Phenotype and genotype analysis of progressive familial intrahepatic cholestasis type 4 / 中华实用儿科临床杂志

Objective:To improve the understanding of progressive familial intrahepatic cholestasis type 4 (PFIC4).Methods:Clinical characteristics in a 10-year-old boy with PFIC4 at the Second Hospital of Hebei Medical University in February 2020 were retrospectively analyzed, and the TJP2 gene mutations were analyzed. Results:The proband was a 10-year-old boy with a slow onset of intrahepatic cholestasis[normal γ-glutamyl transpeptidase(GGT)], hepatosplenomegaly and hepatic fibrosis.Laboratory tests showed elevated levels of total bilirubin, especially the direct bilirubin increased.Alanine aminotransferase, aspartate transaminase acid and total bile acid were elevated, while GGT remained in a normal range.Oral medication of ursodeoxycholic acid initially improved liver biochemical parameters, but later fluctuated.Adenosine dehydrogenase, coagulation indicators and hepatic fibrosis indexes were persistently abnormal.The average shear wave velocity of liver was 1.9 times of the upper limit of normal value.Compound heterozygous mutations c. 334G>A(p.A112T)/c.580_639delGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGG-CCTGGACCAAGACCATGCGCGCACCCGA (p.194_213delDRSRGRSLERGLDQDHARTR) were found in the TJP2 gene.The deletion mutation of the TJP2 gene was reported for the first time throughout the world.Both of his parents carried a heterozygous mutation. Conclusions:PFIC should be considered in intrahepatic cholestasis patients with a normal range of GGT.The detection of TJP2 gene mutation is of great value in the clinical diagnosis of PFIC4.The presence of TJP2 gene mutation may be a risk factor for patient developing cirrhosis of liver and primary liver cancer in early childhood.It is necessary for children with PFIC4 to be closely followed up.

Current status of surgery for portal hypertension in China: a national multi-center survey analysis / 中华器官移植杂志

Objective:To explore the current status of surgery for portal hypertension to grasp current status and future development of surgery in China.Methods:This study is jointly sponsored by China Hepatobiliary & Pancreatic Specialist Alliance & Portal Hypertension Alliance in China (CHESS).Comprehensive surveying is conducted for basic domestic situations of surgery for portal hypertension, including case load, surgical approaches, management of postoperative complications, primary effects, existing confusion and obstacles, liver transplantation(LT), laparoscopic procedures and transjugular intrahepatic portosystemic shunt(TIPS), etc.Results:A total of 8 512 cases of portal hypertension surgery are performed at 378 hospitals nationwide in 2021.Splenectomy plus devascularization predominated(53.0%)and laparoscopy accounted for 76.1%.Primary goal is preventing rebleeding(67.0%) and 72.8% of hospitals used preventive anticoagulants after conventional surgery.And 80.7% of teams believe that the formation of postoperative portal vein thrombosis is a surgical dilemma and 65.3% of hospitals practiced both laparoscopy and TIPS.The major reasons for patients with portal hypertension not receiving LT are due to a lack of qualifications for LT(69.3%)and economic factors(69.0%).Conclusions:Surgery is an integral part of management of portal hypertension in China.However, it is imperative to further standardize the grasp of surgical indications, the handling of surgical operation and the management of postoperative complications.Moreover, prospective, multi-center randomized controlled clinical studies should be performed.

Short-term efficacy and safety of Donafenib as postoperative adjuvant therapy for patients with high risk of recurrence after radical resection of hepatocellular carcinoma: a multicenter retrospective study / 中华消化外科杂志

Objective:To investigate the short-term efficacy and safety of Donafenib as postoperative adjuvant therapy for patients with high risk of recurrence after radical resection of hepatocellular carcinoma (HCC).Methods:The propensity score matching (PSM) and retrospective cohort study was conducted. The clinicopathological data of 157 HCC patients with high risk of recurrence after radical resection who were admitted to 6 medical centers, including The First Affiliated Hospital of Nanjing Medical University et al, from June 2021 to February 2023 were collected. There were 128 males and 29 females, aged (59±10)years. Of 157 patients, 101 cases undergoing Donafenib as postoperative adjuvant therapy were divided into the the Donafenib group, and 56 cases under-going no systemic postoperative adjuvant therapy were divided into the control group. Observation indicators: (1) PSM and comparison of general data of patients between the two groups after matching; (2) postoperative treatment; (3) follow-up and survival of patients; (4) analysis of risk factors affecting recurrence-free survival of patients. PSM was done based on the principle of optimal perfect matching, with the clamp value of 0.5, and the Donafenib group and the control group were matched at a ratio of 1.25∶1. Measurement data with normal distribution were represented as Mean± SD, and comparison between groups was conducted using the t test. Measurement data with skewed distribution were represented as M(range). Count data were described as absolute numbers and/or percentages, and comparison between groups was conducted using the chi-square test. Comparison of ordinal data between groups was conducted using the Kruskal-Wallis H test. The Kaplan-Meier method was used to calculate survival rates and draw survival curves, and the Log-Rank test was used for survival analysis. The COX proportional hazard model was used for univariate and multivariate analyses. Results:(1) PSM and comparison of general data of patients between the two groups after matching. Of 157 patients, 126 cases were successfully matched, including 70 cases in the Donafenib group and 56 cases in the control group, respectively. The elimination of tumor number confounding bias ensured comparability between the two groups after PSM. (2) Postoperative treatment. After PSM, of 70 patients in the Donafenib group, there were 23 cases receiving Donafenib monotherapy, 26 cases combined with transcatheter arterial chemoembolization (TACE), 14 cases combined with immunotherapy, and 7 cases combined with TACE+immunotherapy. Of 56 patients in the control group, there were 37 cases receiving postoperative follow-up alone and 19 cases combined with TACE. (3) Follow-up and survival of patients. All 157 patients were followed up, and the follow-up time of the 101 patients in Donafenib group and the 56 patients in control group were 10.1(range, 6.3-14.6)months and 22.2(range, 15.1-25.5)months, respectively. During the follow-up period, 70 patients in the Donafenib group experienced treatment-related adverse reactions, inclu-ding 8 cases of grade 3 adverse reactions, 23 cases of grade 2 and 39 cases of grade 1 adverse reactions, respectively. After PSM, the postoperative 12-, 18-month recurrence-free survival rates were 83.7%, 83.7% in the 70 patients of Donafenib group and 67.8%, 58.9% in the 56 patients of control group, respectively, showing a significant difference in the postoperative recurrence-free survival time between the two groups ( hazard ratio=0.395, 95% confidence interval as 0.176-0.888, P<0.05). (4) Analysis of risk factors affecting recurrence free survival of patients. Results of multivariate ana-lysis showed that microvascular invasion, vascular thrombus, clinical stage as ⅢA were independent risk factors affecting recurrence-free survival in patients with high risk of recurrence after radical resection of HCC ( hazard ratio=2.181, 2.612, 2.612, 95% confidence interval as 1.028-4.629, 1.128-6.047, 1.128-6.047, P<0.05), Donafenib as postoperative adjuvant therapy was an independent protective factor affecting recurrence-free survival in patients with high risk of recurrence after radical resection of HCC ( hazard ratio=0.457, 95% confidence interval as 0.227-0.920, P<0.05). Results of further analysis showed that after PSM, there were significant differences in the postoperative recurrence-free survival time in patients with different clinical factors, including male, age ≥60 years, tumor diameter >5 cm, positive microvascular invasion, positive hepatitis B virus infection, alpha fetoprotein <200 μg/L, between the Donafenib group and the control group ( hazard ratio=0.283, 0.202, 0.174, 0.345, 0.273, 0.180, 95% confidence interval as 0.114-0.707, 0.044-0.937, 0.038-0.794, 0.128-0.929, 0.091-0.819, 0.052-0.620, P<0.05). Conclusion:Donafenib as postoperative adjuvant therapy can effectively reduce the short-term recurrence rate in patients with high risk of recurrence after radical resection of HCC, with good safety and tolerance.

Control status and influencing factors of glycated hemoglobin in children with type 1 diabetes in Tianjin 2020-2021 / 公共卫生与预防医学

Objective To analyze the control status and influencing factors of glycosylated hemoglobin (HbA1c) in children with type 1 diabetes mellitus (T1DM) in Tianjin from 2020 to 2021, and to provide a theoretical basis for controlling blood glucose in children with type 1 diabetes mellitus. Methods A total of 538 children with type 1 diabetes, including 275 males and 263 females, were selected from our hospital from January 2020 to June 2021. All the children were determined according to the level of HbA1c and divided into well-controlled group (HbA1c<7.0%, n=469) and poorly controlled group (HbA1c≥7.0%, n=69), 3ml fasting elbow venous blood was extracted from the two groups, and the levels of HbA1c, FPG, 2hPG, TC and LDL-C were compared between the two groups. Clinical data of the children were collected from the medical record system. The factors affecting the control of HbA1c in children with type 1 diabetes were analyzed by univariate analysis and logistic regression. Results The comparison of general data between the two groups showed no significant difference in age, sex and course of type 1 diabetes mellitus (P<0.05). The levels of HbA1c, FPG, 2hPG, TC and LDL-C in poorly controlled group were significantly higher than those in well controlled group (P<0.05). The blood glucose monitoring <60 times/month (OR=3.017), uncontrolled diet (OR=2.871), obesity (OR=2.623) were independent risk factors for poor control of HbA1c in children with type 1 diabetes (P<0.05). Conclusions Children with type 1 diabetes mellitus have a greater risk of poor control of HbA1c. It is necessary to strengthen publicity and education for parents of children with diabetes, regularly monitor blood glucose and control diet to effectively improve blood glucose control in children.

Dermatomyositis with malignancy: an update / 中华皮肤科杂志

Dermatomyositis with malignancy is a subtype of dermatomyositis, and the concurrence of malignancy is a major factor for poor prognosis of dermatomyositis. Malignancy usually occurs within 1 year before or after the diagnosis of dermatomyositis. Compared with classic dermatomyositis, dermatomyositis with malignancy mostly occurs in patients aged>50 years, and is typically characterized by the heliotrope sign, skin necrosis and presence of myositis-specific antibodies such as anti-transcriptional intermediary factor-1γ and anti-nuclear matrix protein-2 antibodies, etc. Thorough screening for malignancy or close monitoring and follow-up are necessary in patients with dermatomyositis.

Clinical and imaging characteristics of 107 patients with linear morphea: a retrospective analysis / 中华皮肤科杂志

Objective:To analyze clinical, laboratory and imaging characteristics of different subtypes of linear morphea (LM) , and to propose an appropriate approach to the diagnosis and severity assessment of LM.Methods:Clinical data were collected from patients with clinically and/or pathologically confirmed LM in Department of Dermatology, West China Hospital, Sichuan University from January 2018 to December 2019, and retrospectively analyzed.Results:A total of 107 patients with LM were enrolled into this study, including 63 with LM of the limbs/trunk, 22 with morphea en coup de sabre, 11 with progressive hemifacial atrophy and 11 with eosinophilic fasciitis. Disease severity was evaluated by using the modified localized scleroderma skin severity index (mLoSSI) and localized scleroderma skin damage index (LoSDI) scores in 88 patients, with the mLoSSI scores ranging from 0 to 51 points, and the LoSDI scores ranging from 0 to 40 points. Routine blood examination of 10 patients with eosinophilic fasciitis showed increased eosinophil counts in 4 patients. Thirteen (14.8%) of 88 patients with LM were positive for antinuclear antibody, with titers of ≥ 1∶320. Magnetic resonance imaging (MRI) examination showed ipsilateral cerebral hemisphere atrophy and contralateral white matter hyperintensity on T2-weighted images in 2 out of 4 patients with progressive hemifacial atrophy, myofascial thickening in 26 out of 28 patients with LM of the limbs/trunk (92.9%) , subcutaneous septal and myofascial thickening in all 11 patients with eosinophilic fasciitis.Conclusions:The preliminary assessment of disease activity, severity and prognosis of LM can be made by mLoSSI and LoSDI. MRI examination is recommended for patients with clinical signs of involvement of subcutaneous structures.

Correlation between genotypes with metabolic markers and microstructure of bones in children with Gitelman syndrome / 中华医学遗传学杂志

OBJECTIVE@#To explore the correlation between the genotypes and metabolic markers and microstructure of bones in children with Gitelman syndrome (GS).@*METHODS@#For 15 children with GS and 10 healthy individuals, baseline data and bone metabolic markers including parathyroid hormone, alkaline phosphatase, osteocalcin, N-terminal propeptide of type I procollagen, beta isomer of the C-terminal telopeptide of type I collagen and 25-hydroxyvitamin D, high-resolution peripheral quantitative computed tomography indicators (volumetric bone mineral density, bone microstructure indicators) were collected. Genetic testing was carried out to determine their genotypes.@*RESULTS@#The volumetric bone mineral density, bone geometry and bone microstructure parameters of the GS group were better than those of the healthy controls (P<0.05). Variants of the SLC12A3 gene were identified in 9 of the 15 patients but none of the 10 healthy controls.@*CONCLUSION@#The phenotype of GS children is influenced by the interaction of genetic variants, though the phenotype associated with high frequency mutations showed no specificity. There is also a correlation between their genotype and the bone microstructure.

Genetic analysis of 46,XY disorders of sex development in children caused by a new NR5A1 gene variant / 中华医学遗传学杂志

OBJECTIVE@#To explore the genetic basis for a child with 46,XY disorders of sex development (DSD) and explore its genotype-phenotype correlation.@*METHODS@#The child was subjected to whole exome sequencing (WES), and exons 1 to 7 of NR5A1 were subjected to multiplex ligation-dependent probe amplification (MLPA) analysis.@*RESULTS@#The patient presented with rudimentary vulva of a female with Tanner stage 1. B-mode ultrasonography has detected ovary and uterus. The child was found to have a chromosome karyotype of 46,XY. WES revealed that the patient has harbored heterozygous deletion of exon 5 of the NR5A1 gene, which was a novel pathogenic variant inherited from the mother. No abnormality was found in the father.@*CONCLUSION@#The main symptoms of 46,XY DSD children are insufficient external genitalia masculinization, for which variants of the NR5A1 gene are an important cause. WES has improved the detection rate of genetic variants and provided a solid basis for genetic counseling of the affected families.

Effectiveness and Safety of Acupoint Application of Guan Xin Su He Pill () for Patients with Chronic Stable Angina Pectoris: A Multi-Center, Randomized Controlled Trial / 中国结合医学杂志

OBJECTIVE@#To assess the clinical effectiveness of acupoint application (AP) of Guan Xin Su He Pill (, GXSHP) for patients with chronic stable angina pectoris (CSAP).@*METHODS@#This study was carried out in 3 local hospitals in Chengdu, China. After baseline evaluation, eligible patients were randomly assigned to the placebo application for acupoints (PAA) group or the herbal application for acupoints (HAA) group. Patients in the HAA group underwent AP with herbal powder, which was mainly GXSHP, and patients in the PAA group underwent AP with sham drugs. For each treatment session, unilateral acupoints including Neiguan (PC 6), Danzhong (RN 17), Xinshu (BL 15) and Jueyinshu (BL 14), were stimulated for both groups. AP was performed 3 times a week with a 2-day interval for 4 weeks. The primary outcome was the frequency of angina pectoris attacks per week, while the secondary outcomes included angina pain intensity measured by the Visual Analogue Scale (VAS), dose of rescue oral drugs (nitroglycerin), scores on the Seattle Angina Questionnaire (SAQ), Self-Rating Anxiety Scale scores (SAS) and Self-Rating Depression Scale scores (SDS). Clinical outcomes were measured at week 0, 4 and 8. The safety of AP of GXSHP treatment for CSAP were assessed.@*RESULTS@#A total of 121 patients were enrolled. Baseline characteristics were comparable across the 2 groups. After treatment, the angina attack numbers in the HAA group were significantly reduced from 11.00 to 4.81 (P<0.05). While, for PAA group, the angina frequency was not significantly improved (baseline 10.55; post-treatment 11.05). The HAA group had significantly fewer angina attacks than the PAA group (P<0.05). Pain intensity measured by VAS in HAA group was significantly reduced from 4.06 to 3.02 (P<0.05). While, for PAA group, the VAS was significantly increased (baseline 3.62; post-treatment 3.96; P<0.05). Clinical outcomes showed better improvement after treatment in the HAA group than in the PAA group in terms of oral administration of rescue drugs, SAS, SDS and SAQ scores (P<0.05). The adverse events were also reported.@*CONCLUSION@#AP of GXSHP is a safe and effective treatment for CSAP patients (Registration No. NCT02029118).

Effect of Curdione on MDA-MB-231 Cell Cycle and Apoptosis / 中国实验方剂学杂志

Objective:To investigate the effects of curdione on the proliferation， apoptosis and cell cycle of triple negative breast cancer cell line MDA-MB-231. Method:MDA-MB-231 cells were cultured<italic> in vitro</italic> with capecitabine （positive control） and curdione at different concentrations （125， 250， 500， 1 000， and 2 000 μmol·L^-1）， respectively， for detecting their viability using the cell counting kit-8 （CCK-8） at 24 and 48 h. Three effective inhibitory concentrations （250， 500， and 1 000 μmol·L^-1） against cell proliferation were selected for subsequent experiments. The effect of curdione on cell cycle was determined by flow cytometry combined with propidium iodide （PI） staining. After the set-up of high-concentration （2 000 μmol·L^-1） group， the effect of curdione on cell mitochondrial membrane potential was measured by JC-1（5，5，6，6-tetrachloro-1，1，3，3-tetraethylbenzimidazolylcarbocyanine iodide） staining， followed by the detection of cell apoptosis by flow cytometry combined with Annexin V-FITC/PI double staining. The changes in cell cycle status and apoptosis-related protein expression following curdione intervention were assayed by Western blot. Result:Compared with the blank control， curdione at 250， 500， 1 000， and 2 000 μmol·L^-1significantly inhibited the proliferation of MDA-MB-231 cells （<italic>P</italic><0.01）， exhibiting a concentration- and time-response relationship. The half maximal inhibitory concentration （IC₅₀） values at 24 and 48 h were 1 607 and 1 401 μmol·L^-1， respectively. Curdione at 250， 500， and 1 000 μmol·L^-1 arrested cells in G₁ phase. Curdione at 250 μmol·L^-1had no effect on cell mitochondrial membrane potential， which， however， declined significantly in the 500， 1 000， and 2 000 μmol·L^-1groups （<italic>P</italic><0.05， <italic>P</italic><0.01）. Curdione at 250， 500， and 1 000 μmol·L^-1obviously increased the proportion of apoptotic cells （<italic>P</italic><0.05， <italic>P</italic><0.01）. Curdione at each concentration elevated the Bcl-2-associated X protein （Bax）/B-cell lymphoma 2 （Bcl-2） ratio （<italic>P</italic><0.05， <italic>P</italic><0.01）， but did not change the cysteinyl aspartate-specific protease-3 （Caspase-3） expression. The protein expression levels of Caspase-9， cleaved Caspase-9， cleaved Caspase-3， p53， and p21 were up-regulated （<italic>P</italic><0.05）. Conclusion:A certain concentration of curdione inhibits the proliferation of MDA-MB-231 cells， which may be related to its efficacy in arresting cell cycle and inducing apoptosis.