Application of teach-back-based role transition shock model in knee arthroplasty nursing internship teaching / 中华医学教育探索杂志

Objective:To explore the application of a role transition shock model based on the teach-back technique in knee arthroplasty nursing teaching.Methods:We assigned 50 nursing student interns practicing in the knee arthroplasty team of Orthopedics Department of Nanjing First Hospital between August 2020 and August 2022 into control group ( n=25, traditional teaching) and observation group ( n=25, teach-back-based role transition shock model teaching) according to the order of admission. At the end of internship, the examination scores, the impact of transition shock on comprehensive abilities, and teaching satisfaction of the students were assessed and analyzed using the t test and Fisher's exact test with the use of SPSS 22.0. Results:Compared with the control group, the observation group scored significantly lower in the physical, psychological, knowledge and skills, and sociocultural and developmental dimensions of the transition shock assessment scale ( P<0.05). The observation group showed significantly higher scores of nurse-patient communication, nursing practice, disease observation, health education, humanistic care, team cooperation, clinical thinking, and emergency response than the control group ( P<0.05). The examination results of the observation group were significantly better than those of the control group ( t=12.31, 11.52, P<0.001). The teaching satisfaction rate of the observation group was significantly higher than that of the control group [100.00% (25/25) vs. 68.00% (17/25), χ2=9.52, P=0.002]. Conclusions:The teach-back-based role transition shock model can help alleviate the transition impact faced by nursing student interns when entering clinical practice, and also improve their comprehensive abilities as well as satisfaction with teaching.

Changes in functional connectivity of raphe nucleus in patients with first-episode depression complicated with suicidal ideation / 中国介入影像与治疗学

Objective To observe the changes in functional connectivity(FC)of raphe nucleus in patients with first-episode depression complicated with suicidal ideation(SI).Methods Ninety-eight first-episode depression patients were prospectively enrolled and assigned into SI group(n=56)or non SI group(n=42)based on complicated with SI or not,while 47 healthy volunteers were recruited as control group.Resting-state functional MRI was performed.FC between dorsal raphe nucleus(DRN),median raphe nucleus(MRN)and the whole brain were analyzed and compared among 3 groups and between each 2 groups,and the correlations of FC of different brain regions with clinical data of SI group were explored.Results Compared with control group,FC between DRN and left cerebellum and left putamen in SI group and non SI group decreased(all P＜0.05),between MRN and right inferior temporal gyrus increased but between MRN and left inferior frontal gyrus,right superior occipital gyrus,left inferior parietal lobule,left putamen decreased(all P＜0.05).FC between DRN and left putamen in SI group was higher than that in non SI group(P＜0.05).FC between MRN and right central posterior gyrus of SI group increased compared with that in the rest 2 groups(both P＜0.05).FC between MRN and left putamen in SI group was positively correlated with body mass score of Hamilton depression scale-24(HAMD-24)(rs=0.297,P=0.026).Conclusion Abnormal changes of FC between raphe nucleus and cortex,also between raphe nucleus and subcortical area occurred,and FC between MRN and left putamen positively correlated with body mass score of HAMD-24 in patients with first-episode depression complicated with SI.

Construction and application of a management scheme for nursing assistants in unaccompanied hospitals / 中华护理杂志

Objective To construct a management scheme of nursing assistants in unaccompanied hospitals and explore its application effect.Methods The management team of nursing assistants in unaccompanied hospitals was set up.On the basis of investigating the current situation of nursing assistants'team management,the management scheme of nursing assistants was constructed by ORTCC management model for references,including 5 parts:determining management objectives,perfecting rules system,building hierarchical training system,checking and assessing,and shaping cultural system.Convenience sampling method was used to select 92 nursing assistants in an unaccompanied hospital in Xiamen,Fujian Province from June 2021 to June 2022 as application subjects.The post competence of nursing assistants and the satisfaction of patients and nurses to nursing assistants were compared before the application of the management scheme(June-December 2021)and after the application(January 2022-June 2022).Results After the application of ORTCC management model,the total score of post competency of medical nursing assistants increased from[65(64,67)]to[91(90,92)];the excellent rate of post competency level increased from 1.09％to 67.39％;the satisfaction of patients with nursing assistants increased from 61.99％to 88.62％;the scores of nurses'satisfaction with nursing assistants in all dimensions were significantly higher than before(all P＜0.05),and the overall evaluation was improved from 92.73％to 99.24％.Conclusion The use of the ORTCC management model for nursing assistants can effectively improve their post competence,improve the satisfaction of patients and nurses,and help to further stabilize and develop the medical nursing assistants staff.

Correlation between serum beta 2-microglobulin level and cerebral microbleeds in the elderly / 中华老年心脑血管病杂志

Objective To explore the correlation between serum beta 2-microglobulin(B2M)level and cerebral microbleeds(CMB)in the elderly.Methods A retrospective analysis of 636 elderly patients with chronic diseases admitted to the Department of Neurology of our hospital from Janu-ary 2020 to November 2022 was made.On the second day after admission,venous blood samples were collected to detect the serum B2M level,and brain magnetic resonance susceptibility weigh-ted imaging was performed.Then these patients were assigned into CMB group(82 cases)and CMB-free group(554 cases).Binary logistic regression analysis was employed to identify the inde-pendent risk factors for CMB.Results Binary logistic regression analysis showed that serum B2M level was an independent risk factor for CMB in elderly patients(Model 1:β=0.179,OR=1.196,95％CI:1.017-1.407,P=0.031;Model 2:β=0.215,OR=1.240,95％CI:1.048-1.468,P=0.012)after adjusting confounding factors.ROC curve analysis indicated that the optimal cutoff value of serum B2M level in diagnosing CMB was 1.805 mg/L,with a sensitivity of 70.7％and a specificity of 52.5％,and an AUC value of 0.657(95％CI:0.595-0.719,P＜0.01).Conclusion The increment of serum B2M level is closely related to CMB in the elderly population,so the pro-tein can be used as one of indicators for prediction of CMB in the population.

Development course and research status of incisions in lung transplantation / 器官移植

Surgical technique of lung transplantation exerts significant impact on clinical prognosis of the recipients. Choosing an appropriate surgical incision determines the exposure of intraoperative visual field, which is the first step of surgical success and directly affects subsequent surgical procedures. Lung transplantation incision is usually considered as primary closure. Nevertheless, for patients with high-risk factors such as oversized lung allografts and primary graft failure after lung transplantation, primary closure cannot be achieved. Hence, delayed chest closure is an effective strategy. The selection of incisions and the adoption of delayed chest closure of lung transplantation exert profound impact upon perioperative prognosis, long-term quality of life and surgical complications of the recipients. Therefore, the development and research status of Clamshell incision, anterolateral incision, posterolateral incision and median sternal incision in lung transplantation were reviewed, highlighting the effect of incision patterns on clinical prognosis of lung transplantation and providing reference for the selection of incisions in clinical lung transplantation.

Strategies and advances in laboratory tests for primary liver cancer / 中华预防医学杂志

Primary liver cancer is one of the leading causes of cancer-related deaths worldwide, its early diagnosis and early treatment are of great clinical importance. The main detection tools for liver cancer include serological indicators, imaging tests and risk assessment models. With the advancement of technology and research, the sensitivity and specificity of laboratory tests for liver cancer have been substantially improved, but there are still false negatives and low rates of early diagnosis. For different causes and prevalence regions, each country has developed its clinical practice guidelines to guide risk groups for effective prevention, early diagnosis and standardized treatment. It is important to establish a liver cancer diagnosis strategy that is suitable for China's national conditions, concerning the guidelines for the vigilance and prevention of liver cancer. In this article, the advantages and disadvantages of liver cancer-related tests and the impact of future development trends on laboratory strategies are explained from the perspective of laboratory testing strategies, to provide theoretical support for the practical application of liver cancer diagnostic strategies.

Strategies and advances in laboratory tests for primary liver cancer / 中华预防医学杂志

Primary liver cancer is one of the leading causes of cancer-related deaths worldwide, its early diagnosis and early treatment are of great clinical importance. The main detection tools for liver cancer include serological indicators, imaging tests and risk assessment models. With the advancement of technology and research, the sensitivity and specificity of laboratory tests for liver cancer have been substantially improved, but there are still false negatives and low rates of early diagnosis. For different causes and prevalence regions, each country has developed its clinical practice guidelines to guide risk groups for effective prevention, early diagnosis and standardized treatment. It is important to establish a liver cancer diagnosis strategy that is suitable for China's national conditions, concerning the guidelines for the vigilance and prevention of liver cancer. In this article, the advantages and disadvantages of liver cancer-related tests and the impact of future development trends on laboratory strategies are explained from the perspective of laboratory testing strategies, to provide theoretical support for the practical application of liver cancer diagnostic strategies.

Noninvasive Diagnostic Technique for Nonalcoholic Fatty Liver Disease Based on Features of Tongue Images / 中国结合医学杂志

OBJECTIVE@#To investigate a new noninvasive diagnostic model for nonalcoholic fatty liver disease (NAFLD) based on features of tongue images.@*METHODS@#Healthy controls and volunteers confirmed to have NAFLD by liver ultrasound were recruited from China-Japan Friendship Hospital between September 2018 and May 2019, then the anthropometric indexes and sampled tongue images were measured. The tongue images were labeled by features, based on a brief protocol, without knowing any other clinical data, after a series of corrections and data cleaning. The algorithm was trained on images using labels and several anthropometric indexes for inputs, utilizing machine learning technology. Finally, a logistic regression algorithm and a decision tree model were constructed as 2 diagnostic models for NAFLD.@*RESULTS@#A total of 720 subjects were enrolled in this study, including 432 patients with NAFLD and 288 healthy volunteers. Of them, 482 were randomly allocated into the training set and 238 into the validation set. The diagnostic model based on logistic regression exhibited excellent performance: in validation set, it achieved an accuracy of 86.98%, sensitivity of 91.43%, and specificity of 80.61%; with an area under the curve (AUC) of 0.93 [95% confidence interval (CI) 0.68-0.98]. The decision tree model achieved an accuracy of 81.09%, sensitivity of 91.43%, and specificity of 66.33%; with an AUC of 0.89 (95% CI 0.66-0.92) in validation set.@*CONCLUSIONS@#The features of tongue images were associated with NAFLD. Both the 2 diagnostic models, which would be convenient, noninvasive, lightweight, rapid, and inexpensive technical references for early screening, can accurately distinguish NAFLD and are worth further study.

Mechanism of salvianolic acid B protecting H9C2 from OGD/R injury based on mitochondrial fission and fusion / 药学学报

This study aims to investigate the effect of salvianolic acid B (Sal B), the active ingredient of Salvia miltiorrhiza, on H9C2 cardiomyocytes injured by oxygen and glucose deprivation/reperfusion (OGD/R) through regulating mitochondrial fission and fusion. The process of myocardial ischemia-reperfusion injury was simulated by establishing OGD/R model. The cell proliferation and cytotoxicity detection kit (cell counting kit-8, CCK-8) was used to detect cell viability; the kit method was used to detect intracellular reactive oxygen species (ROS), total glutathione (t-GSH), nitric oxide (NO) content, protein expression levels of mitochondrial fission and fusion, apoptosis-related detection by Western blot. Mitochondrial permeability transition pore (MPTP) detection kit and Hoechst 33342 fluorescence was used to observe the opening level of MPTP, and molecular docking technology was used to determine the molecular target of Sal B. The results showed that relative to control group, OGD/R injury reduced cell viability, increased the content of ROS, decreased the content of t-GSH and NO. Furthermore, OGD/R injury increased the protein expression levels of dynamin-related protein 1 (Drp1), mitofusions 2 (Mfn2), Bcl-2 associated X protein (Bax) and cysteinyl aspartate specific proteinase 3 (caspase 3), and decreased the protein expression levels of Mfn1, increased MPTP opening level. Compared with the OGD/R group, it was observed that Sal B had a protective effect at concentrations ranging from 6.25 to 100 μmol·L-1. Sal B decreased the content of ROS, increased the content of t-GSH and NO, and Western blot showed that Sal B decreased the protein expression levels of Drp1, Mfn2, Bax and caspase 3, increased the protein expression level of Mfn1, and decreased the opening level of MPTP. In summary, Sal B may inhibit the opening of MPTP, reduce cell apoptosis and reduce OGD/R damage in H9C2 cells by regulating the balance of oxidation and anti-oxidation, mitochondrial fission and fusion, thereby providing a scientific basis for the use of Sal B in the treatment of myocardial ischemia reperfusion injury.

Perspective of Calcium Imaging Technology Applied to Acupuncture Research / 中国结合医学杂志

Acupuncture, a therapeutic treatment defined as the insertion of needles into the body at specific points (ie, acupoints), has growing in popularity world-wide to treat various diseases effectively, especially acute and chronic pain. In parallel, interest in the physiological mechanisms underlying acupuncture analgesia, particularly the neural mechanisms have been increasing. Over the past decades, our understanding of how the central nervous system and peripheral nervous system process signals induced by acupuncture has developed rapidly by using electrophysiological methods. However, with the development of neuroscience, electrophysiology is being challenged by calcium imaging in view field, neuron population and visualization in vivo. Owing to the outstanding spatial resolution, the novel imaging approaches provide opportunities to enrich our knowledge about the neurophysiological mechanisms of acupuncture analgesia at subcellular, cellular, and circuit levels in combination with new labeling, genetic and circuit tracing techniques. Therefore, this review will introduce the principle and the method of calcium imaging applied to acupuncture research. We will also review the current findings in pain research using calcium imaging from in vitro to in vivo experiments and discuss the potential methodological considerations in studying acupuncture analgesia.

Clinical characteristics of 21-hydroxylase deficiency in 22 cases / 中国基层医药

Objective:To investigate the clinical characteristics, diagnosis, and treatment experience of 21-hydroxylase deficiency, with the goal of enhancing the clinical doctors' understanding and diagnosis and treatment of this disease.Methods:A total of 22 patients with 21-hydroxylase deficiency who received treatment in People's Hospital of Xinjiang Uygur Autonomous Region from 2014 to 2022 were included in this study. The clinical data of patients with different types of 21-hydroxylase deficiency were analyzed. Their treatment outcomes were followed up.Results:The male-to-female ratio was 7:15, and the average age of the patients was 13.0 (4.8, 23.0) years. Female patients exhibited clitoral enlargement, pigmentation, infrequent menstruation, amenorrhea, hirsutism, acne, accelerated growth, infertility, and vomiting. Male patients exhibited precocious puberty, pigmentation, infertility, nausea, and vomiting. Children with salt deficiency exhibited electrolyte disorders and acid-base imbalance changes, including hyponatremia, hyperkalemia, hypotension, and metabolic acidosis. All patients with confirmed 21-hydroxylase deficiency were treated with glucocorticoid/mineralocorticoid replacement therapy. Five female patients also underwent external genital correction surgery. Among the 10 patients who were followed up, 5 female patients experienced regular or gradual resumption of menstruation, but the improvement in sex hormone levels was not significant.Conclusion:Newborns with gastrointestinal symptoms accompanied by electrolyte disorders, women with hyperandrogenism, male children with precocious puberty, and adult men with infertility should be screened for 21-hydroxylase deficiency. Upon diagnosis, hormone replacement therapy should be conducted to improve prognosis. Genetic testing should be performed as much as possible and regular follow-ups should be conducted to ensure normal adolescent development and good fertility.

Expression of Trichinella spiralis trehalase(TsTRE)protein and establishment of an indirect ELISA / 中国人兽共患病学报

We established an indirect ELISA method using Trichinella spiralis trehalase(TsTRE)protein expressed in prokaryotic cells.The TsTRE gene was amplified by RT-PCR and ligated into the pCold I plasmid,which was expressed in E.coli BL21 competent cells.The rTsTRE protein was purified through affinity column chromatography.The TsTRE protein was localized with immunofluorescence techniques,and the immunogenicity of rTsTRE was detected by westernblotting.Subse-quently,rTsTRE protein was used as a coating antigen to establish an indirect ELISA.We optimized the antigen-coating con-centration,serum dilution concentration,antigen-coating incubation time,type of blocking solution,blocking incubation time,HRP-labeled goat anti-rabbit IgG serum dilution concentration,HRP-labeled goat anti-rabbit IgG serum incubation time and response time of TMB.Subsequently,the critical value,repeatability,sensitivity,specificity and clinical detection rate of the ELISA were evaluated.Immunofluorescence indicated that trehalase was abundant in the rod-shaped body,tail and epidermis of Trichinella spiralis muscle larvae.Western-blot indicated that rTsTRE protein combined with the positive serum of mice infected with T.spiralis for 42 d;the band was approximately 60 kDa.The established indirect ELISA had a positive threshold of 0.384;the intra-run and inter-run coefficients of variation were 5.504％-7.630％ and 4.664％-9.929％,and did not exceed 10％.The lowest detectable titer was 1:1 280.No cross reaction was observed with antibodies to Clonorchissinensis,Schistosoma ja-ponicum,Ascaris suum,Toxocara gondii and Toxocara canis,and the clinical negative detection rate was 0％.Thus,we suc-cessfully expressed the rTsTRE protein.Moreover,the established indirect ELISA method using the TsTRE protein as the coating antigen had good repeatability,sensitivity,specificity and clinical detectability,and can be applied to the detection of clinical samples.

Antithrombin deficiency caused by SERPINC1 gene mutations predispose to venous thrombotic events / 中华检验医学杂志

Objective:To analyze 12 antithrombins (AT) gene mutations that cause AT deficiency and discuss the relationship between the SERPINC1 gene. mutations and venous thrombotic events.Methods:This study belongs to case series of observational studies. Collected the clinical data of 12 AT deficiency cases in the First Affiliated Hospital of Wenzhou Medical University from April 2014 to April 2021 and collected the blood samples before treatment. The AT activity (AT: A) and AT antigen (AT: Ag) was detected by chromogenic substrate and immunoturbidimetry, respectively. The 7 exons and flanking sequences of the SERPINC1 gene were sequenced directly by PCR, the suspected mutations were validated by reverse sequencing. Analyzed the correlation between the SERPINC1 gene. mutations and venous thrombotic events and figured out the proportion.Results:The AT: A of the 12 patients all decreased significantly, ranging from 30% to 66%, and the AT: Ag of the 7 patients decreased accordingly, showing type Ⅰ AT deficiency, and the AT: Ag of the other 5 patients were normal, presented type Ⅱ AT deficiency. 12 mutations were found including 6 heterozygous mutations which were discovered for the first time: c.456_458delCTT(p.phe121del), c.318_319insT(p.Asn75stop), c.922G>T(p.Gly276Cys), c.938T>C (p.Met281Thr), c.1346T>A(p.Leu417Gln)and c.851T>C(p.Met252Thr). All 12 patients had venous thrombosis, and 3 cases including 2 compound heterozygotes and 1 single heterozygote all suffered from deep venous thrombosis (DVT) when they were younger without obvious triggers. The other 9 patients all combined with the other thrombotic factors including old age, hypertensive, smoking, pregnancy, and prolonged immobilization.Conclusion:Patients with AT deficiency caused by SERPINC1 gene defects are prone to venous thrombosis, especially combined with other thrombotic factors.

Expression and clinical significance of laboratory of genetics and physiology 2, retinoic acid inducible gene I and melanoma differentiation associated gene 5 in children with hand, foot and mouth disease / 中国小儿急救医学

Objective:To detect the expression levels of laboratory of genetics and physiology 2 (LGP2), retinoic acid inducible gene I (RIG-I) and melanoma differentiation associated gene 5 (MDA5) in children with hand, foot and mouth disease (HFMD), and to explore their possible clinical significance in HFMD.Methods:Fifty children with HFMD, who visited Second Affiliated Hospital of Xi′an Jiao Tong University, Xi ′an Children′s Hospital and Xi ′an Central Hospital from May 2020 to May 2021, were selected as the research subjects, and 20 children with physical examination at the same age during the same period were selected as the control group.Children with HFMD were divided into enterovirus 71 (EV-A71) type and coxsackievirus A6 (CV-A6) type according to the results of pathogen detection, and then divided into mild group and severe group according to the severity of the disease.The relative mRNA expression levels of LGP2, RIG-I and MDA5 in each group, and the correlation among the three proteins were compared and analyzed.Results:Among 50 cases of HFMD, 26 cases were EV-A71 type (16 cases were mild and 10 cases were severe) and 24 cases were CV-A6 type (17 cases were mild and 7 cases were severe). There was no significant difference in age and sex between HFMD group and control group ( P>0.05). The relative expression levels of LGP2 mRNA in EV-A71 and CV-A6 HFMD cases were 2.37(1.78, 3.25)% and 1.88 (1.35, 3.13)%, lower than that in control group [2.97(2.61, 3.55)%]. Only the difference between CV-A6 HFMD children and control group was statistically significant ( Z=-2.310, P=0.021). The relative expression levels of RIG-I mRNA in EV-A71 and CV-A6 HFMD cases were 9.95 (7.79, 14.62)% and 9.78(7.04, 15.83)%, lower than that in control group [18.47(13.00, 21.07)%]. The differences were all statistically significant ( P<0.05). The relative expression levels of MDA5 mRNA in EV-A71 and CV-A6 HFMD cases were 4.41(2.82, 5.99)% and 3.98 (2.18, 7.41)%, lower than that in control group [5.10(3.52, 7.71)%], but the differences were not statistically significant.There were no significant differences in the relative expression levels of the three indicators between the mild and severe groups of children with EV-A71 or CV-A6 HFMD.The expression levels of LGP2, RIG-I and MDA5 mRNA were highly correlated( P<0.001). Conclusion:The relative expression levels of LGP2, RIG-I and MDA5 mRNA in children with HFMD are decreased in different degrees than those in normal children.And there is a correlation among them.

Endovascular treatment of ruptured lobulated anterior communicating artery aneurysms: A retrospective case series study of 24 patients / 国际脑血管病杂志

Objective:To investigate the efficacy and safety of endovascular treatment for ruptured lobulated anterior communicating artery aneurysm (ACoAA).Methods:Patients with ruptured lobulated ACoAA received endovascular treatment in Sanming First Hospital Affiliated to Fujian Medical University from June 2020 to June 2022 were retrospectively included. Their demographic, clinical and imaging characteristics, endovascular treatment methods and follow-up results were collected.Results:A total of 24 patients with ruptured lobulated ACoAA were included, including 9 males (37.5%) and 15 females (62.5%). Their age was 56.2±8.9 years old (range 39-74). The time from rupture to endovascular treatment was 10.9±12.5 h. The maximum diameter of the aneurysms was 5.1±1.0 mm and neck width was 3.0±0.7 mm. Nineteen patients (79.2%) were double-lobed and 5 (20.8%) were multilobed. Fisher's grade: grade 2 in 16 cases (66.7%), grade 3 in 6 cases (25%), and grade 4 in 2 cases (8.3%). Hunt-Hess grade: grade 0-2 in 5 cases (20.8%), grade 3-5 in 19 cases (79.2%). Glasgow Coma Scale score: 9-12 in 14 cases (58.3%), 13-15 in 10 cases (41.7%). Immediately postprocedural Raymond-Roy grade: grade 1 in 23 cases (95.8%), grade 2 in 1 case (4.2%). Raymond-Roy grade in imaging follow-up for 2 weeks to 3 months: grade 1 in 23 cases (95.8%), grade 2 in 1 case (4.2%). Follow-up for 2 to 12 months showed that 21 patients (87.5%) had good functional outcomes (modified Rankin Scale score ≤2), and there were no deaths.Conclusion:Endovascular treatment is a safe and effective treatment for ruptured lobulated AcoAA.

Phenotype and genotype analysis of progressive familial intrahepatic cholestasis type 4 / 中华实用儿科临床杂志

Objective:To improve the understanding of progressive familial intrahepatic cholestasis type 4 (PFIC4).Methods:Clinical characteristics in a 10-year-old boy with PFIC4 at the Second Hospital of Hebei Medical University in February 2020 were retrospectively analyzed, and the TJP2 gene mutations were analyzed. Results:The proband was a 10-year-old boy with a slow onset of intrahepatic cholestasis[normal γ-glutamyl transpeptidase(GGT)], hepatosplenomegaly and hepatic fibrosis.Laboratory tests showed elevated levels of total bilirubin, especially the direct bilirubin increased.Alanine aminotransferase, aspartate transaminase acid and total bile acid were elevated, while GGT remained in a normal range.Oral medication of ursodeoxycholic acid initially improved liver biochemical parameters, but later fluctuated.Adenosine dehydrogenase, coagulation indicators and hepatic fibrosis indexes were persistently abnormal.The average shear wave velocity of liver was 1.9 times of the upper limit of normal value.Compound heterozygous mutations c. 334G>A(p.A112T)/c.580_639delGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGG-CCTGGACCAAGACCATGCGCGCACCCGA (p.194_213delDRSRGRSLERGLDQDHARTR) were found in the TJP2 gene.The deletion mutation of the TJP2 gene was reported for the first time throughout the world.Both of his parents carried a heterozygous mutation. Conclusions:PFIC should be considered in intrahepatic cholestasis patients with a normal range of GGT.The detection of TJP2 gene mutation is of great value in the clinical diagnosis of PFIC4.The presence of TJP2 gene mutation may be a risk factor for patient developing cirrhosis of liver and primary liver cancer in early childhood.It is necessary for children with PFIC4 to be closely followed up.

Possible mechanisms of toxic effects of per-and polyfluoroalkyl substances exposure on thyroid / 环境与职业医学

Per- and polyfluoroalkyl substances (PFASs) are persistent organic pollutants (POPs). They are widely used in food packaging, tableware coating, stain resistant furniture, and other industrial production. Humans are exposed to PFASs on a daily basis through drinking water and intaking food, use of consumer products containing PFASs, and occupational exposure during the production of PFASs or related products. A growing body of toxicological studies has shown that PFASs exposure disrupts the thyroid hormone (TH) system and causes hypothyroidism, which is further supported by population epidemiological studies. PFASs can damage thyroid follicular cells and sodium/iodine transporters to impair iodine uptake by thyroid cells. They interfere with the synthesis of thyroglobulin, reduce the activity of thyroid peroxidase, and affect the synthesis and secretion of TH. They interfere with TH transportation and biological effects via TH competitive binding thyroid transporter or thyroid hormone receptor. They suppress TH signaling pathway and deiodinase activity, interfere negative feedback mechanism, and accelerate TH metabolism and excretion. The processes of TH synthesis, transport, degradation, and biological effects may all be affected by PFASs exposure. This paper described possible toxic mechanisms of PFASs on the thyroid from four aspects: TH biosynthesis, transport, action on target cells, and metabolic excretion stage, and summarized the thyroid toxicity associated with PFASs exposure.

Mechanism of Buyang Huanwu Decoction in protecting ischemic myocardium by regulating platelet autophagy in rats with acute myocardial infarction / 中国中药杂志

This study explored the effects of Buyang Huanwu Decoction(BYHWD) on platelet activation and differential gene expression after acute myocardial infarction(AMI). SD rats were randomly divided into a sham-operated group, a model group, a positive drug(aspirin) group, and a BYHWD group. Pre-treatment was conducted for 14 days with a daily oral dose of 1.6 g·kg~(-1) BYHWD and 0.1 g·kg~(-1) aspirin. The AMI model was established using the high ligation of the left anterior descending coronary artery method. The detection indicators included myocardial infarct size, heart function, myocardial tissue pathology, peripheral blood flow perfusion, platelet aggregation rate, platelet membrane glycoprotein CD62p expression, platelet transcriptomics, and differential gene expression. The results showed that compared with the sham-operated group, the model group showed reduced ejection fraction and cardiac output, decreased peripheral blood flow, and increased platelet aggregation rate and CD62p expression, and activated platelets. At the same time, TXB_2 content increased and 6-keto-PGF1α content decreased in serum. Compared with the model group, BYHWD increased ejection fraction and cardiac output, improved blood circulation in the foot and tail regions and cardiomyocytes arrangement, reduced myocardial infarct size and inflammatory infiltration, down-regulated platelet aggregation rate and CD62p expression, reduced serum TXB_2 content, and increased 6-keto-PGF1α content. Platelet transcriptome sequencing results revealed that BYHWD regulated mTOR-autophagy pathway-related genes in platelets. The differential gene expression levels were detected using real-time quantitative PCR. BYHWD up-regulated mTOR, down-regulated autophagy-related FUNDC1 and PINK genes, and up-regulated p62 gene expression. The results demonstrated that BYHWD could regulate platelet activation, improve blood circulation, and protect ischemic myocardium in AMI rats, and its mechanism is related to the regulation of the mTOR-autophagy pathway in platelets.

Clinical symptoms and distribution characteristics traditional Chinese medicine syndromes of pulmonary nodules / 中国中药杂志

A cross-sectional study method combined with two types of traditional Chinese medicine(TCM) syndrome differentiation methods was adopted to investigate the clinical symptoms and distribution characteristics of TCM syndromes in patients with pulmonary nodules from the perspectives of number, size, nature, and stability of pulmonary nodules by using the χ~2 test, systematic clustering and Apriori algorithm correlation analysis. The common clinical symptoms of pulmonary nodules were fatigue(77.35%) and irritability(75.40%), and 40 symptoms were clustered into 3 groups(digestive system symptoms, respiratory system symptoms, and emotional and systemic symptoms) and 8 major symptom categories. The proportion of cold and heat in complexity syndrome(63.43%) was higher based on cold-heat syndrome differentiation. The top two syndromes were Qi deficiency syndrome(88.03%) and Qi depression syndrome(83.17%) based on disease syndrome differentiation. Yang deficiency syndrome(60.52%) was more than Yin deficiency syndrome(50.16%). There were higher proportions of phlegm syndrome(78.67%) and Yang deficiency syndrome(69.33%) of so-litary pulmonary nodules in terms of the number of pulmonary nodules. In terms of size, the proportion of phlegm syndrome decreased as the mean diameter of pulmonary nodules increased, while the proportions of Yang deficiency syndrome and blood stasis syndrome increased. The distribution of Qi depression syndrome was more in those with mean diameter<10 mm(85.02%, P=0.044) and cold syndrome was more in those with mean diameter ≥10 mm(16.67%, P=0.024). In terms of the nature of pulmonary nodules, the proportions of Qi depression syndrome and heat syndrome decreased with the increase in solid components of pulmonary nodules, while the proportions of Yin deficiency syndrome and cold and heat in complexity syndrome increased. The blood stasis syndrome accounted for a higher proportion of pulmonary nodules with solid components. In terms of the stability of pulmonary nodules, dampness syndrome(72.97%), blood stasis syndrome(37.84%), and cold and heat in complexity syndrome(70.27%) accounted for higher proportions. In addition, patients with new nodules presented higher proportions in Qi inversion syndrome(52.00%, P=0.007) and cold and heat in complexity syndrome(66.00%, P=0.008). Meanwhile, 11 syndromes were associated and 4 common compound syndromes were obtained(Qi deficiency and depression syndrome, Qi depression and phlegm coagulation syndrome, Qi deficiency and phlegm coagulation syndrome, and Qi deficiency and dampness obstruction syndrome). Qi deficiency syndrome and Qi depression syndrome could be associated with other syndromes. The results show that the main clinical symptoms of pulmonary nodules are fatigue and irritability. The main TCM syndromes of pulmonary nodules are Qi deficiency syndrome, Qi depression syndrome, Yang deficiency syndrome, and cold and heat in complexity syndrome. The distribution of TCM syndromes is significantly correlated with the size of pulmonary nodules and the presence or absence of new nodules. The common compound syndromes are Qi deficiency and depression syndrome, Qi depression and phlegm coagulation syndrome, Qi deficiency and phlegm coagulation syndrome, and Qi deficiency and dampness obstruction syndrome.

Recent advances in small molecule inhibitors of interleukin‑1 receptor-associated kinase / 药学学报

Interleukin-1 receptor associated kinase 4 (IRAK-4), acting as a serine threonine kinase, is considered as a key signal node for the transduction of IL-1R family and TLRs signal pathway. Studies have found that IRAK-4 has a hand in many signal pathways, involving the inflammatory response of human joints, intestines, liver and nervous system, as well as other autoimmune diseases. It is also one of the causes of drug resistance of some cancer cells. Therefore, IRAK-4 tends to be an effective therapeutic target for inflammatory diseases and cancer. The prospects for the development of drugs in this pathway is to develop novel IRAK-4 small molecule inhibitors and investigate their safety and effectiveness, enrich the clinical treatment of inflammatory and cancer diseases finally. This paper classified and summarized the latest research progress on small molecule inhibitors of IRAK-4 signaling pathway according to structures of the compounds, in order to provide assistances and references for the research and development of related drugs.