Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 63
Filtrar
1.
International Eye Science ; (12): 473-478, 2024.
Artigo em Chinês | WPRIM | ID: wpr-1011404

RESUMO

AIM: To observe the distribution of cone in the macular of healthy adult in different ages using adaptive optics scanning laser ophthalmoscope(AO-SLO)system, and analyze its relationship with age.METHODS: A total of 100 healthy examinees(200 eyes)in our hospital from June to July 2023 were selected, and they were divided into four groups according to their age, with 25 cases(50 eyes)in each group, including 18-30 years in group A, 31-40 years in group B, 41-50 years in group C, 51-65 years in group D. AO-SLO was performed in both eyes and cone density was measured.RESULTS: The density of cone in the foveal eccentricity of 3° and 2.4°×2.4° in each group was different(P<0.001), and the cone density in each area showed a relatively regular distribution characteristics, with the highest density in the temporal side, and the temporal>nasal>inferior>superior sides from high to low. The mean cone density in the macular area of both eyes was 14 144.38±1 082.40, 13 241.24±535.32, 12 930.29±727.73, and 10 907.50±490.86 cell/mm2, respectively(P<0.001), indicating that the cone density decreased with age. The correlation analysis showed that the mean cone density in the macular area was negatively correlated with age(r=-0.578, P<0.001).CONCLUSION: AO-SLO is a quantitative non-invasive detection of cones, and there is a negative correlation between cone density and age in healthy human. Furthermore, density of cone in healthy people over 50 years was significantly decreased.

2.
Artigo em Chinês | WPRIM | ID: wpr-1007223

RESUMO

The set of guidelines for the diagnosis and treatment of thyroid nodules and differentiated thyroid cancer (the second edition) was published in 2023 in China. Based on the first (2012) edition, the current set was revised jointly by nearly 100 experts in endocrinology, thyroid surgery, oncology, nuclear medicine, ultrasound medicine, and pathology from seven national societies for one year. The new version of the guideline is still divided into two parts, namely, thyroid nodules and differentiated thyroid cancer. The writing mode of asking clinical questions, explaining and giving recommendations is adopted, and a total of 117 recommendations are provided. This article aims to compare the variations in the differentiation of benign and malignant thyroid nodules and surgical treatment of differentiated thyroid cancer between the new and old versions from the perspective of surgery. The author's own understanding and experiences are also discussed.

3.
Artigo em Chinês | WPRIM | ID: wpr-995607

RESUMO

Objective:To analyze the clinical characteristics and evaluate the effect and safety of anti-vascular endothelial growth factor (VEGF) therapy in retinopathy of prematurity (ROP) in Sichuan province.Methods:A retrospective study. From January 2013 to January 2022, 156 patients (306 eyes) with ROP who received intravitreal anti-VEGF therapy for the first time in the Department of Ophthalmology, West China Hospital of Sichuan University were selected. According to the type of anti-VEGF drugs, the children were divided into intravitreal injection of ranibizumab (IVR) group and intravitreal injection of conbercept (IVC) group; IVC group was divided into hospital group and referral group according to the different paths of patients. After treatment, the patients were followed up until the disease degenerated (vascular degeneration or complete retinal vascularization) or were hospitalized again for at least 6 months. If the disease recurred or progressed, the patients were re-admitted to the hospital and received anti-VEGF drug treatment, laser treatment or surgical treatment according to the severity of the disease. Clinical data of these children was collected, including general clinical characteristics: gender, gestational age at birth (GA), birth weight (BW), history of oxygen inhalation; pathological condition: ROP stage, zone, whether there were plus lesions; treatment: treatment time, postmenstrual gestational age at the time of the first anti-VEGF drug treatment; prognosis: re-treat or not, time of re-treatment, mode of re-treatment; adverse events: corneal edema, lens opacity, endophthalmitis, retinal injury, and treatment-related systemic adverse reactions. The measurement data between groups were compared by t test, and the count data were compared by χ2 test or rank sum test. Results:Of the 306 eyes of 156 children with ROP, 74 were male (47.44%, 74/156) and 82 were female (52.56%, 82/156). Each included child had a history of oxygen inhalation at birth. The GA was (28.43±2.19) (23.86-36.57) weeks, BW was (1 129±335) (510-2 600) g, and the postmenstrual gestational age was (39.80±3.04) (31.71-49.71) weeks at the time of the first anti-VEGF drug treatment. All patients were diagnosed as type 1 ROP, including 26 eyes (8.50%, 26/306) of aggressive ROP (A-ROP), 39 eyes (12.74%, 39/306) of zone Ⅰ lesions, and 241 eyes (78.76%, 241/306) of zone Ⅱ lesions. The children were treated with intravitreal injection of anti-VEGF drugs within 72 hours after diagnosis. Among them, 134 eyes (43.79%, 134/306) of 68 patients were treated with IVR, and 172 eyes (56.21%, 172/306) of 88 patients were treated with IVC. In IVC group, 67 eyes of 34 patients (38.95%, 67/172) were in the hospital group and 105 eyes of 54 patients (61.05%, 105/172) were in the referral group. 279 eyes (91.18%, 279/306) were improved after one treatment, 15 eyes (4.90%, 15/306) were improved after two treatments, and 12 eyes (3.92%, 12/306) were improved after three treatments. The one-time cure rate of IVR group was lower than that of IVC group, but the difference was not statistically significant ( χ2=1.665, P=0.197). In different ROP categories, IVC showed better therapeutic effect in A-ROP, and its one-time cure rate was higher than that in IVR group, with statistically significant difference ( χ2=7.797, P<0.05). In the hospital group of IVC group, the GA, BW and the postmenstrual gestational age at first time of anti-VEGF drug treatment were lower than those in the referral group, and the difference was statistically significant ( t=-2.485, -2.940, -3.796; P<0.05). The one-time cure rate of the hospital group and the referral group were 94.94%, 92.38%, respectively. The one-time cure rate of the hospital group was slightly higher than that of the referral group, but the difference was not statistically significant ( χ2=0.171, P=0.679). In this study, there were no ocular and systemic adverse reactions related to drug or intravitreal injection in children after treatment. Conclusions:Compared with the characteristics of ROP in developed countries, the GA, BW and postmenstrual gestational age of the children in Sichuan province are higher. Both IVR and IVC can treat ROP safely and effectively. There is no significant difference between the two drugs in the overall one-time cure effect of ROP, but IVC performed better in the treatment of A-ROP in this study.

4.
Artigo em Chinês | WPRIM | ID: wpr-984556

RESUMO

Objective To investigate the effect and mechanism of astragaloside Ⅳ(AS-Ⅳ) activating ROCK/JNK to regulate autophagy in improving isoproterenol (ISO) induced myocardial fibrosis (MF) in mice. Methods The mice were randomly divided into control operation group (Control group), ISO induced myocardial fibrosis group (MF group), AS-Ⅳ treatment group (AS-Ⅳ group) and combination group of astragaloside IV and Y-33075 (ROCK inhibitor) (astragaloside IV+Y-33075 group). After repeated administration for 30 days. The serum levels of LDH, BNP, CTGF in each group were detected. The cardiac function was detected by ultrasound. Myocardial structure and tissue fibrosis degree in each group were detected by Sirius Red and Masson staining. Oxidative stress (ROS) levels in myocardial tissue of each group were detected by DHE staining and the expression of ROCK, JNK, Atg5, Beclin 1, and LC3 Ⅰ/Ⅱ in myocardial tissue were detected by Western blotting. Results Compared with AS-Ⅳ group, the EF value of AS-Ⅳ+Y-33075 group decreased and the degree of myocardial fibrosis increased (P<0.05). The serum level of LDH, BNP, CTGF increased and the level of ROS in myocardial tissue increased while the expression of ROCK, JNK, Atg5, Beclin 1, LC3 Ⅰ/Ⅱ decreased (P<0.05). Y-33075 could block the protective effect of AS-Ⅳ on myocardial injury induced by MF and inhibit the regulation of AS-Ⅳ on ROCK and JNK. Conclusion AS-Ⅳ could attenuate myocardial fibrosis in mice by activating ROCK/JNK signal and promoting autophagy.

5.
Artigo em Chinês | WPRIM | ID: wpr-991450

RESUMO

Under the influence of the coronavirus disease 2019 epidemic, the disadvantages of traditional blended teaching, which has been developed for 20 years, are gradually being revealed. With the help of modern network technology and under the guidance of minimalism, the new blended teaching model adheres to the principle of systematic, holistic, ecological, and collaborative reform and thus can not only efficiently realize the teaching goal of "improvement in self-learning ability and high-order thinking ability", but also achieve innovation and inheritance of "excellent teaching concepts and methods". On this basis, this study forms the "151 framework and BASIC mechanism", which will promote the reform and upgrading of blended teaching from point to surface and then to a three-dimensional structure and ensure that blended teaching has stronger vitality in the new era.

6.
Artigo em Chinês | WPRIM | ID: wpr-990060

RESUMO

Objective:To improve the understanding of progressive familial intrahepatic cholestasis type 4 (PFIC4).Methods:Clinical characteristics in a 10-year-old boy with PFIC4 at the Second Hospital of Hebei Medical University in February 2020 were retrospectively analyzed, and the TJP2 gene mutations were analyzed. Results:The proband was a 10-year-old boy with a slow onset of intrahepatic cholestasis[normal γ-glutamyl transpeptidase(GGT)], hepatosplenomegaly and hepatic fibrosis.Laboratory tests showed elevated levels of total bilirubin, especially the direct bilirubin increased.Alanine aminotransferase, aspartate transaminase acid and total bile acid were elevated, while GGT remained in a normal range.Oral medication of ursodeoxycholic acid initially improved liver biochemical parameters, but later fluctuated.Adenosine dehydrogenase, coagulation indicators and hepatic fibrosis indexes were persistently abnormal.The average shear wave velocity of liver was 1.9 times of the upper limit of normal value.Compound heterozygous mutations c. 334G>A(p.A112T)/c.580_639delGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGG-CCTGGACCAAGACCATGCGCGCACCCGA (p.194_213delDRSRGRSLERGLDQDHARTR) were found in the TJP2 gene.The deletion mutation of the TJP2 gene was reported for the first time throughout the world.Both of his parents carried a heterozygous mutation. Conclusions:PFIC should be considered in intrahepatic cholestasis patients with a normal range of GGT.The detection of TJP2 gene mutation is of great value in the clinical diagnosis of PFIC4.The presence of TJP2 gene mutation may be a risk factor for patient developing cirrhosis of liver and primary liver cancer in early childhood.It is necessary for children with PFIC4 to be closely followed up.

7.
Chinese Journal of Biotechnology ; (12): 4335-4357, 2023.
Artigo em Chinês | WPRIM | ID: wpr-1008029

RESUMO

Biomanufacturing uses biological systems, including cells, microorganisms, and enzymes, to produce natural or synthetic molecules with biological activities for use in various industries, such as pharmaceuticals, cosmetics, and agriculture. These bioactive compounds are expected to play important roles in improving the quality of life and prolonging its length. Fortunately, recent advances in synthetic biology and automation technologies have accelerated the development of biomanufacturing, enabling us to create new products and replace conventional methods in a more sustainable manner. As of now, the role of biomanufacturing in the growth and innovation of bioeconomy is steadily increasing, and this techbology becomes a prevalent technology in global markets. To gain a comprehensive understanding of this field, this article presents a retrospective review of Bloomage Biotechnology's Research and Development and briefly reviews the developments of biomanufacturing and offers insights into the futre prospects. In conclusion, biomanufacturing will continue to be an important, environmentally friendly, and sustainable production mode in the ongoing development of bioeconomy.


Assuntos
Qualidade de Vida , Biotecnologia , Agricultura , Biologia Sintética , Indústrias
8.
Artigo em Chinês | WPRIM | ID: wpr-995993

RESUMO

Objective:To analyze the current situation of research on the moral culture construction of the healthcare industry in China, and provide reference for further promoting such construction.Methods:Relevant literature on the moral culture construction of the healthcare industry published from 2012 to April 18, 2022 were retrieved on CNKI, and bibliometric analysis was made on the temporal distribution, sources, institutional cooperation, keyword clustering, etc. of the literature through CiteSpace 5.8.R3 software.Results:A total of 126 effective documents were included, and the highest number of published articles was 23 in 2018. The top 5 journals were all non-core journals with a total of 45 articles(35.71%). The number of papers issued by 11 research institutions was 2, and the other 102 were all 1. The overall density of the knowledge map network of research institutions was 0. The top three keywords in terms of frequency were " moral culture construction" , " hospital" and " medical ethics" , of which the heart rate was>0.1.The results of cluster analysis of subject research showed that the research subjects of the moral culture construction of the healthcare industry mainly focus on the construction of hospital moral culture and medical ethics. Most of the research subjects focused on hospitals, and focus on the construction of public hospitals′ moral culture. The research content was related to medical ethics, party conduct, and doctor-patient relationship.Conclusions:Medical and health institutions should pay more attention to the construction and research of moral culture, expand the depth of research, enhance the influence of this research field, and pay attention to the construction of moral culture of healthcare institutions outside hospitals.

9.
Artigo em Chinês | WPRIM | ID: wpr-957207

RESUMO

Objective:To compare the serum uric acid levels among employees with different psychological states.Methods:From January 2019 to August 2021, 200 in-service employees of various enterprises and public institutions receiving health screening in PLA General Hospital were selected as the participants for this study. Based on the scores of psychological stress, anxiety, and depression scale, each of the three psychological states was divided into four groups from mild to severe. The baseline data, serum uric acid level, creatinine level, and urea nitrogen level of participants were studied to explore the relationship between different psychological states and changes serum uric acid level.Results:According to the degree of psychological stress, anxiety, and depression, serum uric acid levels were 198.52±30.24 μmol/L, 256.52±10.33 μmol/L, 354.20±15.54 μmol/L, and 399.20±20.20 μmol/L ( F value 694.662, P<0.001), respectively. There was statistical difference in serum uric acid level of employees with different psychological statuses; with the aggravation of psychological status, the serum uric acid level showed a trend of gradually increasing from low to high. There was a positive correlation between the scores of different psychological states and uric acid level ( r=0.885, 0.780, 0.794, P<0.05), and no correlation between uric acid level and creatinine and urea nitrogen levels ( r=1.869, 3.887, 5.798, P>0.05). Conclusions:The serum uric acid level of employees varied with different types of psychological states. The greater the psychological stress is,the more serious the degree of depression and anxiety and the higher the serum uric acid level would be. The increase in uric acid level has no relationship with creatinine and urea nitrogen level.

10.
Artigo em Chinês | WPRIM | ID: wpr-956160

RESUMO

Objective:To investigate the gaze characteristics of children with autism spectrum disorder (ASD) on dynamic threatening (fear, anger) and non-threatening emotional (sadness, happiness) faces, and to explore the correlation between their eye-tracking data and autism symptomatology scores to provide a basis for the treatment and rehabilitation of children with ASD.Methods:From November 2020 to June 2021, 26 children with ASD and 30 age-and sex-matched normally developing children (typical developmental, TD) who met the enrollment criteria were included, and children with ASD were assessed for symptoms by the childhood autism rating scale (CARS). The SMI-red portable eye-tracking recording system was used to record the eye-movement gaze characteristics of children in both groups during free viewing of dynamic threatening and non-threatening emotional face segments.Statistical processing was performed by SPSS 21.0 software.The independent sample t-test and chi square test were used for the data conforming to the normal distribution, and the non parametric test was used for the data not conforming to the normal distribution, and Pearson correlation analysis was used to analyze the correlation between eye-tracking data and symptomatology scores. Results:The total CARS score of the ASD group was (32.64±7.42). The eye tracking data for children with ASD showed gaze aversion characteristics.Children with ASD spent significantly less time gazing at the eye area of threatening emotional faces in fear (2.41(0.26, 10.65)s) and anger (2.17(0.13, 6.13)s) than children with TD (8.81(2.54, 12.11)s, 5.21(3.80, 12.49)s), with statistically significant differences (fear: Z=-2.252, P<0.05.anger: Z=-2.793, P<0.01). Children with ASD spent significantly less time gazing at the mouth area of all four emotional faces (sad: 3.56(0.44, 7.16)s, fear: 2.68(0.42, 4.78)s, anger: 2.13(0.35, 4.20)s, happiness: 2.93(0.46, 5.71)s) than children with TD (sad: 11.43(6.97, 14.22) s, fear: 6.73(3.65, 10.10)s, anger: 6.86(4.55, 12.33)s, happiness: 11.72(7.22, 14.39)s), with statistically significant differences (sad: Z=-4.502, P<0.01.fear: Z=-3.493, P<0.01.anger: Z=-4.025, P<0.01.happiness: Z=-4.699, P<0.01). Correlation analysis revealed that the time spent gazing at emotional faces in children with ASD was negatively correlated with the total CARS score ( r=-0.476, P<0.05), and further analysis of different emotional faces revealed that the time spent gazing at fearful faces in children with ASD was negatively correlated with the total CARS score ( r=-0.455, P<0.05). Conclusions:Eye tracking in children with ASD show a gaze profile with less gaze time to threatening emotional faces compared with TD children, and the more severe the symptoms in children with ASD, the less gaze time to fearful faces.

11.
Artigo em Chinês | WPRIM | ID: wpr-955614

RESUMO

Objective:To explore the reform plan for the integration of doctoral degree education in clinical medicine and standardized training for specialists.Methods:Using the literature analysis method and expert interview method, the preliminary framework of the merger training program was initially constructed, and Delphi method was used to determine the final index system. Excel 2010 was used to make data entry, and SPSS 19.0 was used for statistical analysis.Results:After two rounds of inquiry, the preliminary framework of the merger training program was finally determined from six aspects: enrollment methods, training resources, training content, training methods, training assessment and quality control, including 6 first-level indicators, 26 second-level indicators and 72 third-level indicators.Conclusion:By scientifically formulating systematic training programs, establishing the core training content and comprehensive evaluation system with post competency, and using flexible academic system, it provides a basis for carrying out the reform of the integration of doctoral education of clinical medicine and standardized training of specialists.

12.
Artigo em Chinês | WPRIM | ID: wpr-954592

RESUMO

Objective:To investigate the clinical significance and biological effect of long non-coding RNA (lncRNA) NRSN2-AS1 in ovarian cancer.Methods:The expression of NRSN2-AS1 was detected by real-time quantitative PCR (RT-qPCR) in 84 cases of ovarian cancer tissues and corresponding normal adjacent tissues, and the relationship between NRSN2-AS1 expression and clinical data of patients was analyzed. Human ovarian epithelial cells HOSEpiC and human ovarian cancer cells A2780 and OVCAR3 were cultured in vitro, and overexpression or interference of NRSN2-AS1 and control plasmids were respectively transfected into A2780 and OVCAR3 cells as the blank group, overexpression group and control group, interference group. CCK-8 assay was used to detect cell proliferation, while transwell invasion and migration assay were used to detect the change of cell metastasis ability, RT-qPCR and Western blot were used to detect the expressions of SRY related HMG box transcription factor 12 (SOX12), a potential downstream gene of NRSN2-AS1.Results:The expressions of NRSN2-AS1 in ovarian cancer tissues and cells were significantly higher than normal adjacent tissues, and the high expression of NRSN2-AS1 was significantly correlated with poor prognosis, lymph node metastasis and high clinical stage ( P<0.05). In the blank and overexpression group, the expressions of NRSN2-AS1 were 1.00±0.08 and 5.78±0.41, the expressions of SOX12 mRNA were 1.00±0.10 and 3.08±0.23, the expression of SOX12 protein were 1.00±0.08 and 7.26±0.39, the invasion cells per field were 22.7±4.9 and 79.0±6.2, and the migration cells per field were 26.5±4.1 and 43.5±4.5. In the control and interference group, the expression of NRSN2-AS1 were 1.00±0.11 and 0.37±0.04, the expressions of SOX12 mRNA were 1.00±0.07 and 0.59±0.05, the expression of SOX12 protein were 1.00±0.07 and 0.36±0.03, the invasion cells per field were 68.3±6.1 and 30.6±5.5, and the migration cells per field were 85.2±7.0 and 22.7±4.2. Compared with the blank group, the expression of SOX12 mRNA and protein in the overexpression group was significantly increased ( P<0.05), and the cell proliferation and metastasis ability were significantly enhanced ( P<0.05). Compared with the control group, the expression of SOX12 mRNA and protein in the interference group was significantly decreased, and the ability of cell proliferation and metastasis was suppressed significantly ( P<0.05) . Conclusion:The expression of NRSN2-AS1 is up-regulated in ovarian cancer, which is closely related to poor prognosis and progression of ovarian cancer. NRSN2-AS1 can promote the expression of SOX12 and the malignant behavior of ovarian cancer cells in vitro.

13.
Artigo em Chinês | WPRIM | ID: wpr-923513

RESUMO

@#Objective To systematically review the research progress of sensory integration therapy in the rehabilitation of children with cerebral palsy. Methods The literatures related to the application of sensory integration therapy in the rehabilitation of children with cerebral palsy was retrieved from Web of Sciences, PubMed, CNKI, Wanfang data, and VIP databases until November 27, 2021, using subject search. And the contents of the literatures were extracted to review the implementation plan of sensory integration therapy and the effectiveness of its application in the rehabilitation of children with cerebral palsy. Results Six literatures were included. The main focus was on the research of sensory integration therapy on postural control, gross motor function, intelligence level and cognitive function, and treatment modalities in children with cerebral palsy. Conclusion Sensory integration therapy is effective on motor function, posture control and intelligence in children with cerebral palsy. To maximize the effect of sensory integration therapy, a suitable rehabilitation treatment plan should be formulated according to the degree of sensory integration disorder and the age, gender and tolerance of children.

14.
Acta Pharmaceutica Sinica B ; (6): 2658-2671, 2022.
Artigo em Inglês | WPRIM | ID: wpr-939939

RESUMO

Glioma is a primary aggressive brain tumor with high recurrence rate. The poor efficiency of chemotherapeutic drugs crossing the blood‒brain barrier (BBB) is well-known as one of the main challenges for anti-glioma therapy. Moreover, massive infiltrated tumor-associated macrophages (TAMs) in glioma further thwart the drug efficacy. Herein, a therapeutic nanosystem (SPP-ARV-825) is constructed by incorporating the BRD4-degrading proteolytic targeting chimera (PROTAC) ARV-825 into the complex micelle (SPP) composed of substance P (SP) peptide-modified poly(ethylene glycol)-poly(d,l-lactic acid)(SP-PEG-PDLLA) and methoxy poly(ethylene glycol)-poly(d,l-lactic acid) (mPEG-PDLLA, PP), which could penetrate BBB and target brain tumor. Subsequently, released drug engenders antitumor effect via attenuating cells proliferation, inducing cells apoptosis and suppressing M2 macrophages polarization through the inhibition of IRF4 promoter transcription and phosphorylation of STAT6, STAT3 and AKT. Taken together, our work demonstrates the versatile role and therapeutic efficacy of SPP-ARV-825 micelle against glioma, which may provide a novel strategy for glioma therapy in future.

15.
Artigo em Chinês | WPRIM | ID: wpr-934278

RESUMO

With the rapid development of fundus imaging technology, it is of great significance to establish a new naming system for neovascular age-related macular degeneration (nAMD) based on the multi-mode imaging. In 2020, an international panel of retina specialists, imaging and image reading center experts, and ocular pathologists reached a consensus after repeated discussions, a new name for nAMD subtype and related lesions was established based on the previous knowledge of fundus fluorescein angiography and pathology, combining indocyanine green angiography, optical coherence tomography and optical coherence tomography angiography with current pathological knowledge, in order to help ophthalmologists to study nAMD. The consensus proposed the term "macular neovascularization" and classified it into type 1, type 2 and type 3. Many lesions related to macular neovascularization, such as pigment epithelial detachment, hemorrhage, fibrosis, rip of retinal pigment epithelium and so on, were named. The new designation will help improve clinical communication between different studies, establish standard definitions and terms between reading centers and researchers, and further promote the understanding and communication of nAMD among ophthalmologists.

16.
Cancer Research and Clinic ; (6): 423-428, 2022.
Artigo em Chinês | WPRIM | ID: wpr-958868

RESUMO

Objective:To screen and analyze ferroptosis-related genes (FRG) impacting the prognosis of colorectal adenocarcinoma patients based on bioinformatics.Methods:RNA sequencing data including the clinical information of 545 colorectal adenocarcinoma patients and 602 data sets were downloaded from the Cancer Genome Atlas (TCGA) database. FRG gene sets were downloaded from FerrDb database. FRG expression dataset could be obtained after taking the intersection between FRG gene sets and TCGA database gene sets. Differentially expressed FRG and prognosis-related genes between colorectal adenocarcinoma tissues and the adjacent tissues were screened by using R software, and finally FRG influencing the prognosis of colorectal adenocarcinoma were obtained. According to protein-protein interaction networks, the interaction and the expression association of proteins were analyzed. LASSO regression analysis was used to build a risk model for patients' 5-year overall survival rate. The risk value was calculated for 509 colorectal adenocarcinoma samples in the TCGA database, and then the median risk value was taken as the cut-off value. All patients were divided into the high-risk group (≥ median risk value) and the low-risk group (< median risk value), and the survival curves of the two groups were drawn. The receiver operating characteristic (ROC) curve was drawn for predicting the 5-year overall survival rate of colorectal adenocarcinoma patients in a time-dependent way in TCGA database according to the risk value of FRG prognosis model. Cox proportional risk model was used to make univariate and multivariate survival analysis in order to screen factors affecting the prognosis. The pathway enrichment analysis of prognosis-related FRG of colorectal adenocarcinoma was performed based on gene ontology (GO) database and Kyoto Encyclopedia of Genes and Genomes (KEGG) database.Results:The clinical information of 545 patients and 602 datasets were extracted from the database. A total of differential expressed 199 FRG in colorectal adenocarcinoma and 28 prognosis-related FRG were identified. After taking the intersection, 21 FRG affecting the prognosis of colorectal adenocarcinoma patients were identified. DUOX2, NOX4, NOX1, DDIT3, JDP2, ATP6V1G2, ULK1, ATG3 were probably associated with WIPI1; expressions of NOX4, NOX5, PLIN4 were positively correlated with ATP6V1G2, while the expression of ULK1 was negatively correlated with MAPK1, MYB, FANCD2, ATG3 and ATP5MC3. LASSO regression analysis showed that 15 FRG were finally screened out (ATP5MC3, NOX4, NOX5, ALOX12B, ATG3, WIPI1, MAPK1, MYB, AKR1C1, DDIT3, JDP2, ATP6V1G2, DRD4, SLC2A3, PLIN4), and the risk model was constructed by calculating the risk value, and the risk value = NOX4×0.139-ATP5M3×0.108+NOX5×1.486+ALOX12B×0.475-ATG3×0.030-WIPI1×0.170-MAPK1×0.271-MYB×0.063+AKR1C1×0.021+DDIT3×0.186+JDP2×0.292+ATP6V1G2×0.777+DRD4×0.294+SLC2A3×0.059+PLIN4×0.113. The overall survival of patients in the high-risk group was worse than that in the low-risk group ( P < 0.001). The 5-year overall survival rate was 48.2% in the high-risk group and 76.8% in the low-risk group. Multivariate survival showed that the age and risk value were independent affecting factors of the prognosis. ROC curves revealed that the risk model constructed by using prognosis-related FRG could well predict the 5-year overall survival rate of patients (the area under the curve was 0.728). The differential expressed genes of both groups may be associated with genetic pathways such as extracellular matrix composition, extracellular structure composition and focal adhesion. Conclusions:The prognostic risk model constructed by the screened FRG can better evaluate the prognosis of colorectal adenocarcinoma patients. These FRG are expected to become new candidate biomarkers related to the prognosis of colorectal adenocarcinoma.

17.
Chinese Journal of Neurology ; (12): 952-956, 2021.
Artigo em Chinês | WPRIM | ID: wpr-911820

RESUMO

Hyperhomocysteinemia (HHcy) is one of the independent risk factors for youth cerebral infarction. Gene mutation of key enzymes in homocysteine metabolism is the main cause of HHcy. Few cases of cystathionine beta-synthase (CBS) compound heterozygous mutation complicated with pulmonary embolism and lower extremity artery embolism have been reported. This article reported a young cerebral infarction patient complicated with pulmonary embolism and lower extremity artery embolism, who was subsequently detected with significantly elevated blood Hcy, and finally etiologically diagnosed with CBS 833 T>C/1082C>T compound heterozygous mutation. With the treatment of folic acid, methyl cobalt amine, vitamin B 6 and anticoagulant, the blood Hcy has been gradually declined, and no new thrombotic events occurred during the follow-up period of a year.

18.
Artigo em Chinês | WPRIM | ID: wpr-910617

RESUMO

Objective:To investigate the consistency of indirect calorimetry, Harris-Benedict (H-B) formula method and rule of thumb in calculating the daily total energy expenditure (TDEE) of patients with acute pancreatitis (AP), and provide the basis for the formulation of reasonable nutritional support program.Methods:A total of 66 AP patients admitted to Henan Provincial People's Hospital from June 2020 to December 2020 were included and retrospectively analyzed, including 35 males and 31 females with an average age of 41.8 years. They were divided into mild acute pancreatitis (MAP) group ( n=20) and moderate to severe AP group ( n=46) according to severity. TDEE was calculated by indirect calorimetry, H-B formula and rule of thumb, and Pearson correlation analysis and Bland-Altman diagram were used to analyze the correlation and consistency of the three methods, respectively. Results:There were no statistical significances in the TDEE of MAP group calculated by indirect calorimetry, H-B formula method and rule of thumb (both P>0.05). TDEE calculated by indirect calorimetry were higher than that of calculated by H-B formula and thumb method both in moderate and severe AP groups, and the difference was statistically significant (both P<0.05). Pearson correlation analysis showed that H-B formula method was positively correlated with the TDEE calculated by indirect calorimetry, and the correlation was 0.61 ( P<0.05). Bland-Altman plot analysis showed the consistence of the two methods. TDEE calculated by rule of thumb was positively correlated with that calculated by indirect calorimetry, and the correlation was 0.75 ( P<0.05). The bland-Altman plot analysis showed a good consistency between the two methods. Conclusion:For MAP patients, TDEE can be calculated by the H-B formula method and rule of thumb. In moderate and severe AP patients, TDEE should be calculated by indirect calorimetry as the basis for the formulation of nutritional support plan.

19.
Artigo em Chinês | WPRIM | ID: wpr-882881

RESUMO

Objective:A retrospective analysis was performed on clinical characteristics and deoxyguanosine kinase DGUOK gene mutations in a family with hepatocerebral mitochondrial DNA depletion syndrome (MTDPS). Methods:The clinical data, treatment process and gene detection results of a child with MTDPS in the second hospital of Hebei Medical University in April 2019 were analyzed and summarized.Results:Proband was a girl.From the first week of infantile, she suffered from recurrent hypoglycemia, hyperlactic acid, progressive cholestatic liver dysfunction, coagulopathy, difficult feeding, slow growth of body mass, microcephaly, hypotonia, and gradul intermittent binocular tremors, and eventually failed to thrive.Gene testing identified two compound heterozygous mutations c. 42-c.43insTTCA(p.F15fs129X)/c.808-1(IVS6)G>A in DGUOK gene.The former was a frame-shift mutation resulted in truncated protein and the later was a splicing mutation resulted in abnormal splicing.Each parent was a heterozygous carrier, and there were no mutations in the two sites with her elder sister. Conclusions:Both mutations were first reported worldwide. DGUOK gene mutations with MTDPS are important causes of infant liver failure.When hypoglycemia, hyperlactic acidemia and liver dysfunction occur in newborn and infant, MTDPS related gene DGUOK gene sequencing screening should be considered for early definitive diagnosis, or, when acute liver failure happen in infant and childhood, neuromuscular involvement is insufficient.

20.
Artigo em Chinês | WPRIM | ID: wpr-934257

RESUMO

Objective:To observe the imaging characteristics of optical coherence tomography angiography in macular telangiectasia type 2 (Mac-Tel 2).Methods:A retrospective case analysis. From October 2017 to June 2021, 11 patients (22 eyes) diagnosed as Mac-Tel type 2 by multi-modal imaging in Nanjing Medical University Eye Hospital were included in this study. There were 5 males (10 eyes) and 6 females (12 eyes). The age were 41.61±11.32 years old. All patients underwent the examinations of best corrected visual acuity, indirect ophthalmoscope, fundus color photography, fluorescein fundus angiography (FFA), optical coherence tomography (OCT), and OCT angiography (OCTA). The scope of 3 mm × 3 mm in macular area of eyes was scanned by OCTA. After automatic image processing, the system could provide the blood flow image of capillary layer, deep capillary layer, outer retina, choroidal capillary layer, and the B-scan image. The imaging characteristics were observed.Results:Among the 22 eyes, 14 eyes were in the early stage of the disease, and 8 eyes had secondary subretinal neovascularization (SRN) and/or choroidal neovascularization (CNV). FFA examination that in the early stage of the disease, the capillaries near the fovea were dilated, the blood vessels were stretched, and the late fluorescence was mainly stained; high-fluorescence leakage was seen when SRN and CNV were developed. OCTA examination showed that in the early stage of the disease, the temporal capillaries in the macular area were dilated and stretched, especially in the deep layer. The capillary space was enlarged, and the right-angled venules were seen to change and infiltrate into the deep layer; when the lesions invaded the outer retina, flower clusters-like SRN were seen; neovascularization was seen in the outer retina and choroidal capillary layer when CNV was developed. B-scan image showed that in the early stage of the disease, irregular weak reflex cavities and lamellar holes change between the neuroepithelial layers; secondary SRN and CNV showed strong little clumpy reflexes accompanied by abundant blood flow signals.Conclusion:The image characteristics of OCTA in the eyes of Mac-Tel 2 were dilated, stretched superficial and deep temporal capillaries in the macula area and right-angled changes in blood vessels.

SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA