Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Results 1 - 20 de 192
Filter
1.
Article in Chinese | WPRIM | ID: wpr-879520

ABSTRACT

OBJECTIVE@#To detect the mutation site in a pedigree affected with autosomal dominant polycystic kidney disease (ADPKD) and verify its impact on the protein function.@*METHODS@#Peripheral blood samples were collected from the proband and his pedigree members for the extraction of genomic DNA. Mutational analysis was performed on the proband through whole-exome sequencing. Suspected variant was verified by Sanger sequencing. A series of molecular methods including PCR amplification, restriction enzyme digestion, ligation and transformation were also used to construct wild-type and mutant eukaryotic expression vectors of the PKD2 gene, which were transfected into HEK293T and HeLa cells for the observation of protein expression and cell localization.@*RESULTS@#The proband was found to harbor a c.2051dupA (p. Tyr684Ter) frame shift mutation of the PKD2 gene, which caused repeat of the 2051st nucleotide of its cDNA sequence and a truncated protein. Immunofluorescence experiment showed that the localization of the mutant protein within the cell was altered compared with the wild-type, which may be due to deletion of the C-terminus of the PKD2 gene.@*CONCLUSION@#The c.2051dupA (p. Tyr684Ter) mutation of the PKD2 gene probably underlay the pathogenesis of ADPKD in this pedigree.


Subject(s)
DNA Mutational Analysis , Female , Frameshift Mutation , HEK293 Cells , HeLa Cells , Humans , Male , Pedigree , Polycystic Kidney, Autosomal Dominant/physiopathology , Protein Kinases/genetics , Protein Transport/genetics , Whole Exome Sequencing
2.
Autops. Case Rep ; 10(1): 2019128, Jan.-Mar. 2020. ilus, tab
Article in English | LILACS | ID: biblio-1052960

ABSTRACT

We describe an autopsy case of a 45-year-old male diagnosed with autosomal dominant polycystic kidney disease who presented with complaints of altered sensorium. The autopsy revealed multiple tumor-like masses in the liver, which on histological examination depicted multiple large suppurative granulomas with the presence of variable acid-fast coccobacilli (consistent with Brucella spp.). Interestingly, extensive amyloid deposition in multiple organs was noted. To the best of our knowledge, this is the first case of chronic brucellosis causing tumor-like abscesses in the liver accompanied by secondary systemic amyloidosis in a patient with underlying autosomal dominant polycystic kidney disease.


Subject(s)
Humans , Male , Middle Aged , Polycystic Kidney, Autosomal Dominant/pathology , Amyloidosis , Autopsy , Brucellosis , Diagnosis, Differential
3.
Article in Chinese | WPRIM | ID: wpr-828948

ABSTRACT

OBJECTIVE@#To investigate the optimal dose range of immunosuppressants in patients with autosomal dominant polycystic kidney disease (ADPKD) after renal transplantation.@*METHODS@#A cohort of 68 patients with ADPKD who received their first renal transplantation between March, 2000 and January, 2018 in our institute were retrospectively analyzed, with 68 non-ADPKD renal transplant recipients matched for gender, age and date of transplant as the control group. We analyzed the differences in patient and renal survival rates, postoperative complications and concentrations of immunosuppressive agents between the two groups at different time points within 1 year after kidney transplantation. The concentrations of the immunosuppressants were also compared between the ADPKD patients with urinary tract infections (UTI) and those without UTI after the transplantation.@*RESULTS@#The recipients with ADPKD and the control recipients showed no significantly difference in the overall 1-, 5-, and 10- year patient survival rates (96.6% 96.0%, 94.1% 93.9%, and 90.6% 93.9%, respectively; > 0.05), 1-, 5-, and 10-year graft survival rates (95.2% 96.0%, 90.8% 87.2%, and 79.0% 82.3%, respectively; > 0.05), or the incidences of other post- transplant complications including acute rejection, gastrointestinal symptoms, cardiovascular events, pneumonia, and neoplasms ( > 0.05). The plasma concentrations of both tacrolimus and mycophenolate mofetil (MPA) in ADPKD group were significantly lower than those in the control group at 9 months after operation ( < 0.05). The incidence of UTI was significantly higher in ADPKD patients than in the control group ( < 0.05). In patients with ADPKD, those with UTI after transplantation had a significantly higher MPA plasma concentration ( < 0.05).@*CONCLUSIONS@#In patients with ADPKD after renal transplant, a higher dose of MPA is associated with a increased risk of UTI, and their plasma concentrations of immunosuppressants for long-term maintenance of immunosuppression regimen can be lower than those in other kidney transplantation recipients.


Subject(s)
Graft Survival , Humans , Immunosuppressive Agents , Kidney Transplantation , Polycystic Kidney, Autosomal Dominant , Retrospective Studies
4.
Article in Chinese | WPRIM | ID: wpr-826533

ABSTRACT

OBJECTIVE@#To carry out genetic analysis for a family with a fetus manifesting bilateral polycystic renal dysplasia and oligohydramnios at 16 gestational week and a previous history for fetal renal anomaly.@*METHODS@#Ultrasound scan was carried out to detect the morphological changes. Following genetic counselling, the parents had decided to terminate the pregnancy. Fetal kidneys were subjected to histological examination. Target capture and next generation sequencing (NGS) was applied to the abortus to detect potential variants. The results were verified by Sanger sequencing.@*RESULTS@#Histological examination of fetal kidneys revealed cystic changes without cortex, medulla or normal renal structure. NGS has identified a heterozygous c.100+1G>A variant and deletion of exon 3 of the INVS gene, which were respectively inherited from the mother and father.@*CONCLUSION@#Through NGS and Sanger sequencing, the fetus was diagnosed with type II nephronophthisis (NPHP2). Above result can provide guidance for further pregnancy and enforce understanding of clinical features and genetic etiologies for NPHP.


Subject(s)
Female , Fetus , Genetic Testing , Heterozygote , Humans , Mutation , Polycystic Kidney, Autosomal Dominant , Diagnostic Imaging , Genetics , Pregnancy , Sequence Deletion , Genetics , Transcription Factors , Genetics , Ultrasonography
5.
J. bras. nefrol ; 41(4): 570-574, Out.-Dec. 2019. graf
Article in English | LILACS | ID: biblio-1056613

ABSTRACT

Abstract The occurrence of ascites after Renal Transplant (RT) is infrequent, and may be a consequence of surgical or medical complications. Case report: 61 year-old, male, history of arterial hypertension, tongue carcinoma and alcoholic habits 12-20g/day. He had chronic kidney disease secondary to autosomal dominant polycystic kidney disease, without hepatic polycystic disease. He underwent cadaver donor RT in September 2017. He had delayed graft function by surgically corrected renal artery stenosis. He was admitted in January 2018 for ascites de novo, with no response to diuretics. HE had visible abdominal collateral circulation. Graft dysfunction, adequate tacrolinemia, Innocent urinary sediment, mild anemia, without thrombocytopenia. Serum albumin 4.0g / dL. Normal hepatic biochemistry. Peritoneal fluid with transudate characteristics and serum albumin gradient > 1.1. Ultrasound showed hepatomegaly, permeable vascular axes, without splenomegaly. Mycophenolate mofetil was suspended, with reduced remaining immunosuppression. He maintained refractory ascites: excluded infectious, metabolic, autoimmune and neoplastic etiologies. No nephrotic proteinuria and no heart failure. MRI: micronodules compatible with bile cysts. Upper Digestive Tract Endoscopy did not show gastroesophageal varicose veins. Normal abdominal lymphoscintigraphy. He underwent exploratory laparoscopy with liver biopsy: incomplete septal cirrhosis of probable vascular etiology some dilated bile ducts. He maintained progressive RT dysfunction and restarted hemodialysis. The proposed direct measurement of portal pressure was delayed by ascites resolution. There was further recovery of the graft function. Discussion: Incomplete septal cirrhosis is an uncommon cause of non-cirrhotic portal hypertension. Its definition is not well known, morphological and pathophysiological. We have not found published cases of post-RT ascites secondary to this pathology, described as possibly associated with drugs, immune alterations, infections, hypercoagulability and genetic predisposition.


Resumo A ocorrência de ascite no pós-Transplante Renal (TR) é infrequente, podendo ser consequência de complicações cirúrgicas ou médicas. Caso clínico: 61 anos, masculino, antecedentes de hipertensão arterial, carcinoma da língua e hábitos alcoólicos 12-20g/dia. Doença renal crônica secundária à doença renal poliquística autossômica dominante, sem poliquistose hepática. Submetido a TR de doador cadáver em setembro de 2017. Atraso na função de enxerto por estenose da artéria renal, corrigida cirurgicamente. Internado em janeiro de 2018 por ascite de novo, sem resposta a diuréticos. Circulação colateral abdominal visível. Disfunção do enxerto, tacrolinemia adequada. Sedimento urinário inocente. Anemia ligeira, sem trombocitopenia. Albumina sérica 4,0g/dL. Bioquímica hepática normal. Líquido peritoneal com características de transudado e gradiente sero-ascítico de albumina > 1,1. Ecografia com hepatomegalia, eixos vasculares permeáveis, sem esplenomegalia. Suspendeu micofenolato mofetil, reduziu restante imunossupressão. Manteve ascite refratária: excluídas etiologias infecciosas, metabólicas, autoimunes e neoplásicas. Sem proteinúria nefrótica e sem insuficiência cardíaca. RM: micronódulos compatíveis com quistos biliares. EDA sem varizes gastroesofágicas. Linfocintigrafia abdominal normal. Submetido a laparoscopia exploradora com biópsia hepática: cirrose septal incompleta de provável etiologia vascular, alguns ductos biliares dilatados. Manteve disfunção progressiva do TR, reiniciou hemodiálise. Proposta medição direta da pressão portal, protelada por resolução da ascite. Recuperação posterior da função de enxerto. Discussão: A cirrose septal incompleta é uma causa incomum de hipertensão portal não cirrótica. A sua definição é morfológica e a fisiopatologia, pouco conhecida. Não encontramos publicados casos de ascite pós-TR secundária a esta patologia, descrita como possivelmente associada a fármacos, alterações imunitárias, infecções, hipercoagulabilidade e predisposição genética.


Subject(s)
Humans , Male , Middle Aged , Ascites/etiology , Kidney Transplantation/adverse effects , Renal Insufficiency, Chronic/surgery , Liver Cirrhosis/pathology , Ascites/diagnosis , Renal Dialysis/standards , Polycystic Kidney, Autosomal Dominant/complications , Delayed Graft Function/complications , Hypertension, Portal/etiology , Liver Cirrhosis/complications
6.
Article in Chinese | WPRIM | ID: wpr-771999

ABSTRACT

OBJECTIVE@#To explore the genetic etiology for 17 pedigrees affected with autosomal dominant polycystic kidney disease (ADPKD).@*METHODS@#Peripheral blood samples were derived from the probands and their parents with informed consent. Following DNA extraction, targeted capture and next generation sequencing were carried out in search for potential disease-causing variants. Sanger sequencing was used to validate candidate pathogenic variants co-segregating with the disease in each pedigree. Prenatal diagnosis was provided for one family.@*RESULTS@#Among the 17 probands, 14 PKD1 mutations and 3 PKD2 mutations were detected, which included 6 missense mutations, 4 nonsense mutations and 7 frameshift mutations. Of these, 8 have been associated with ADPKD previously and 9 were novel, which included c.7625G>T (p.Gly2542Val), c.3673C>T (p.Gln1225*), c.11048dupT (p.Thr3684Aspfs*38), c.9083_9084delAG (p.Glu3028Glyfs*40), c.10560delG (p.Pro3521Hisfs*6), c.7952_7974del TGTCCCTGAGGGTCCACACTGTG (p.Val2651Glyfs*2) of PKD1, and c.662T>G (p.Leu221*), c.1202_1203 insCT (p.Glu401Aspfs*2), and c.919 delA (p.Ser307Valfs*10) of PKD2. Prenatal testing showed that the fetus did not carry the same mutation as the proband.@*CONCLUSION@#Identification of causative mutations in the 17 pedigrees affected with ADPKD has provided a basis for genetic counseling and reproductive guidance. The novel findings have enriched the mutational spectrum of the PKD1 and PKD2 genes.


Subject(s)
DNA Mutational Analysis , Female , Humans , Mutation , Pedigree , Polycystic Kidney, Autosomal Dominant , Pregnancy , Prenatal Diagnosis , TRPP Cation Channels
7.
Article in Chinese | WPRIM | ID: wpr-813032

ABSTRACT

Autosomal dominant polycystic kidney disease (ADPKD) is a common hereditary disease, mainly caused by polycystic kidney disease 1/2 (PKD1/2) gene mutation. The main manifestation is the formation of multiple progressive enlarged cysts in both kidneys, which can be accompanied by decreased glomerular filtration rate, hypertension, liver cyst and cerebral aneurysm. About 45% of patients will progress to end-stage renal failure before the age of 60. ADPKD gene sequencing can be chosen for suspicious patients with atypical clinical features, no positive family history, and inconspicuous imaging findings. In the ADPKD positive families, imaging examination is the main means of diagnosing ADPKD. Height-adjusted total kidney volume (htTKV) and kidney growth rate are commonly used to monitor ADPKD disease progression and prognosis. There is no effective treatment for ADPKD to stop its progress. Drugs such as tolvaptan and bosutinib can delay the renal disfunction and they have been applied to clinical therapy in Europe and America.


Subject(s)
Disease Progression , Glomerular Filtration Rate , Humans , Kidney , Polycystic Kidney, Autosomal Dominant , Tolvaptan
8.
Article in English | WPRIM | ID: wpr-739197

ABSTRACT

Autosomal dominant polycystic kidney disease (ADPKD) is the most frequent hereditary renal disease and causes terminal chronic renal failure. ADPKD is characterized by bilateral multiple renal cysts, which are produced by mutations of the PKD1 and PKD2 genes. PKD1 is located on chromosome 16 and encodes a protein that is involved in cell cycle regulation and intracellular calcium transport in epithelial cells and is responsible for 85% of ADPKD cases. Although nine cases of unilateral ADPKD with contralateral kidney agenesis have been reported, there have been no reports of early childhood ADPKD. Here, we report the only case of unilateral ADPKD with contralateral kidney dysplasia in the world in a four year-old girl who was intrauterinely diagnosed since she was 20 weeks old and followed for four years until present.


Subject(s)
Calcium , Cell Cycle , Chromosomes, Human, Pair 16 , Epithelial Cells , Female , Humans , Kidney , Kidney Failure, Chronic , Polycystic Kidney, Autosomal Dominant
9.
Article in English | WPRIM | ID: wpr-739185

ABSTRACT

Autosomal dominant polycystic kidney disease (ADPKD) is the most frequent hereditary renal disease and causes terminal chronic renal failure. ADPKD is characterized by bilateral multiple renal cysts, which are produced by mutations of the PKD1 and PKD2 genes. PKD1 is located on chromosome 16 and encodes a protein that is involved in cell cycle regulation and intracellular calcium transport in epithelial cells and is responsible for 85% of ADPKD cases. Although nine cases of unilateral ADPKD with contralateral kidney agenesis have been reported, there have been no reports of early childhood ADPKD. Here, we report the only case of unilateral ADPKD with contralateral kidney dysplasia in the world in a four year-old girl who was intrauterinely diagnosed since she was 20 weeks old and followed for four years until present.


Subject(s)
Calcium , Cell Cycle , Chromosomes, Human, Pair 16 , Epithelial Cells , Female , Humans , Kidney , Kidney Failure, Chronic , Polycystic Kidney Diseases , Polycystic Kidney, Autosomal Dominant
10.
National Journal of Andrology ; (12): 409-413, 2018.
Article in Chinese | WPRIM | ID: wpr-689742

ABSTRACT

<p><b>Objective</b>Autosomal dominant polycystic kidney disease (ADPKD) is one of the most common genetic renal diseases, which may cause oligoasthenospermia and azoospermia and result in male infertility. This study aimed to analyze the outcomes of preimplantation genetic diagnosis (PGD) in male patients with ADPKD-induced infertility.</p><p><b>METHODS</b>We retrospectively analyzed the clinical data on 7 male patients with ADPKD-induced infertility undergoing PGD from April 2015 to February 2017, including 6 cases of oligoasthenospermia and 1 case of obstructive azoospermia, all with the PKD1 gene heterozygous mutations. Following intracytoplasmic sperm injection (ICSI), we performed blastomere biopsy after 5 or 6 days of embryo culture and subjected the blastomeres to Sureplex whole-genome amplification, followed by haplotype linkage analysis, Sanger sequencing, array-based comparative genomic hybridization to assess the chromosomal ploidy of the unaffected embryos, and identification of the unaffected euploid embryos for transfer.</p><p><b>RESULTS</b>One PGD cycle was completed for each of the 7 patients. Totally, 26 blastocysts were developed, of which 12 were unaffected and diploid. Clinical pregnancies were achieved in 6 cases following 7 cycles of frozen embryo transplantation, which included 5 live births and 1 spontaneous abortion.</p><p><b>CONCLUSIONS</b>For males with ADPKD-induced infertility, PGD may contribute to high rates of clinical pregnancy and live birth and prevent ADPKD in the offspring as well. This finding is also meaningful for the ADPKD patients with normal fertility.</p>


Subject(s)
Abortion, Spontaneous , Genetics , Biopsy , Blastocyst , Comparative Genomic Hybridization , Embryo Transfer , Female , Humans , Infertility, Male , Genetics , Male , Mutation , Polycystic Kidney, Autosomal Dominant , Diagnosis , Genetics , Pregnancy , Pregnancy Outcome , Preimplantation Diagnosis , Retrospective Studies , Sperm Injections, Intracytoplasmic
12.
Article in English | WPRIM | ID: wpr-714979

ABSTRACT

Compressive femoral neuropathy is a disabling condition accompanied by difficulty in hip flexion and knee extension. It may result from retroperitoneal hematoma or bleeding, or from complications associated with pelvic, hip surgery, and renal transplants. A 55-year-old female with autosomal dominant polycystic kidney disease presented with proximal muscle weakness in lower extremities. The patient experienced recurrent renal cyst infection, with aggravated weakness during each event. Electromyography and nerve conduction study revealed bilateral femoral neuropathy. Computed tomography and magnetic resonance images were added to further identify the cause. As a result, a diagnosis of femoral neuropathy caused by enlarged polycystic kidney was made. Cyst infection was managed with antibiotics. Renal function was maintained by frequent regular hemodialysis. While avoiding activities that may increase abdominal pressure, rehabilitation exercises were provided. Motor strength in hip flexion and knee extension improved, and was confirmed via electrodiagnostic studies.


Subject(s)
Anti-Bacterial Agents , Diagnosis , Electromyography , Exercise , Female , Femoral Neuropathy , Hematoma , Hemorrhage , Hip , Humans , Knee , Lower Extremity , Middle Aged , Muscle Weakness , Neural Conduction , Polycystic Kidney Diseases , Polycystic Kidney, Autosomal Dominant , Rehabilitation , Renal Dialysis
13.
Article in English | WPRIM | ID: wpr-714851

ABSTRACT

A 47-year-old female previously diagnosed with ADPKD visited the hospital due to sudden pain in her upper abdomen and back. Esophagogastroduodenoscopy, contrast-enhanced abdominal computed tomography (CT), and CT angiography identified an esophageal artery pseudoaneurysm and hematoma in the esophagus. Urgent angiography and embolization were performed. After the procedure, CT angiography and positron emission tomography were performed due to differences in blood pressure between the arms. The patient was also found to have Takayasu arteritis and subsequently received outpatient follow-up care. The possible mechanisms that cause vascular abnormalities in ADPKD patients include damaged vascular integrity due to abnormal polycystin expression caused by PKD mutations and connective tissue abnormalities. Further research is needed to confirm these mechanisms, and ADPKD patients should be assessed for vascular abnormalities.


Subject(s)
Abdomen , Aneurysm , Aneurysm, False , Angiography , Arm , Arteries , Blood Pressure , Connective Tissue , Endoscopy, Digestive System , Esophagus , Female , Follow-Up Studies , Hematoma , Humans , Middle Aged , Outpatients , Polycystic Kidney, Autosomal Dominant , Positron-Emission Tomography , Takayasu Arteritis
14.
Braz. j. med. biol. res ; 51(3): e6560, 2018. graf
Article in English | LILACS | ID: biblio-889037

ABSTRACT

Autosomal dominant tubulointerstitial kidney disease (ADTKD) is characterized by autosomal dominant inheritance, progressive chronic kidney disease, and a bland urinary sediment. ADTKD is most commonly caused by mutations in the UMOD gene encoding uromodulin (ADTKD-UMOD). We herein report the first confirmed case of a multi-generational Brazilian family with ADTKD-UMOD, caused by a novel heterozygous mutation (c.163G>A, GGC→AGC, p.Gly55Ser) in the UMOD gene. Of 41 family members, 22 underwent genetic analysis, with 11 individuals found to have this mutation. Three affected individuals underwent hemodialysis, one peritoneal dialysis, and one patient received a kidney transplant from a family member later found to be genetically affected. Several younger individuals affected with the mutation were also identified. Clinical characteristics included a bland urinary sediment in all tested individuals and a kidney biopsy in one individual showing tubulointerstitial fibrosis. Unlike most other reported families with ADTKD-UMOD, neither gout nor hyperuricemia was found in affected individuals. In summary, we report a novel UMOD mutation in a Brazilian family with 11 affected members, and we discuss the importance of performing genetic testing in families with inherited kidney disease of unknown cause.


Subject(s)
Humans , Female , Middle Aged , Polycystic Kidney, Autosomal Dominant/genetics , Uromodulin/genetics , Mutation/genetics , Pedigree , Biopsy , Polycystic Kidney, Autosomal Dominant/pathology , Genotype
15.
Article in English | WPRIM | ID: wpr-739604

ABSTRACT

A 22-year-old male patient was diagnosed with autosomal dominant polycystic kidney disease (ADPKD). He received conservative treatment with an angiotensin-converting enzyme inhibitor. Two years later, oral therapy, consisting of 60 mg tolvaptan per day, was initiated. Compared with height-adjusted total kidney volume, the rate of kidney growth reduced significantly from 7.33% to 0.66% annually, since commencement of the tolvaptan therapy. The liver enzyme profile and serum sodium level and osmolality were constantly within normal ranges. In Korea, this is the first reported case of a patient with ADPKD who received tolvaptan treatment for more than 1 year. This case demonstrates that long-term tolvaptan treatment appears to be safe, well tolerated, and effective for ADPKD.


Subject(s)
Humans , Kidney , Korea , Liver , Male , Osmolar Concentration , Polycystic Kidney, Autosomal Dominant , Reference Values , Sodium , Young Adult
16.
Article in English | WPRIM | ID: wpr-741464

ABSTRACT

We report our first experience with the use of contrast-enhanced ultrasonography (CEUS) to differentiate between a complicated hemorrhagic renal cyst and a cystic renal cell carcinoma in a 50-year-old man diagnosed with autosomal dominant polycystic kidney disease undergoing hemodialysis for end-stage renal disease. CEUS could successfully differentiate between a complicated hemorrhagic renal cyst and a cystic renal cell carcinoma, as opposed to computed tomography (CT) or magnetic resonance imaging (MRI), which could not distinguish between the 2 disease conditions. CEUS is comparable diagnostic tool as CT or MRI to distinguish between benign and malignant cystic renal masses.


Subject(s)
Carcinoma, Renal Cell , Humans , Kidney Failure, Chronic , Magnetic Resonance Imaging , Middle Aged , Polycystic Kidney, Autosomal Dominant , Renal Dialysis , Ultrasonography
17.
Article in Chinese | WPRIM | ID: wpr-335125

ABSTRACT

<p><b>OBJECTIVE</b>To determine the molecular etiology for a family affected with autosomal dominant polycystic kidney disease and provide prenatal diagnosis for the family.</p><p><b>METHODS</b>Clinical data of the family was collected. Target region sequencing with monogenetic disorders capture array combined with Sanger sequencing and bioinformatics analysis were performed in turn. SIFT and NCB1 were used to evaluate the conservation of the gene and pathogenicity of the identified mutation.</p><p><b>RESULTS</b>Target region sequencing has identified a novel c.11333C to A (p.T3778N) mutation of the PKD1 gene in the proband and the fetus, which was confirmed by Sanger sequencing in three affected individuals from the family. The same mutation was not detected in healthy members of the pedigree. Bioinformatics analysis suggested that the mutation has caused a likely pathogenic amino acid substitution of Threonine by Aspartic acid, and Clustal analysis indicated that the altered amino acid is highly conserved in mammals.</p><p><b>CONCLUSION</b>A novel mutation of the PKD1 gene has been identified in an affected Chinese family. The mutation is probably responsible for a range of clinical manifestations, for which reliable prenatal diagnosis and genetic counseling may be provided.</p>


Subject(s)
Adult , Amino Acid Sequence , Asian Continental Ancestry Group , Genetics , Base Sequence , China , DNA Mutational Analysis , Exons , Female , Humans , Male , Middle Aged , Molecular Sequence Data , Mutation , Pedigree , Polycystic Kidney, Autosomal Dominant , Genetics , TRPP Cation Channels , Genetics , Young Adult
19.
Article in English | WPRIM | ID: wpr-145685

ABSTRACT

Autosomal dominant polycystic kidney disease (ADPKD) is the most common inherited renal disease. Hypertension is common and occurs before decline in renal function. However, the coexistence of hypertension and hypokalemia is rare in ADPKD patients. We report on a 32-year-old woman with secondary aldosteronism. Magnetic resonance imaging of the renal arteries revealed multiple cysts of varying sizes in both the kidneys and the liver, compatible with ADPKD. Increased reninangiotensin-aldosterone system activity was secondary to cyst expansion. After initiation of angiotensin II receptor blocker, her blood pressure was controlled without additional requirement of potassium.


Subject(s)
Adult , Angiotensin Receptor Antagonists , Blood Pressure , Diagnosis , Female , Humans , Hyperaldosteronism , Hypertension , Hypokalemia , Kidney , Liver , Magnetic Resonance Imaging , Polycystic Kidney, Autosomal Dominant , Potassium , Receptors, Angiotensin , Renal Artery
20.
Article in English | WPRIM | ID: wpr-164783

ABSTRACT

Tuberous sclerosis complex (TSC, MIM#191100) is an autosomal dominant neurocutaneous syndrome caused by mutation or deletion of TSC1 encoding hamartin or TSC2 encoding tuberin and characterized by seizure, mental retardation, and multiple hamartomas or benign tumors in the skin, brain, retina, heart, kidney, and lungs. The TSC2 gene on chromosome 16p13.3 lies adjacent to the PKD1 gene which is responsible for autosomal dominant polycystic kidney disease (MIM#173900). The TSC2/PKD1 contiguous gene syndrome (TSC2/PKD1 CGDS, MIM#600273) is caused by deletion of both TSC2 and PKD1 gene. We recently experienced a 15 month-old boy and a 26 month-old girl with TSC2/PKD1 CGDS confirmed by multiplex ligation-dependent probe amplification (MLPA) analysis. They showed not only typical neurologic manifestations of TSC such as epilepsy, subependymal nodules, and subcortical tubers, but also polycystic kidney disease. The contiguous gene syndrome involving PKD1 and TSC2 should be suspected in children with enlarged polycystic kidneys and TSC. MLPA analysis is a useful method for the genetic confirmation of TSC2/PKD1 CGDS.


Subject(s)
Brain , Child , Epilepsy , Female , Gene Deletion , Hamartoma , Heart , Humans , Intellectual Disability , Kidney , Lung , Male , Methods , Multiplex Polymerase Chain Reaction , Neurocutaneous Syndromes , Neurologic Manifestations , Polycystic Kidney Diseases , Polycystic Kidney, Autosomal Dominant , Retina , Seizures , Skin , Tuberous Sclerosis
SELECTION OF CITATIONS
SEARCH DETAIL