Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 47
Filtrar
1.
Braz. j. biol ; 83: 1-7, 2023. map, graf, tab
Artículo en Inglés | LILACS, VETINDEX | ID: biblio-1468971

RESUMEN

Birds are very valuable indicators of species richness and endemic patterns in a specified ecosystem, which eventually help the scientist to measure the environmental degradation. The aim of present study was to know human knowledge and attitude toward urban birds in Faisalabad city, Pakistan. The study conducted in four consecutive months: November 2019 to February 2020. Population of birds was noted from eight residential towns of Faisalabad city, data were collected through questionnaire. Faisalabad has a reasonably large population of birds and present data show that, there is a significant difference between favorite bird of residential areas and institutions. The pigeon received the most likeness in bird population among residential area residents, while the myna received the least. The most popular bird in Faisalabad institutions was the sparrow, while the least popular bird was the common myna. Bird adaptation percentage of residential areas and institutional areas of Faisalabad was the highest for parrot and sparrow respectively. People in residential areas and institutions, on the other hand, adapted least to common myna. It is concluded that people of the study area like birds and offered food and high population of birds are present in study area.


Os pássaros são indicadores muito valiosos da riqueza de espécies e padrões endêmicos em um determinado ecossistema, o que acaba ajudando o cientista a medir a degradação ambiental. O objetivo do presente estudo foi conhecer o conhecimento humano e a atitude em relação às aves urbanas na cidade de Faisalabad, Paquistão. O estudo foi conduzido em quatro meses consecutivos: novembro de 2019 a fevereiro de 2020. A população de pássaros foi observada em oito cidades residenciais da cidade de Faisalabad, os dados foram coletados por meio de questionário. Faisalabad tem uma população razoavelmente grande de pássaros, e os dados atuais mostram que há uma diferença significativa entre as aves favoritas de áreas residenciais e instituições. O pombo recebeu mais semelhanças na população de pássaros entre os residentes de áreas residenciais, enquanto o myna recebeu menos. A ave mais popular nas instituições de Faisalabad era o pardal, enquanto a ave menos popular era o myna comum. A porcentagem de adaptação de pássaros em áreas residenciais e institucionais de Faisalabad foi a mais alta para papagaios e pardais, respectivamente. As pessoas em áreas residenciais e instituições, por outro lado, se adaptaram menos ao myna comum. Conclui-se que pessoas da área de estudo como pássaros e alimentos oferecidos e alta população de pássaros estão presentes na área de estudo.


Asunto(s)
Animales , Aves/clasificación , Ecosistema
2.
Braz. j. biol ; 832023.
Artículo en Inglés | LILACS-Express | LILACS, VETINDEX | ID: biblio-1469187

RESUMEN

Abstract Birds are very valuable indicators of species richness and endemic patterns in a specified ecosystem, which eventually help the scientist to measure the environmental degradation. The aim of present study was to know human knowledge and attitude toward urban birds in Faisalabad city, Pakistan. The study conducted in four consecutive months: November 2019 to February 2020. Population of birds was noted from eight residential towns of Faisalabad city, data were collected through questionnaire. Faisalabad has a reasonably large population of birds and present data show that, there is a significant difference between favorite bird of residential areas and institutions. The pigeon received the most likeness in bird population among residential area residents, while the myna received the least. The most popular bird in Faisalabad institutions was the sparrow, while the least popular bird was the common myna. Bird adaptation percentage of residential areas and institutional areas of Faisalabad was the highest for parrot and sparrow respectively. People in residential areas and institutions, on the other hand, adapted least to common myna. It is concluded that people of the study area like birds and offered food and high population of birds are present in study area.


Resumo Os pássaros são indicadores muito valiosos da riqueza de espécies e padrões endêmicos em um determinado ecossistema, o que acaba ajudando o cientista a medir a degradação ambiental. O objetivo do presente estudo foi conhecer o conhecimento humano e a atitude em relação às aves urbanas na cidade de Faisalabad, Paquistão. O estudo foi conduzido em quatro meses consecutivos: novembro de 2019 a fevereiro de 2020. A população de pássaros foi observada em oito cidades residenciais da cidade de Faisalabad, os dados foram coletados por meio de questionário. Faisalabad tem uma população razoavelmente grande de pássaros, e os dados atuais mostram que há uma diferença significativa entre as aves favoritas de áreas residenciais e instituições. O pombo recebeu mais semelhanças na população de pássaros entre os residentes de áreas residenciais, enquanto o myna recebeu menos. A ave mais popular nas instituições de Faisalabad era o pardal, enquanto a ave menos popular era o myna comum. A porcentagem de adaptação de pássaros em áreas residenciais e institucionais de Faisalabad foi a mais alta para papagaios e pardais, respectivamente. As pessoas em áreas residenciais e instituições, por outro lado, se adaptaram menos ao myna comum. Conclui-se que pessoas da área de estudo como pássaros e alimentos oferecidos e alta população de pássaros estão presentes na área de estudo.

3.
Braz. j. biol ; 83: e249229, 2023. tab, graf
Artículo en Inglés | LILACS, VETINDEX | ID: biblio-1339374

RESUMEN

Abstract Birds are very valuable indicators of species richness and endemic patterns in a specified ecosystem, which eventually help the scientist to measure the environmental degradation. The aim of present study was to know human knowledge and attitude toward urban birds in Faisalabad city, Pakistan. The study conducted in four consecutive months: November 2019 to February 2020. Population of birds was noted from eight residential towns of Faisalabad city, data were collected through questionnaire. Faisalabad has a reasonably large population of birds and present data show that, there is a significant difference between favorite bird of residential areas and institutions. The pigeon received the most likeness in bird population among residential area residents, while the myna received the least. The most popular bird in Faisalabad institutions was the sparrow, while the least popular bird was the common myna. Bird adaptation percentage of residential areas and institutional areas of Faisalabad was the highest for parrot and sparrow respectively. People in residential areas and institutions, on the other hand, adapted least to common myna. It is concluded that people of the study area like birds and offered food and high population of birds are present in study area.


Resumo Os pássaros são indicadores muito valiosos da riqueza de espécies e padrões endêmicos em um determinado ecossistema, o que acaba ajudando o cientista a medir a degradação ambiental. O objetivo do presente estudo foi conhecer o conhecimento humano e a atitude em relação às aves urbanas na cidade de Faisalabad, Paquistão. O estudo foi conduzido em quatro meses consecutivos: novembro de 2019 a fevereiro de 2020. A população de pássaros foi observada em oito cidades residenciais da cidade de Faisalabad, os dados foram coletados por meio de questionário. Faisalabad tem uma população razoavelmente grande de pássaros, e os dados atuais mostram que há uma diferença significativa entre as aves favoritas de áreas residenciais e instituições. O pombo recebeu mais semelhanças na população de pássaros entre os residentes de áreas residenciais, enquanto o myna recebeu menos. A ave mais popular nas instituições de Faisalabad era o pardal, enquanto a ave menos popular era o myna comum. A porcentagem de adaptação de pássaros em áreas residenciais e institucionais de Faisalabad foi a mais alta para papagaios e pardais, respectivamente. As pessoas em áreas residenciais e instituições, por outro lado, se adaptaram menos ao myna comum. Conclui-se que pessoas da área de estudo como pássaros e alimentos oferecidos e alta população de pássaros estão presentes na área de estudo.


Asunto(s)
Humanos , Animales , Aves , Ecosistema , Pakistán , Ciudades , Biodiversidad
4.
Artículo | IMSEAR | ID: sea-220379

RESUMEN

Currently, the novel and major life-threatening cause all over the world is COVID-19 (Coronavirus disease 2019) which is started at the end of 2019 in Wuhan, China, and spread all over the world today. The infection of COVID-19 severity is variable which affects all ages' people and especially elderly persons whose immune system is very weak. Fatigue, fever, respiratory illness, dry cough, loss of appetite, olfactory dysfunction are the most common symptoms of this disease along with the decrease of certain cells of the immune system like helper T cells, monocytes/macrophages, etc. and an increase in pro-inflammatory cytokines are some of the major characteristics of this disease. Some natural herbal products are a successive option to combat SARS-Cov-2 disease. Herbs have various potential compound which is used as a dietary product that strongly influences immunity and maintenance of the homeostasis of inflammatory/anti-inflammatory. In the present review, we describe the potential of three herbal products as Turmeric (Haldi), Heart-leaved moonseed (Giloy), and Black cumin (Kalonji) that can be used for preventative or nutritional therapy of COVID-19.

5.
Braz. j. biol ; 82: 1-11, 2022. graf, tab
Artículo en Inglés | LILACS, VETINDEX | ID: biblio-1468570

RESUMEN

A research was conducted to evaluate the impact of various nitrogen and phosphorus levels along with beneficial microbes to enhance canola productivity. The research was carried out at Agronomy Research Farm, The University of Agriculture Peshawar in winter 2016-2017. The experiment was conducted in randomized complete block factorial design. The study was comprised of three factors including nitrogen (60, 120 and 180 kg ha-¹), phosphorous (70, 100 and 130 kg ha-¹) and beneficial microbes (with and without BM). A control treatment with no N, P and BM was also kept for comparison. Application of beneficial microbes significantly increased pods plant, seed pod, seed filling duration, 1000 seed weight, biological yield and seed yield as compared to control plots. Nitrogen applied at the rate of 180 kg ha-¹ increased pods plant-¹, seed pod, seed filling duration, seed weight, biological yield and seed yield. Maximum pods plant-¹, seed pod, early seed filling, heavier seed weight, biological yield, seed yield, and harvest index were observed in plots treated with 130 kg.ha-¹ phosphorous. As comparison, the combine treated plots have more pods plant-¹, seeds pod-¹, seed filling duration, heaviest seeds, biological yield, seed yield and harvest index as compared to control plots. It is concluded that application of beneficial microbes with N and P at the rate of 180 kg ha-¹ and 130 kg ha-¹, respectively, increased yield and its attributes for canola.


Uma pesquisa foi realizada para avaliar o impacto de vários níveis de nitrogênio e fósforo, juntamente com micróbios benéficos, para aumentar a produtividade da canola. A pesquisa foi realizada no inverno de 2016-17 no Agronomy Research Farm, Universidade de Agricultura do Peshawar. O experimento foi conduzido por planejamento fatorial aleatorizado em blocos. O estudo focou-se em três fatores, incluindo o teor de nitrogênio, N, (60, 120 e 180 kg.ha-¹), o teor de fósforo, P, (70, 100 e 130 kg ha-¹) e a presença de micróbios benéficos (com BM e sem BM). Para fins de comparação, um tratamento controle sem N, P e BM também foi incluído no estudo. A aplicação de micróbios benéficos aumentou significativamente as vagens das plantas e de sementes, a duração do enchimento das sementes, o peso de 1000 sementes, o rendimento biológico e o rendimento de sementes em comparação com os resultados do controle. O nitrogênio aplicado na taxa de 180 kg ha-¹ aumentou as vagens por planta, vagem, duração do enchimento, peso da semente, rendimento biológico e rendimento de sementes. Vagens máximas por planta, vagem, enchimento precoce de sementes, peso maior de semente, rendimento biológico, rendimento de sementes e índice de colheita foram observados em parcelas tratadas com 130 kg.ha-¹ de fósforo. Em comparação aos blocos cultivados de controle, os blocos cultivados tratados combinados têm mais vagens por planta e sementes por vagem, maior duração do enchimento das sementes, maior número de sementes mais pesadas e maior rendimento biológico, rendimento de sementes e índice de colheita. Conclui-se que a aplicação de micróbios benéficos junto com N e P nas doses de 180 kg ha-¹ e 130 kg ha-¹, respectivamente, aumentou a produtividade e atributos de produtividade para a canola.


Asunto(s)
Brassica napus/crecimiento & desarrollo , Brassica napus/efectos de los fármacos , Brassica napus/microbiología , Fósforo/administración & dosificación , Nitrógeno/administración & dosificación
6.
Braz. j. biol ; 822022.
Artículo en Inglés | LILACS-Express | LILACS, VETINDEX | ID: biblio-1468757

RESUMEN

Abstract A research was conducted to evaluate the impact of various nitrogen and phosphorus levels along with beneficial microbes to enhance canola productivity. The research was carried out at Agronomy Research Farm, The University of Agriculture Peshawar in winter 2016-2017. The experiment was conducted in randomized complete block factorial design. The study was comprised of three factors including nitrogen (60, 120 and 180 kg ha-1), phosphorous (70, 100 and 130 kg ha-1) and beneficial microbes (with and without BM). A control treatment with no N, P and BM was also kept for comparison. Application of beneficial microbes significantly increased pods plant, seed pod, seed filling duration, 1000 seed weight, biological yield and seed yield as compared to control plots. Nitrogen applied at the rate of 180 kg ha-1 increased pods plant-1, seed pod, seed filling duration, seed weight, biological yield and seed yield. Maximum pods plant-1, seed pod, early seed filling, heavier seed weight, biological yield, seed yield, and harvest index were observed in plots treated with 130 kg.ha-1 phosphorous. As comparison, the combine treated plots have more pods plant-1, seeds pod-1, seed filling duration, heaviest seeds, biological yield, seed yield and harvest index as compared to control plots. It is concluded that application of beneficial microbes with N and P at the rate of 180 kg ha-1 and 130 kg ha-1, respectively, increased yield and its attributes for canola.


Resumo Uma pesquisa foi realizada para avaliar o impacto de vários níveis de nitrogênio e fósforo, juntamente com micróbios benéficos, para aumentar a produtividade da canola. A pesquisa foi realizada no inverno de 2016-17 no Agronomy Research Farm, Universidade de Agricultura do Peshawar. O experimento foi conduzido por planejamento fatorial aleatorizado em blocos. O estudo focou-se em três fatores, incluindo o teor de nitrogênio, N, (60, 120 e 180 kg.ha-1), o teor de fósforo, P, (70, 100 e 130 kg ha-1) e a presença de micróbios benéficos (com BM e sem BM). Para fins de comparação, um tratamento controle sem N, P e BM também foi incluído no estudo. A aplicação de micróbios benéficos aumentou significativamente as vagens das plantas e de sementes, a duração do enchimento das sementes, o peso de 1000 sementes, o rendimento biológico e o rendimento de sementes em comparação com os resultados do controle. O nitrogênio aplicado na taxa de 180 kg ha-1 aumentou as vagens por planta, vagem, duração do enchimento, peso da semente, rendimento biológico e rendimento de sementes. Vagens máximas por planta, vagem, enchimento precoce de sementes, peso maior de semente, rendimento biológico, rendimento de sementes e índice de colheita foram observados em parcelas tratadas com 130 kg.ha-1 de fósforo. Em comparação aos blocos cultivados de controle, os blocos cultivados tratados combinados têm mais vagens por planta e sementes por vagem, maior duração do enchimento das sementes, maior número de sementes mais pesadas e maior rendimento biológico, rendimento de sementes e índice de colheita. Conclui-se que a aplicação de micróbios benéficos junto com N e P nas doses de 180 kg ha-1 e 130 kg ha-1, respectivamente, aumentou a produtividade e atributos de produtividade para a canola.

7.
Braz. j. biol ; 82: e227703, 2022. tab, graf
Artículo en Inglés | LILACS, VETINDEX | ID: biblio-1285590

RESUMEN

A research was conducted to evaluate the impact of various nitrogen and phosphorus levels along with beneficial microbes to enhance canola productivity. The research was carried out at Agronomy Research Farm, The University of Agriculture Peshawar in winter 2016-2017. The experiment was conducted in randomized complete block factorial design. The study was comprised of three factors including nitrogen (60, 120 and 180 kg ha-1), phosphorous (70, 100 and 130 kg ha-1) and beneficial microbes (with and without BM). A control treatment with no N, P and BM was also kept for comparison. Application of beneficial microbes significantly increased pods plant, seed pod, seed filling duration, 1000 seed weight, biological yield and seed yield as compared to control plots. Nitrogen applied at the rate of 180 kg ha-1 increased pods plant-1, seed pod, seed filling duration, seed weight, biological yield and seed yield. Maximum pods plant-1, seed pod, early seed filling, heavier seed weight, biological yield, seed yield, and harvest index were observed in plots treated with 130 kg.ha-1 phosphorous. As comparison, the combine treated plots have more pods plant-1, seeds pod-1, seed filling duration, heaviest seeds, biological yield, seed yield and harvest index as compared to control plots. It is concluded that application of beneficial microbes with N and P at the rate of 180 kg ha-1 and 130 kg ha-1, respectively, increased yield and its attributes for canola.


Uma pesquisa foi realizada para avaliar o impacto de vários níveis de nitrogênio e fósforo, juntamente com micróbios benéficos, para aumentar a produtividade da canola. A pesquisa foi realizada no inverno de 2016-17 no Agronomy Research Farm, Universidade de Agricultura do Peshawar. O experimento foi conduzido por planejamento fatorial aleatorizado em blocos. O estudo focou-se em três fatores, incluindo o teor de nitrogênio, N, (60, 120 e 180 kg.ha-1), o teor de fósforo, P, (70, 100 e 130 kg ha-1) e a presença de micróbios benéficos (com BM e sem BM). Para fins de comparação, um tratamento controle sem N, P e BM também foi incluído no estudo. A aplicação de micróbios benéficos aumentou significativamente as vagens das plantas e de sementes, a duração do enchimento das sementes, o peso de 1000 sementes, o rendimento biológico e o rendimento de sementes em comparação com os resultados do controle. O nitrogênio aplicado na taxa de 180 kg ha-1 aumentou as vagens por planta, vagem, duração do enchimento, peso da semente, rendimento biológico e rendimento de sementes. Vagens máximas por planta, vagem, enchimento precoce de sementes, peso maior de semente, rendimento biológico, rendimento de sementes e índice de colheita foram observados em parcelas tratadas com 130 kg.ha-1 de fósforo. Em comparação aos blocos cultivados de controle, os blocos cultivados tratados combinados têm mais vagens por planta e sementes por vagem, maior duração do enchimento das sementes, maior número de sementes mais pesadas e maior rendimento biológico, rendimento de sementes e índice de colheita. Conclui-se que a aplicação de micróbios benéficos junto com N e P nas doses de 180 kg ha-1 e 130 kg ha-1, respectivamente, aumentou a produtividade e atributos de produtividade para a canola.


Asunto(s)
Fósforo , Nitrógeno , Estaciones del Año , Semillas , Agricultura
8.
Artículo | IMSEAR | ID: sea-220358

RESUMEN

Tuberculosis is a bacterial infectious illness that is spread mostly by communicable droplets from one person to another. Drug-resistant patients and substandard drug authorization Mycobacterium tuberculosis is one of the two major obstacles to tuberculosis (TB) management in endemic areas, such as India and the rest of the world. Precision medicine, also known as customized medicine, is based on the diversity of systems biology and using predictive techniques to assess health risk and build tailored health plans to assist patients in reducing risk, preventing disease, and treating it with precision. Only active pulmonary tuberculosis is contagious. TB continues to be a significant source of illness and mortality in many low- and middle-income nations, and drug-resistant TB is a major problem in many areas. Furthermore, several novel TB diagnostics methods, such as quick molecular testing, have been developed, and there is a demand for simpler point-of-care tests. Personalized medicine ushers in a new age in healthcare. In the subject of Mycobacteriology, personalized medicine may be used in a variety of ways, including prevention, diagnosis, improved therapy, and prognosis. To change an independent proposition in mycobacterial disorders, a genetic inclination and a protein affliction investigation are presented. Patients' results should be turned into accurate diagnostic tests and focused therapy in order for personalized medicine to be used successfully by the healthcare system.

9.
Artículo | IMSEAR | ID: sea-220340

RESUMEN

Fibromyalgia (FM) is a musculo-skeletal disorder and tiredness which results in diffuse myalgia, localized pain, weakness, lower pain thresholds and non-restorative sleep. Multiple sources of evidence supporting the view of decreased flux via the serotonin pathway in FM patients. Supplementation with serotonin substrates, through L- tryptophan or 5-Hydroxytryptophan (5-HTP) significantly improves depression symptoms, anxiety, fatigue and poor sleep in FM patients. Advances in fibromyalgia recognition have helped to increase the therapy choices for FM patients. New medications, nutritional supplements, and nutritional / pharmacological improvement of deep-stage sleep are all being studied by researchers that emphasizes awareness, exercise, and serotonin substrate / receptor regulation.

10.
Rev. bras. entomol ; Rev. bras. entomol;61(2): 101-106, Apr.-Jun. 2017. tab, graf
Artículo en Inglés | LILACS | ID: biblio-843709

RESUMEN

ABSTRACT During the present study, the host-parasite relationship between mosquitoes and parasitic mites was investigated. The 8954 individuals of male and female mosquitoes belonging to 26 genera: seven each of Aedes and Culex, six of Anopheles and one each of Toxorhynchites, Coquillettidia and Uranotaenia were collected from 200 sites. The male and female mosquitoes were collected from the State of Uttar Pradesh, located at 26.8500° N, 80.9100° E in North India by deploying Carbon dioxide-baited and gravid traps. The intensity of mite's infection, type and number of mites attached to mosquitoes, mite's preference for body parts and host sexes were the parameters used to determine host-parasite relationship. Eight species of mites: Arrenurus acuminatus, Ar. gibberifrons, Ar. danbyensis, Ar. madaraszi, Ar. kenki, Parathyas barbigera, Leptus sp., and Anystis sp., parasitized mosquitoes. Parasitic mites preferred host's thorax for attachment as compared to the head, pre-abdomen or appendages. The present study suggests phoretic relationship between parasitic mites and mosquitoes. Wide occurrence, intensity of infection, parasitic load, and attachment preferences of the mites suggested their positive role in biological control of adult mosquitoes. The present study will set the path of future studies on host-parasite relationships of mites and mosquitoes and define the role of parasitic mites in the biological control of mosquitoes.

11.
Indian J Cancer ; 2015 July-Sept; 52(3): 314-318
Artículo en Inglés | IMSEAR | ID: sea-173820

RESUMEN

INTRODUCTION: Chronic myeloid leukemia (CML) is characterized by the Philadelphia chromosome, an abnormally shortened chromosome 22. It is the result of a reciprocal translocation of chromosomes 9 and 22, creating BCR‑ABL fusion transcripts, b3a2, b2a2, and e1a2. The aim of our study was to determine the type of BCR‑ABL fusion transcripts for molecular diagnosis and investigate the frequency of BCR‑ABL fusion transcripts in CML patients by multiplex RT‑PCR in CML. MATERIALS AND METHODS: A single reaction with multiple primers multiplex PCR was used to detect and investigate the type and frequency in 200 CML patients among which 116, 33, and 51 were in CP, AP, and BC phase, respectively. RESULTS: The study included 200 CML patients, among whom breakpoints in b3a2, b2a2 transcripts were detected in 68% and 24%, respectively, while 8% of the patients showed both b3a2/b2a2. A statistically significant difference was seen between frequency of BCR‑ABL fusion transcripts and gender (P = 0.03), molecular response (P = 0.04), and hematological response (P = 0.05). However, there was no correlation found between frequencies of BCR‑/ABL fusion transcripts and other clinicopathological parameters like age, type of therapy, thrombocytopenia, and white blood cell count. CONCLUSION: Multiplex reverse transcriptase‑polymerase chain reaction is useful and saves time in the detection of BCR‑ABL variants; the occurrence of these transcripts associated with CML can assist in prognosis and treatment of disease.

12.
IJPR-Iranian Journal of Pharmaceutical Research. 2014; 13 (4): 1173-1181
en Inglés | IMEMR | ID: emr-151735

RESUMEN

New mono acid esters have been synthesized from the reaction of benzoic acid and mono-hydroxybenzoic acids with 2-phenoxyethanol separated from Urtica pilulifera, characterized, and screened for possible antioxidant, antifungal, antimicrobial and anticancer activities. These phenolic acid esters gave various degrees of free radical scavenging, but the values were lower than that of alpha-tocopherol. The concentrations of the tested compounds needed to reduce DPPH absorption by 50% at 517 nm were nearly in the range of 900-1100 micro g/mL. While for alpha-tocopherol was 40 micro g /mL. The compounds were tested in-vitro against six bacterial species which are known to cause dermic and mucosal infections in human. 2-phenoxyethyl benzoate showed significant activity in the range of 30% against P. aeruginosa to 70% against E. coli compared with the activity of Streptomycin. On the other hand 2-phenoxyethyl 2-hydroxybenzoate reveals 70% of gentamicin against K. pneumoniae. The tested compounds also showed complete inhibition at a concentration less than 37.5 micro g/mL against M. canis and less than 50 micro g/mL against T. rubrum. 2-phenoxyethyl 4-hydroxybenzoate showed considerable activity against MCF-7 with IC[50] is less than 62.5 micro g/mL

13.
Braz. j. microbiol ; Braz. j. microbiol;44(3): 751-758, July-Sept. 2013. ilus, tab
Artículo en Inglés | LILACS | ID: lil-699807

RESUMEN

Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes) rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction) has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO). A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB) followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT) complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR). PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%), followed by fish meat (4.0%), and then beef (2.5%). Among various milk and milk products, curd (2.0%) showed the highest prevalence, followed by raw milk (1.3%). The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS) examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro) resulted positive in twenty four strong haemolysin producing L. monocytogenes isolates. The vero cytotoxicity assay could be suggested as a further step towards an alternative assay for detection of haemolytic strains of L. monocytogenes.


Asunto(s)
Animales , Bovinos , Microbiología de Alimentos/métodos , Listeria monocytogenes/aislamiento & purificación , Técnicas de Diagnóstico Molecular/métodos , Toxinas Bacterianas/genética , Supervivencia Celular , Chlorocebus aethiops , Pollos , Cartilla de ADN/genética , Productos Lácteos/microbiología , Peces , Proteínas de Choque Térmico/genética , Proteínas Hemolisinas/genética , India , Carne/microbiología , Leche/microbiología , Reacción en Cadena de la Polimerasa , Células Vero
14.
Saudi Medical Journal. 2013; 34 (12): 1248-1254
en Inglés | IMEMR | ID: emr-148585

RESUMEN

To characterize the effects of regular Roselle ingestion on blood pressure and left ventricular hypertrophy [LVH] in patients with established moderate essential hypertension. This non-randomized quasi-experimental study was conducted in Kafr El-Shaikh, Egypt, for 8 weeks, from September 2012 to November 2012. The effects of a 4-week period of regular Roselle ingestion followed by a 4-week recovery period on systolic blood pressure [SBP], diastolic blood pressure [DBP], pulse pressure [PP], and heart rates [HR] was studied in 2 equal, gender- and age-matched groups [n=50 each; average age - 50 +/- 5 years] of normotensive subjects, and patients with moderate essential hypertension. Electrocardiographic assessments of LVH were also made prior to, and at the end of both treatment and recovery periods. Pulse pressure [PP] significantly fell from baseline values by 10.9% [normotensive group [NG]], 21.2% [hypertensive group [HG]]; SBP by 10% [NG], 19.6% [HG]; DBP by 9.5% [NG], 18.7% [HG], and HR by 14.6% [NG], 17.1% [HG] by the end of week 4 of treatment. Following treatment cessation, SBP, DBP, PP, and HR returned to pretreatment levels over 4 weeks. Before intervention, none of the normotensive subjects, but 14 hypertensive patients showed LVH. However, Roselle treatment was associated with regression of LVH in 10 patients with only 4 patients showing LVH after 4 weeks of treatment. This became 10 patients 4 weeks after ceasing treatment. These findings empirically suggest favorable cardiovascular effects of Roselle in patients with established moderate essential hypertension


Asunto(s)
Humanos , Masculino , Femenino , Presión Arterial/efectos de los fármacos , Hipertrofia Ventricular Izquierda , Hipertensión , Presión Sanguínea , Frecuencia Cardíaca
15.
Egyptian Journal of Hospital Medicine [The]. 2013; 50: 108-126
en Inglés | IMEMR | ID: emr-170271

RESUMEN

This research aims to study the epidemiology of the parasite in livestock by using statistical methods for analyzing the numbers of infections and prevalence of the disease among one year [1431HD] in the camels, cattle, sheep and goats. The genus Echinococcus is of great importance because it can cause the cystic echinococcosis[CE], or hydatid cyst, this disease is one of the serious parasitic diseases that may lead to death, and only can be treated surgically This disease can bring a lot of material loss to livestock and can cause serious ill health in man. The genus Echinococcus contains a number of zoonotic species. There are at least 4 species in the genus. The data where collected regularly each week for among one year from the official slaughter house records for the infected camels, cattle, sheep and goats with the cystic echinococcosis, all the collected data were inserted in tables and divided to four quarters[Q1,Q2,Q3 and Q4] three months in each quarter, then statistical analysis [Chi test for goodness of fit and for independence] where used to analysis the numbers and prevalence of infected animals. The present study have been demonstrated that the prevalence of the CE in the year 1423HD was higher in camels with percentage of 7.21% followed by cattle [6.35%] then sheep [2.60%] and the least in goats [1.84%] for both local and imported livestock ,there were very high significant relation between the local and imported livestock and there were very high significant relation between types of animals and between the fourth quarter Q4 and the other quarters [Q1, 2,and3]. The results obtained in this study showed abundant rate of CE in slaughtered animals, and it proved the presence of echinococcosis the deadly disease in the region of the study, which leads to think strongly to find intensive controlling programs to eliminate or eradicate this disease to avoid losing livestock and reducing man mortalities or infections. More epidemiological studies are needed to watch the changes in the prevalence of the cystic echinococcosis because it is a major public health problem throughout the world and causes serious socio-economic effects


Asunto(s)
Animales , Estudio Comparativo , Camelus/parasitología , Bovinos/parasitología , Cabras/parasitología , Estudios Epidemiológicos
16.
Indian J Ophthalmol ; 2010 May; 58(3): 189-194
Artículo en Inglés | IMSEAR | ID: sea-136052

RESUMEN

Context: Retinal perfusion variability impacts ocular disease and physiology. Aim: To evaluate the response of central retinal artery (CRA) blood flow to temperature alterations in 20 healthy volunteers. Setting and Design: Non-interventional experimental human study. Materials and Methods: Baseline data recorded: Ocular surface temperature (OST) in °C (thermo-anemometer), CRA peak systolic velocity (PSV) and end diastolic velocity (EDV) in cm/s using Color Doppler. Ocular laterality and temperature alteration (warming by electric lamp/cooling by ice-gel pack) were randomly assigned. Primary outcomes recorded were: OST and intraocular pressure (IOP) immediately after warming or cooling and ten minutes later; CRA-PSV and EDV at three, six and nine minutes warming or cooling. Statistical Analysis: Repeated measures ANOVA. Results: (n = 20; μ ± SD): Pre-warming values were; OST: 34.5 ± 1.02°C, CRA-PSV: 9.3 ± 2.33 cm/s, CRA-EDV: 4.6 ± 1.27 cm/s. OST significantly increased by 1.96°C (95% CI: 1.54 to 2.37) after warming, but returned to baseline ten minutes later. Only at three minutes, the PSV significantly rose by 1.21 cm/s (95% CI: 0.51to1.91). Pre-cooling values were: OST: 34.5 ± 0.96°C, CRA-PSV: 9.7 ± 2.45 cm/s, CRA-EDV: 4.7 ± 1.12 cm/s. OST significantly decreased by 2.81°C (95% CI: −2.30 to −3.37) after cooling, and returned to baseline at ten minutes. There was a significant drop in CRA-PSV by 1.10cm/s (95% CI: −2.05 to −0.15) and CRA-EDV by 0.81 (95% CI: −1.47 to −0.14) at three minutes. At six minutes both PSV (95% CI: −1.38 to −0.03) and EDV (95% CI: −1.26 to −0.02) were significantly lower. All values at ten minutes were comparable to baseline. The IOP showed insignificant alteration on warming (95% CI of difference: −0.17 to 1.57mmHg), but was significantly lower after cooling (95% CI: −2.95 to −4.30mmHg). After ten minutes, IOP had returned to baseline. Conclusion: This study confirms that CRA flow significantly increases on warming and decreases on cooling, the latter despite a significant lowering of IOP.


Asunto(s)
Velocidad del Flujo Sanguíneo , Femenino , Humanos , Masculino , Valores de Referencia , Arteria Retiniana/fisiología , Temperatura , Adulto Joven
17.
Egyptian Journal of Medical Human Genetics [The]. 2009; 10 (1): 97-104
en Inglés | IMEMR | ID: emr-97431

RESUMEN

Farber Disease [MIM 228000][1] is a rare AR disorder first described by Sidney Farber in 1952[2]. Farber disease is usually recognized by the presence of three symptoms: Painful and progressively deformed joints, nodules under the skin and progressive hoarseness. Other organ systems may also be involved. As with most lysosomal storage diseases, the course of Farber's Disease is progressive and death typically occurs in infancy. Stiff skin syndrome [SSS] [MIM% 184900][1] was first described by Esterly and McKusick as a disorder characterized by thickened and indurated skin of the entire body and limitation of joint mobility with flexion contractures. Diagnosis and clarification of overlapping in the clinical presentation of the studied case. Clinical report of an atypically presenting Farber case and analyzing the overlapping manifestations between the two syndromes. Histopathological study was the conclusive diagnostic key in our case. Recognition of atypical or abortive cases is of practical importance as it may affect counseling or therapeutic decision making. Orodental manifestations were not previously considered but they may be of future diagnostic help


Asunto(s)
Humanos , Masculino , Femenino , Manifestaciones Cutáneas , Manifestaciones Neurológicas , Recién Nacido
18.
Medical Journal of Cairo University [The]. 2009; 77 (1): 453-458
en Inglés | IMEMR | ID: emr-100955

RESUMEN

Three families with seven patients [three males and four females] represented by repeated attacks of seizures and hospitalized in Taef Children Hospital. These patients were en over a period of 9 months. All patients shared most of the typical dysmorphic features of Sanjad-Sakati syndrome as microcephaly, deep set eyes, beaked nose, micrognathia, abnormal ear malformations, short stature and small hands d feet. In addition to the previous features, hypoparathyroidism was diagnosed by laboratory investigations and showed low calcium concentration, high phosphorus level and low immuno-reactive parathyroid hormone level. All the patients bad normal karyotype. Accurate and proper clinical examination was of great importance to differentiate this syndrome from another similar syndrome known as Kenny-Caffey syndrome which has the same homozygous deletion in TBCE gene. We recommended molecular study for all the patients and their parents which confirms the diagnosis and gives great help in genetic counseling


Asunto(s)
Humanos , Masculino , Femenino , Hipoparatiroidismo/congénito , Microcefalia , Discapacidad Intelectual , Convulsiones , Retardo del Crecimiento Fetal , Análisis Citogenético
19.
Medical Journal of Cairo University [The]. 2009; 77 (1): 219-225
en Inglés | IMEMR | ID: emr-101619

RESUMEN

This study included 18 cases with hepatomegaly referred to the Human Genetics Department, National Research Centre with a suspicion of a metabolic disorder from 2006 to 2008. The aim of our study was to find out the importance of hepatomegaly as sign for many metabolic disorders and their frequency among other disorders with hepatomegaly. All cases were subjected to clinical and biochemical studies. 12 cases, 66%, [10 males 83.4% and 2 females 16.6%] were diagnosed with a metabolic disease. 8 cases with mucopolysaccharidosis [MPS] [3 cases MPS I, 3 cases MPS II, one case MPS III and one case MPS VI]; one case with glycogen storage disease [GSD]; one case with galactosemia and 2 cases with Niemann-Pick disease type C. 75% of the diagnosed cases showed positive consanguinity and the remaining 25% were three patients with MPS II with an X linked mode of inheritance


Asunto(s)
Humanos , Masculino , Femenino , Enfermedades Metabólicas , Errores Innatos del Metabolismo , Glicosaminoglicanos , Galactosemias , Enfermedad del Almacenamiento de Glucógeno , Consanguinidad
20.
Medical Journal of Cairo University [The]. 2009; 77 (1): 5-10
en Inglés | IMEMR | ID: emr-92100

RESUMEN

Females with Turner syndrome are at risk for decreased bone density from ovarian failure and possibly from haploin-sufficiency for bone-related X-chromosome genes. We studied the relation between bone density, anthropometry, body composition and chromosomal abnormalities in Turner syndrome. The study included 18 females with Turner syndrome. They were divided in two groups. Group A consisted of 12 cases with 45, X karyotype [classic Turner syndrome] and their mean age of 13.5 +/- 5.5 years. Group B included 6 cases with mosaic karyotype and their mean age of 16.3 +/- 4.2 years. Bone mineral density [BMD] was determined using dual energy X-ray absorptiometry scans [DEXA]. BMD was measured in the femoral neck [FN], lumber spine [LS], and forearm [FA]. Body composition was assessed using RJL body fat analyzer. Anthropometry was carried out for each case. Seventy-two percent of females investigated had osteope-nia. When BMD was expressed as z-scores [individual values compared to normal reference data matched for age and weight] for all cases at it was 0.587 +/- 0.10 at FN and was 0.630 +/- 0.17 at LS. In group A bone mineral density was decreased [osteope-nia] by 66.7% in FN, and 25% in LS. In group B bone mineral density was decreased by 66.7% in FN, and 50% in LS. When comparing females in group A with those of group B, there was no statistical difference in BMD at femur and spine. The ostopenia found in patients of group A and B was not related to type of X-chromosomal aberrations. Group A showed significant increase in TBW and Corinic index SDS as compared to group B. Body fat and lean percentages are similar in the two studied groups. Also, no correlation was found between BMD and body weight, body height, body fat or percentage body fat. Body composition changes seem to be more impressive in classic Turner patients, while BMD changes are similar in the two groups. Achieving optimal bone density is of critical importance for fracture prevention in TS


Asunto(s)
Humanos , Femenino , Densidad Ósea , Enfermedades Óseas Metabólicas , Composición Corporal , Peso Corporal , Estatura , Análisis Citogenético , Aberraciones Cromosómicas , Antropometría
SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA