavior scores of the GDD children in two groups was not statistically significant (P>0.05).After 3 months of treatment, the physical fitness test scores, except body mass index (BMI), and social adaptive behavior scores of the GDD children in two groups were significantly different from those before treatment (P<0.05), and the physical fitness test scores (except for height, weight and BMI) and the social adaptive behavior of the test group were better than those of the control group (t=2.363,4.020,3.331,3.338,P<0.05). 【Conclusion】 Physical fitness training can significantly improve the adaptive behavior, independent function, cognitive function and social/self-control ability of GDD children.

3.
International Eye Science ; (12): 473-478, 2024.
مقالة ي صينى | WPRIM | ID: wpr-1011404

الملخص

AIM: To observe the distribution of cone in the macular of healthy adult in different ages using adaptive optics scanning laser ophthalmoscope(AO-SLO)system, and analyze its relationship with age.METHODS: A total of 100 healthy examinees(200 eyes)in our hospital from June to July 2023 were selected, and they were divided into four groups according to their age, with 25 cases(50 eyes)in each group, including 18-30 years in group A, 31-40 years in group B, 41-50 years in group C, 51-65 years in group D. AO-SLO was performed in both eyes and cone density was measured.RESULTS: The density of cone in the foveal eccentricity of 3° and 2.4°×2.4° in each group was different(P&#x003C;0.001), and the cone density in each area showed a relatively regular distribution characteristics, with the highest density in the temporal side, and the temporal&#x003E;nasal&#x003E;inferior&#x003E;superior sides from high to low. The mean cone density in the macular area of both eyes was 14 144.38±1 082.40, 13 241.24±535.32, 12 930.29±727.73, and 10 907.50±490.86 cell/mm2, respectively(P&#x003C;0.001), indicating that the cone density decreased with age. The correlation analysis showed that the mean cone density in the macular area was negatively correlated with age(r=-0.578, P&#x003C;0.001).CONCLUSION: AO-SLO is a quantitative non-invasive detection of cones, and there is a negative correlation between cone density and age in healthy human. Furthermore, density of cone in healthy people over 50 years was significantly decreased.

4.
Tianjin Medical Journal ; (12): 44-50, 2024.
مقالة ي صينى | WPRIM | ID: wpr-1020968

الملخص

Objective To construct an in vitro"metabolic memory"cell model of HT-22 mouse hippocampal neurons induced by high glucose,and to investigate the effect of"metabolic memory"on apoptosis and histone acetylation in HT-22 cells.Methods HT-22 cells were cultured in high glucose medium(glucose concentration was 55 mmol/L)and conventional glucose medium(glucose concentration was 25 mmol/L),and cells were divided into the control group(NG 4,6 and 8 groups,25 mmol/L glucose was cultured for 4,6 and 8 days,respectively),the high glucose group(HG 4,6 and 8 groups,respectively)and the metabolic memory group(HG2NG2,HG2NG4,HG2NG6,HG4NG2 and HG4NG4 groups,high glucose culture for 2 days to 25 mmol/L glucose culture for 2,4 or 6 days,high glucose culture for 4 days to 25 mmol/L glucose culture for 2 or 4 days).Cell viability was detected by CCK-8 method.The release of lactate dehydrogenase(LDH)in cell culture supernatant was detected,and the optimal time to establish a"metabolic memory"model was selected.Subsequently,cells were divided into the NG4 group,the NG8 group,the HG4 group,the HG4NG4 group and the HG8 group,and the cell morphology of each group was observed by optical microscope.The apoptosis rate was detected by flow cytometry.The activities of deacetylase(HDAC)and histone acetyltransferase(HAT)were detected by enzyme-linked immunosorbent assay(ELISA).Western blot assay was used to detect expression levels of histone deacetylase 4(HDAC4),B lymphocyte tumor 2(Bcl-2),Bcl-2 related X protein(Bax)and Caspase-3 protein.Results The HG4NG4 group was the ideal cell model with high glucose metabolic memory.Cells of the NG4 group and the NG8 group were interwoven into a dense network,growing well,with spindle shaped cells and distinct synaptic structures.However,in the HG4 group and the HG8 group,the cell body became round,synaptic structure disappeared and growth was inhibited.In the HG4NG4 group,the number of cells increased but their morphology was damaged.Results of flow cytometry showed that compared with the NG8 group,the apoptosis rates were significantly increased in the HG8 group and the HG4NG4 group(P<0.05).ELISA results showed that compared with the NG8 group,the expression levels of HDAC4,Bax,and Caspase-3 proteins increased in the HG8 group and the HG4NG4 group,while the expression level of Bcl-2 protein significantly decreased(P<0.05).Compared with the HG8 group,there were no significant differences in protein expression levels of HAT and HDAC in the HG4NG4 group.Western blot reslts showed that compared with the NG8 group,the levels of HDAC4,Bax and Caspase-3 protein increased in the HG8 group and the HG4NG4 group(P<0.05).Compared with the HG8 group,there were no significant differences in protein expression levels in the HG4NG4 group.Conclusion HT-22 mouse hippocampal neurons cultured with 55mmol/L high glucose for 4 days,and then cultured with 25 mmol/L glucose for 4 days are the ideal"metabolic memory"cell model.The mechanism may be related to the increased activity of HDAC,HAT and HDAC4 expression in the hyperglycemic model.

5.
مقالة ي صينى | WPRIM | ID: wpr-1021534

الملخص

BACKGROUND:Blood flow restriction training has broad application prospects in improving limb muscle strength.It has ideal effects on the upper limbs is ideal,and the specific application scheme has high research value. OBJECTIVE:To explain the influence of blood flow restriction training on the fitness benefits of upper limb muscles and summarize the specific programs of blood flow restriction training for upper limb,attempting to give suggestions on application programs based on existing studies. METHODS:Literature on the application of upper limb blood flow restriction training were searched in CNKI,WanFang,VIP,CBM,PubMed,Embase,EBSCO,Cochrane Library and Web of Science databases.The search terms were"blood flow restriction,blood flow restriction training,pressure training,upper limb,upper arm,forearm,arm,forearm"in Chinese and"blood flow restriction training,blood flow restriction exercise,blood flow restriction therapy,BFR therapy,occlusion training,KAATSU training,BFRT,upper extremity,upper limb,arm,forearm"in English.The relevant articles on the application of blood flow restriction training in the upper limbs included in the database from database inception to December 2022 were selected and screened according to inclusion criteria and exclusion criteria. RESULTS AND CONCLUSION:Firstly,blood flow restriction training is mainly applied to healthy people,special athletes and people with upper limb injury.Secondly,the influence of blood flow restriction training on upper limb muscle fitness is mainly reflected in the increase of upper limb circumference,muscle strength,muscle endurance,muscle thickness,muscle cross-sectional area and explosive power of upper limb,followed by the cross migration phenomenon of the upper limbs.Thirdly,blood flow restriction training for the upper limbs mainly uses inflatable blood flow restriction devices:the cuff width was 3-5 cm,the pressure position was 1/3 of the upper arm,the limiting pressure was 40%-60%arterial occlusion pressure or 80-160 mmHg,the training load is 20%-30%1RM,the training volume is four sessions(30-15-15-15 times),the interval time was 30-60 seconds,and the training frequency was 2 or 3 times per week.

6.
مقالة ي صينى | WPRIM | ID: wpr-1023138

الملخص

The occurrence of benign prostate hyperplasia(BPH)was related to disrupted sex steroid hormones,and metformin(Met)had a clinical response to sex steroid hormone-related gynaecological disease.How-ever,whether Met exerts an antiproliferative effect on BPH via sex steroid hormones remains unclear.Here,our clinical study showed that along with prostatic epithelial cell(PEC)proliferation,sex steroid hormones were dysregulated in the serum and prostate of BPH patients.As the major contributor to dysregulated sex steroid hormones,elevated dihydrotestosterone(DHT)had a significant positive rela-tionship with the clinical characteristics of BPH patients.Activation of adenosine 5'-monophosphate(AMP)-activated protein kinase(AMPK)by Met restored dysregulated sex steroid hormone homeostasis and exerted antiproliferative effects against DHT-induced proliferation by inhibiting the formation of androgen receptor(AR)-mediated Yes-associated protein(YAP1)-TEA domain transcription factor(TEAD4)heterodimers.Met's anti-proliferative effects were blocked by AMPK inhibitor or YAP1 over-expression in DHT-cultured BPH-1 cells.Our findings indicated that Met would be a promising clinical therapeutic approach for BPH by inhibiting dysregulated steroid hormone-induced PEC proliferation.

7.
Chinese Journal of Biotechnology ; (12): 4335-4357, 2023.
مقالة ي صينى | WPRIM | ID: wpr-1008029

الملخص

Biomanufacturing uses biological systems, including cells, microorganisms, and enzymes, to produce natural or synthetic molecules with biological activities for use in various industries, such as pharmaceuticals, cosmetics, and agriculture. These bioactive compounds are expected to play important roles in improving the quality of life and prolonging its length. Fortunately, recent advances in synthetic biology and automation technologies have accelerated the development of biomanufacturing, enabling us to create new products and replace conventional methods in a more sustainable manner. As of now, the role of biomanufacturing in the growth and innovation of bioeconomy is steadily increasing, and this techbology becomes a prevalent technology in global markets. To gain a comprehensive understanding of this field, this article presents a retrospective review of Bloomage Biotechnology's Research and Development and briefly reviews the developments of biomanufacturing and offers insights into the futre prospects. In conclusion, biomanufacturing will continue to be an important, environmentally friendly, and sustainable production mode in the ongoing development of bioeconomy.


الموضوعات
Quality of Life , Biotechnology , Agriculture , Synthetic Biology , Industry
8.
مقالة ي صينى | WPRIM | ID: wpr-984556

الملخص

Objective To investigate the effect and mechanism of astragaloside Ⅳ(AS-Ⅳ) activating ROCK/JNK to regulate autophagy in improving isoproterenol (ISO) induced myocardial fibrosis (MF) in mice. Methods The mice were randomly divided into control operation group (Control group), ISO induced myocardial fibrosis group (MF group), AS-Ⅳ treatment group (AS-Ⅳ group) and combination group of astragaloside IV and Y-33075 (ROCK inhibitor) (astragaloside IV+Y-33075 group). After repeated administration for 30 days. The serum levels of LDH, BNP, CTGF in each group were detected. The cardiac function was detected by ultrasound. Myocardial structure and tissue fibrosis degree in each group were detected by Sirius Red and Masson staining. Oxidative stress (ROS) levels in myocardial tissue of each group were detected by DHE staining and the expression of ROCK, JNK, Atg5, Beclin 1, and LC3 Ⅰ/Ⅱ in myocardial tissue were detected by Western blotting. Results Compared with AS-Ⅳ group, the EF value of AS-Ⅳ+Y-33075 group decreased and the degree of myocardial fibrosis increased (P<0.05). The serum level of LDH, BNP, CTGF increased and the level of ROS in myocardial tissue increased while the expression of ROCK, JNK, Atg5, Beclin 1, LC3 Ⅰ/Ⅱ decreased (P<0.05). Y-33075 could block the protective effect of AS-Ⅳ on myocardial injury induced by MF and inhibit the regulation of AS-Ⅳ on ROCK and JNK. Conclusion AS-Ⅳ could attenuate myocardial fibrosis in mice by activating ROCK/JNK signal and promoting autophagy.

9.
مقالة ي صينى | WPRIM | ID: wpr-1019441

الملخص

Objective:To investigate the correlation between levels of fibroblast growth factor-23 (FGF-23) and monocyte chemoattractant protein-1 (MCP-1) and glucocorticoids-induced osteoporosis (GIOP) in children.Methods:From May. 2018 to May. 2022, 80 children with glucocorticoid osteoporosis admitted to our hospital were selected as the study subjects, and the control group was 62 children who received glucocorticoid therapy but had normal bone mass. General data were collected and bone density and bone metabolism were measured, including type 1 collagen carboxy-terminal peptide (CTX-1), type 1 procollagen amino-terminal peptide (PINP), and osteocalcin (OC). The levels of MCP-1and FGF-23 in the serum of the two groups were detected, and univariate and multivariate analysis was performed using prism software to analyze the risk factors affecting GIOP.Results:There was no significant difference in general data between the two groups (both P>0.05). The levels of FGF-23 (264.81±24.61) and MCP-1 (194.16±15.76) in serum of GIOP children were significantly higher than those in the control group (207.97±9.91; 179.00±18.34) ( t=17.13, P < 0.001; t=5.29, P < 0.001) ; Compared with those of the control group (0.88±1.08; 23.98±2.45; 8.36±3.71; 4.56±2.21), bone mineral density (0.44±0.29), PINP (16.29±3.97) and OC (6.74±3.22) levels were decreased, and CTX-1 level was increased (6.62±1.11) ( t=3.58, P<0.05; t=13.40, P<0.05; t=2.78, P<0.05; t=7.25, P<0.05) of the study group. Multivariate Logistic regression model showed that FGF-23 ( OR=1.161, 95% CI: 1.080-1.341, P<0.05), MCP-1 ( OR=1.179, 95% CI: 1.044-1.448, P<0.05) and CTX-1 ( OR=3.018, 95% CI: 1.526-10.510, P<0.05) were independent clinical risk factors for GIOP in children (all P<0.05). PINP ( OR=0.453, 95% CI: 0.169-0.740, P<0.05) was a protective factor affecting GIOP in children. Conclusion:FGF-23 and MCP-1 were independent risk factors for GIOP in children.

10.
مقالة ي صينى | WPRIM | ID: wpr-990060

الملخص

Objective:To improve the understanding of progressive familial intrahepatic cholestasis type 4 (PFIC4).Methods:Clinical characteristics in a 10-year-old boy with PFIC4 at the Second Hospital of Hebei Medical University in February 2020 were retrospectively analyzed, and the TJP2 gene mutations were analyzed. Results:The proband was a 10-year-old boy with a slow onset of intrahepatic cholestasis[normal γ-glutamyl transpeptidase(GGT)], hepatosplenomegaly and hepatic fibrosis.Laboratory tests showed elevated levels of total bilirubin, especially the direct bilirubin increased.Alanine aminotransferase, aspartate transaminase acid and total bile acid were elevated, while GGT remained in a normal range.Oral medication of ursodeoxycholic acid initially improved liver biochemical parameters, but later fluctuated.Adenosine dehydrogenase, coagulation indicators and hepatic fibrosis indexes were persistently abnormal.The average shear wave velocity of liver was 1.9 times of the upper limit of normal value.Compound heterozygous mutations c. 334G>A(p.A112T)/c.580_639delGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGG-CCTGGACCAAGACCATGCGCGCACCCGA (p.194_213delDRSRGRSLERGLDQDHARTR) were found in the TJP2 gene.The deletion mutation of the TJP2 gene was reported for the first time throughout the world.Both of his parents carried a heterozygous mutation. Conclusions:PFIC should be considered in intrahepatic cholestasis patients with a normal range of GGT.The detection of TJP2 gene mutation is of great value in the clinical diagnosis of PFIC4.The presence of TJP2 gene mutation may be a risk factor for patient developing cirrhosis of liver and primary liver cancer in early childhood.It is necessary for children with PFIC4 to be closely followed up.

11.
مقالة ي صينى | WPRIM | ID: wpr-991450

الملخص

Under the influence of the coronavirus disease 2019 epidemic, the disadvantages of traditional blended teaching, which has been developed for 20 years, are gradually being revealed. With the help of modern network technology and under the guidance of minimalism, the new blended teaching model adheres to the principle of systematic, holistic, ecological, and collaborative reform and thus can not only efficiently realize the teaching goal of "improvement in self-learning ability and high-order thinking ability", but also achieve innovation and inheritance of "excellent teaching concepts and methods". On this basis, this study forms the "151 framework and BASIC mechanism", which will promote the reform and upgrading of blended teaching from point to surface and then to a three-dimensional structure and ensure that blended teaching has stronger vitality in the new era.

12.
مقالة ي صينى | WPRIM | ID: wpr-995607

الملخص

Objective:To analyze the clinical characteristics and evaluate the effect and safety of anti-vascular endothelial growth factor (VEGF) therapy in retinopathy of prematurity (ROP) in Sichuan province.Methods:A retrospective study. From January 2013 to January 2022, 156 patients (306 eyes) with ROP who received intravitreal anti-VEGF therapy for the first time in the Department of Ophthalmology, West China Hospital of Sichuan University were selected. According to the type of anti-VEGF drugs, the children were divided into intravitreal injection of ranibizumab (IVR) group and intravitreal injection of conbercept (IVC) group; IVC group was divided into hospital group and referral group according to the different paths of patients. After treatment, the patients were followed up until the disease degenerated (vascular degeneration or complete retinal vascularization) or were hospitalized again for at least 6 months. If the disease recurred or progressed, the patients were re-admitted to the hospital and received anti-VEGF drug treatment, laser treatment or surgical treatment according to the severity of the disease. Clinical data of these children was collected, including general clinical characteristics: gender, gestational age at birth (GA), birth weight (BW), history of oxygen inhalation; pathological condition: ROP stage, zone, whether there were plus lesions; treatment: treatment time, postmenstrual gestational age at the time of the first anti-VEGF drug treatment; prognosis: re-treat or not, time of re-treatment, mode of re-treatment; adverse events: corneal edema, lens opacity, endophthalmitis, retinal injury, and treatment-related systemic adverse reactions. The measurement data between groups were compared by t test, and the count data were compared by χ2 test or rank sum test. Results:Of the 306 eyes of 156 children with ROP, 74 were male (47.44%, 74/156) and 82 were female (52.56%, 82/156). Each included child had a history of oxygen inhalation at birth. The GA was (28.43±2.19) (23.86-36.57) weeks, BW was (1 129±335) (510-2 600) g, and the postmenstrual gestational age was (39.80±3.04) (31.71-49.71) weeks at the time of the first anti-VEGF drug treatment. All patients were diagnosed as type 1 ROP, including 26 eyes (8.50%, 26/306) of aggressive ROP (A-ROP), 39 eyes (12.74%, 39/306) of zone Ⅰ lesions, and 241 eyes (78.76%, 241/306) of zone Ⅱ lesions. The children were treated with intravitreal injection of anti-VEGF drugs within 72 hours after diagnosis. Among them, 134 eyes (43.79%, 134/306) of 68 patients were treated with IVR, and 172 eyes (56.21%, 172/306) of 88 patients were treated with IVC. In IVC group, 67 eyes of 34 patients (38.95%, 67/172) were in the hospital group and 105 eyes of 54 patients (61.05%, 105/172) were in the referral group. 279 eyes (91.18%, 279/306) were improved after one treatment, 15 eyes (4.90%, 15/306) were improved after two treatments, and 12 eyes (3.92%, 12/306) were improved after three treatments. The one-time cure rate of IVR group was lower than that of IVC group, but the difference was not statistically significant ( χ2=1.665, P=0.197). In different ROP categories, IVC showed better therapeutic effect in A-ROP, and its one-time cure rate was higher than that in IVR group, with statistically significant difference ( χ2=7.797, P<0.05). In the hospital group of IVC group, the GA, BW and the postmenstrual gestational age at first time of anti-VEGF drug treatment were lower than those in the referral group, and the difference was statistically significant ( t=-2.485, -2.940, -3.796; P<0.05). The one-time cure rate of the hospital group and the referral group were 94.94%, 92.38%, respectively. The one-time cure rate of the hospital group was slightly higher than that of the referral group, but the difference was not statistically significant ( χ2=0.171, P=0.679). In this study, there were no ocular and systemic adverse reactions related to drug or intravitreal injection in children after treatment. Conclusions:Compared with the characteristics of ROP in developed countries, the GA, BW and postmenstrual gestational age of the children in Sichuan province are higher. Both IVR and IVC can treat ROP safely and effectively. There is no significant difference between the two drugs in the overall one-time cure effect of ROP, but IVC performed better in the treatment of A-ROP in this study.

13.
مقالة ي صينى | WPRIM | ID: wpr-1038389

الملخص

Objective@#To investigate whether the cyclic adenosine monophosphate (cAMP) / exchange proteins directly activated by cAMP (Epac) / ras-related protein 1 ( Rap1 ) signalling pathway is involved in the intervening mechanisms of interleukin-1 β (IL-1 β) ,tumor necrosis factor-α (TNF-α) ,brain-derived neurotrophic factor (BDNF) and Jujuboside A(JuA) secretion by NG2 cells. @*Methods@#NG2 cells were cultured in vitro and the experiment was divided into control group ,pertussis toxin ( PTX) group ,ESI-09 group,JuA group and positive drug group.The effect of different concentrations of JuA on the survival rate of NG2 cells was detected by CCK-8 method,and the expression of IL-1 β , TNF-α , BDNF,cAMP,Epac,Rap1 mRNA and protein in each group was detected by RT-PCR and Western blot. @*Results@#Compared with the control group,the PTX group decreased the expression of IL-1 β and TNF-α mRNA and protein (P<0. 01) and increased the expression of cAMP and BDNF mRNA and protein (P<0. 01) ; the ESI-09 group increased the expression of IL-1 β and TNF-α mRNA and protein (P < 0. 05) and decreased the expression of BDNF,Epac and Rap1 mRNA and protein expression (P<0. 01) ; the JuA group and positive drug group increased IL-1 β , TNF-α , BDNF,cAMP,Epac,Rap1 mRNA and protein expression (P<0. 01) .@*Conclusion @#The cAMP / Epac / Rap1 signaling pathway is involved in the secretion of IL-1 β , TNF- α , and BDNF by NG2 cells.JuA may act on cAMP / Epac / Rap1 signaling pathway to affect the secretion of BDNF by NG2 cells.

14.
Chinese Journal of Neuromedicine ; (12): 318-324, 2023.
مقالة ي صينى | WPRIM | ID: wpr-1035817

الملخص

Post-stroke cognitive impairment (PSCI), one of the important complications of stroke, seriously affects the quality of life of these patients. PSCI is an important cause of disease burden of stroke. In recent years, more and more evidences show that blood biomarkers are of great significance in PSCI diagnosis, and the detection of blood biomarkers is relatively simple and more suitable for clinical application. Therefore, this paper sorts out the values of 5 blood biomarkers, nerve injury marker, metabolic biomarker, inflammatory biomarker, oxidative stress marker and other biomarker, in diagnosing PSCI, to provide references for early diagnosis and intervention of PSCI.

15.
مقالة ي صينى | WPRIM | ID: wpr-954592

الملخص

Objective:To investigate the clinical significance and biological effect of long non-coding RNA (lncRNA) NRSN2-AS1 in ovarian cancer.Methods:The expression of NRSN2-AS1 was detected by real-time quantitative PCR (RT-qPCR) in 84 cases of ovarian cancer tissues and corresponding normal adjacent tissues, and the relationship between NRSN2-AS1 expression and clinical data of patients was analyzed. Human ovarian epithelial cells HOSEpiC and human ovarian cancer cells A2780 and OVCAR3 were cultured in vitro, and overexpression or interference of NRSN2-AS1 and control plasmids were respectively transfected into A2780 and OVCAR3 cells as the blank group, overexpression group and control group, interference group. CCK-8 assay was used to detect cell proliferation, while transwell invasion and migration assay were used to detect the change of cell metastasis ability, RT-qPCR and Western blot were used to detect the expressions of SRY related HMG box transcription factor 12 (SOX12), a potential downstream gene of NRSN2-AS1.Results:The expressions of NRSN2-AS1 in ovarian cancer tissues and cells were significantly higher than normal adjacent tissues, and the high expression of NRSN2-AS1 was significantly correlated with poor prognosis, lymph node metastasis and high clinical stage ( P<0.05). In the blank and overexpression group, the expressions of NRSN2-AS1 were 1.00±0.08 and 5.78±0.41, the expressions of SOX12 mRNA were 1.00±0.10 and 3.08±0.23, the expression of SOX12 protein were 1.00±0.08 and 7.26±0.39, the invasion cells per field were 22.7±4.9 and 79.0±6.2, and the migration cells per field were 26.5±4.1 and 43.5±4.5. In the control and interference group, the expression of NRSN2-AS1 were 1.00±0.11 and 0.37±0.04, the expressions of SOX12 mRNA were 1.00±0.07 and 0.59±0.05, the expression of SOX12 protein were 1.00±0.07 and 0.36±0.03, the invasion cells per field were 68.3±6.1 and 30.6±5.5, and the migration cells per field were 85.2±7.0 and 22.7±4.2. Compared with the blank group, the expression of SOX12 mRNA and protein in the overexpression group was significantly increased ( P<0.05), and the cell proliferation and metastasis ability were significantly enhanced ( P<0.05). Compared with the control group, the expression of SOX12 mRNA and protein in the interference group was significantly decreased, and the ability of cell proliferation and metastasis was suppressed significantly ( P<0.05) . Conclusion:The expression of NRSN2-AS1 is up-regulated in ovarian cancer, which is closely related to poor prognosis and progression of ovarian cancer. NRSN2-AS1 can promote the expression of SOX12 and the malignant behavior of ovarian cancer cells in vitro.

16.
مقالة ي صينى | WPRIM | ID: wpr-955614

الملخص

Objective:To explore the reform plan for the integration of doctoral degree education in clinical medicine and standardized training for specialists.Methods:Using the literature analysis method and expert interview method, the preliminary framework of the merger training program was initially constructed, and Delphi method was used to determine the final index system. Excel 2010 was used to make data entry, and SPSS 19.0 was used for statistical analysis.Results:After two rounds of inquiry, the preliminary framework of the merger training program was finally determined from six aspects: enrollment methods, training resources, training content, training methods, training assessment and quality control, including 6 first-level indicators, 26 second-level indicators and 72 third-level indicators.Conclusion:By scientifically formulating systematic training programs, establishing the core training content and comprehensive evaluation system with post competency, and using flexible academic system, it provides a basis for carrying out the reform of the integration of doctoral education of clinical medicine and standardized training of specialists.

17.
مقالة ي صينى | WPRIM | ID: wpr-956160

الملخص

Objective:To investigate the gaze characteristics of children with autism spectrum disorder (ASD) on dynamic threatening (fear, anger) and non-threatening emotional (sadness, happiness) faces, and to explore the correlation between their eye-tracking data and autism symptomatology scores to provide a basis for the treatment and rehabilitation of children with ASD.Methods:From November 2020 to June 2021, 26 children with ASD and 30 age-and sex-matched normally developing children (typical developmental, TD) who met the enrollment criteria were included, and children with ASD were assessed for symptoms by the childhood autism rating scale (CARS). The SMI-red portable eye-tracking recording system was used to record the eye-movement gaze characteristics of children in both groups during free viewing of dynamic threatening and non-threatening emotional face segments.Statistical processing was performed by SPSS 21.0 software.The independent sample t-test and chi square test were used for the data conforming to the normal distribution, and the non parametric test was used for the data not conforming to the normal distribution, and Pearson correlation analysis was used to analyze the correlation between eye-tracking data and symptomatology scores. Results:The total CARS score of the ASD group was (32.64±7.42). The eye tracking data for children with ASD showed gaze aversion characteristics.Children with ASD spent significantly less time gazing at the eye area of threatening emotional faces in fear (2.41(0.26, 10.65)s) and anger (2.17(0.13, 6.13)s) than children with TD (8.81(2.54, 12.11)s, 5.21(3.80, 12.49)s), with statistically significant differences (fear: Z=-2.252, P<0.05.anger: Z=-2.793, P<0.01). Children with ASD spent significantly less time gazing at the mouth area of all four emotional faces (sad: 3.56(0.44, 7.16)s, fear: 2.68(0.42, 4.78)s, anger: 2.13(0.35, 4.20)s, happiness: 2.93(0.46, 5.71)s) than children with TD (sad: 11.43(6.97, 14.22) s, fear: 6.73(3.65, 10.10)s, anger: 6.86(4.55, 12.33)s, happiness: 11.72(7.22, 14.39)s), with statistically significant differences (sad: Z=-4.502, P<0.01.fear: Z=-3.493, P<0.01.anger: Z=-4.025, P<0.01.happiness: Z=-4.699, P<0.01). Correlation analysis revealed that the time spent gazing at emotional faces in children with ASD was negatively correlated with the total CARS score ( r=-0.476, P<0.05), and further analysis of different emotional faces revealed that the time spent gazing at fearful faces in children with ASD was negatively correlated with the total CARS score ( r=-0.455, P<0.05). Conclusions:Eye tracking in children with ASD show a gaze profile with less gaze time to threatening emotional faces compared with TD children, and the more severe the symptoms in children with ASD, the less gaze time to fearful faces.

18.
مقالة ي صينى | WPRIM | ID: wpr-957207

الملخص

Objective:To compare the serum uric acid levels among employees with different psychological states.Methods:From January 2019 to August 2021, 200 in-service employees of various enterprises and public institutions receiving health screening in PLA General Hospital were selected as the participants for this study. Based on the scores of psychological stress, anxiety, and depression scale, each of the three psychological states was divided into four groups from mild to severe. The baseline data, serum uric acid level, creatinine level, and urea nitrogen level of participants were studied to explore the relationship between different psychological states and changes serum uric acid level.Results:According to the degree of psychological stress, anxiety, and depression, serum uric acid levels were 198.52±30.24 μmol/L, 256.52±10.33 μmol/L, 354.20±15.54 μmol/L, and 399.20±20.20 μmol/L ( F value 694.662, P<0.001), respectively. There was statistical difference in serum uric acid level of employees with different psychological statuses; with the aggravation of psychological status, the serum uric acid level showed a trend of gradually increasing from low to high. There was a positive correlation between the scores of different psychological states and uric acid level ( r=0.885, 0.780, 0.794, P<0.05), and no correlation between uric acid level and creatinine and urea nitrogen levels ( r=1.869, 3.887, 5.798, P>0.05). Conclusions:The serum uric acid level of employees varied with different types of psychological states. The greater the psychological stress is,the more serious the degree of depression and anxiety and the higher the serum uric acid level would be. The increase in uric acid level has no relationship with creatinine and urea nitrogen level.

19.
Cancer Research and Clinic ; (6): 423-428, 2022.
مقالة ي صينى | WPRIM | ID: wpr-958868

الملخص

Objective:To screen and analyze ferroptosis-related genes (FRG) impacting the prognosis of colorectal adenocarcinoma patients based on bioinformatics.Methods:RNA sequencing data including the clinical information of 545 colorectal adenocarcinoma patients and 602 data sets were downloaded from the Cancer Genome Atlas (TCGA) database. FRG gene sets were downloaded from FerrDb database. FRG expression dataset could be obtained after taking the intersection between FRG gene sets and TCGA database gene sets. Differentially expressed FRG and prognosis-related genes between colorectal adenocarcinoma tissues and the adjacent tissues were screened by using R software, and finally FRG influencing the prognosis of colorectal adenocarcinoma were obtained. According to protein-protein interaction networks, the interaction and the expression association of proteins were analyzed. LASSO regression analysis was used to build a risk model for patients' 5-year overall survival rate. The risk value was calculated for 509 colorectal adenocarcinoma samples in the TCGA database, and then the median risk value was taken as the cut-off value. All patients were divided into the high-risk group (≥ median risk value) and the low-risk group (< median risk value), and the survival curves of the two groups were drawn. The receiver operating characteristic (ROC) curve was drawn for predicting the 5-year overall survival rate of colorectal adenocarcinoma patients in a time-dependent way in TCGA database according to the risk value of FRG prognosis model. Cox proportional risk model was used to make univariate and multivariate survival analysis in order to screen factors affecting the prognosis. The pathway enrichment analysis of prognosis-related FRG of colorectal adenocarcinoma was performed based on gene ontology (GO) database and Kyoto Encyclopedia of Genes and Genomes (KEGG) database.Results:The clinical information of 545 patients and 602 datasets were extracted from the database. A total of differential expressed 199 FRG in colorectal adenocarcinoma and 28 prognosis-related FRG were identified. After taking the intersection, 21 FRG affecting the prognosis of colorectal adenocarcinoma patients were identified. DUOX2, NOX4, NOX1, DDIT3, JDP2, ATP6V1G2, ULK1, ATG3 were probably associated with WIPI1; expressions of NOX4, NOX5, PLIN4 were positively correlated with ATP6V1G2, while the expression of ULK1 was negatively correlated with MAPK1, MYB, FANCD2, ATG3 and ATP5MC3. LASSO regression analysis showed that 15 FRG were finally screened out (ATP5MC3, NOX4, NOX5, ALOX12B, ATG3, WIPI1, MAPK1, MYB, AKR1C1, DDIT3, JDP2, ATP6V1G2, DRD4, SLC2A3, PLIN4), and the risk model was constructed by calculating the risk value, and the risk value = NOX4×0.139-ATP5M3×0.108+NOX5×1.486+ALOX12B×0.475-ATG3×0.030-WIPI1×0.170-MAPK1×0.271-MYB×0.063+AKR1C1×0.021+DDIT3×0.186+JDP2×0.292+ATP6V1G2×0.777+DRD4×0.294+SLC2A3×0.059+PLIN4×0.113. The overall survival of patients in the high-risk group was worse than that in the low-risk group ( P < 0.001). The 5-year overall survival rate was 48.2% in the high-risk group and 76.8% in the low-risk group. Multivariate survival showed that the age and risk value were independent affecting factors of the prognosis. ROC curves revealed that the risk model constructed by using prognosis-related FRG could well predict the 5-year overall survival rate of patients (the area under the curve was 0.728). The differential expressed genes of both groups may be associated with genetic pathways such as extracellular matrix composition, extracellular structure composition and focal adhesion. Conclusions:The prognostic risk model constructed by the screened FRG can better evaluate the prognosis of colorectal adenocarcinoma patients. These FRG are expected to become new candidate biomarkers related to the prognosis of colorectal adenocarcinoma.

20.
مقالة ي صينى | WPRIM | ID: wpr-934278

الملخص

With the rapid development of fundus imaging technology, it is of great significance to establish a new naming system for neovascular age-related macular degeneration (nAMD) based on the multi-mode imaging. In 2020, an international panel of retina specialists, imaging and image reading center experts, and ocular pathologists reached a consensus after repeated discussions, a new name for nAMD subtype and related lesions was established based on the previous knowledge of fundus fluorescein angiography and pathology, combining indocyanine green angiography, optical coherence tomography and optical coherence tomography angiography with current pathological knowledge, in order to help ophthalmologists to study nAMD. The consensus proposed the term "macular neovascularization" and classified it into type 1, type 2 and type 3. Many lesions related to macular neovascularization, such as pigment epithelial detachment, hemorrhage, fibrosis, rip of retinal pigment epithelium and so on, were named. The new designation will help improve clinical communication between different studies, establish standard definitions and terms between reading centers and researchers, and further promote the understanding and communication of nAMD among ophthalmologists.

اختيار الاستشهادات
تفاصيل البحث