Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 6 de 6
Filtrar
Adicionar filtros








Intervalo de ano
1.
Journal of Preventive Medicine ; (12): 1003-1008, 2017.
Artigo em Chinês | WPRIM | ID: wpr-792664

RESUMO

Objective To compare the applicability of different occupational health risk assessment methods in small furniture manufacturing industry. Methods American EPA inhalation risk model, Singapore semi-quantitative risk assessment model of occupational exposure to chemical substances and Australian Occupational Health and Safety Risk Assessment model, were used to assess the occupational health risk in a small furniture manufacturing industry from a city of Zhejiang Province. Results The results of American EPA model showed that the workers who exposed to benzene and formaldehyde had low risk of carcinogens, and who exposed to benzene and xylene had very high risk of non-carcinogens. According to Singapore semi-quantitative risk assessment model, there were low and medium health risk caused by toluene and xylene, and high risk caused by wood dust in preparation and polishing jobs. Similar to the results of other models, Australia qualitative risk assessment model showed that there were medium health risk caused by toluene and xylene, and high risk caused by benzene, wood dust and noise. All of the three methods could found the key risk control point in furniture manufacturing industry. The risk ratios of the three methods were higher than the toxic work classification ratio (P<0.01), and the risk ratio of EPA model were higher than the results of Singapore model and Australia model (P<0.05) . Conclusion All of the three methods can be applied to assess the occupational health risk in furniture manufacturing industry, and the combined application of multiple risk assessment methods can be used as one of the risk assessment strategies.

2.
Journal of Preventive Medicine ; (12): 445-448,452, 2016.
Artigo em Chinês | WPRIM | ID: wpr-792496

RESUMO

Objective TolearnthehealthstatusofemptynesterswithdiabetesinthemountainssouthwestofZhejiangand toexploretheinfluencingfactors.Methods Usingthemethodofstratified-random-clustersampling,78emptynesters with diabetes and 1 56 non -empty nesters with diabetes who come from five streets and 1 0 towns of 30 community (or village)were selected and investigated by questionnaire and physical examination were conducted.Univariate analysis were conducted to compare the differences about lifestyle,biochemical indicators and health status between the two groups and multivariateunconditionallogisticregressionanalysiswereconductedtoanalyzetheinfluencingfactors.Results The prevalence of hypertension of empty nest group was 70.51%,and the prevalence of hypertension of non-empty nest group was 58.97%.Fasting blood glucose level of empty nest group was 9.39 ±5.73 mmol/L,higher than that of the non-empty nest group(P<0.05 ).There was significant difference between the two groups in other indicators,such as drinking rate,high -salt diet rate,obesity rate,triglyceride levels,regular exercise rate,vegetables/fruits ≥4 days/week proportion,fish/meat≥4 days/week,awareness of their own blood pressure and blood sugar awareness (P<0.05).After adjustment for age,the obesity rate,abnormal rate of triglycerides,fish/meat(≥4 days/week)intake,regular exercise rate,blood pressure and blood sugar awareness rate were lower among non-empty nesters with diabetes,and overweight rate,systolic blood pressure abnormal rate,fasting glucose ratio,alcohol and high salt diet were higher in empty nest group patientswithdiabetes.Conclusion Emptynesterswithdiabeteshavearelativelyhighproportionoflackofexercise, inadequate nutrition intake,alcohol consumption,high-salt diet and lack of health knowledge and other unhealthy factors. The community health services and individual guidance for the empty nesters should be strengthened to improve the health status of empty nesters with diabetes.

3.
Chinese Journal of Oncology ; (12): 85-88, 2013.
Artigo em Chinês | WPRIM | ID: wpr-284233

RESUMO

<p><b>OBJECTIVE</b>To explore the expression of soluble programmed death ligand-1 on lung cancer cells and to clarify its biological function through PD-1/PD-L1 pathway in regulating the function of T lymphocytes.</p><p><b>METHODS</b>Labeled monoclonal antibody and flow cytometry were used to analyze the expression of PD-L1 and its receptor PD-l on lung cancer cells and human T lymphocytes, respectively. The level of sPD-L1 in the supernatant of lung cancer cells was determined with an ELISA kit. The inhibition of proliferation of T lymphocytes by mPD-L1 and sPD-L1 was studied using CCK-8 incorporation.</p><p><b>RESULTS</b>Low or no expression [(16.08 ± 2.28)%] of PD-1 was found on resting T lymphocytes from human peripheral blood with flow cytometry, but up-regulated expression of PD-1 [(78.06 ± 7.21)%] was found on the surface of activated T lymphocytes. Soluble PD-L1 was found in supernatant of some lung cancer cell lines, such as H1299, HO8910, SPCA-1, H460, H446 cells, with PD-L1 expressing on their cell surface [(78.34 ± 10.25)%, (68.17 ± 11.56)%, (45.32 ± 7.98)%, (47.52 ± 9.62)% and (40.95 ± 8.56)%, respectively], but very low expression on A549 cells [(16.02 ± 6.28)%]. The level of mPD-L1 on H1299 cells was highest [(78.34 ± 10.25)%], compared with HO8910 cells (68.17 ± 11.56)%, SPCA-1 cells (45.32 ± 7.98)%, H446 cells (40.95 ± 8.56)%, and H460 cells (47.52 ± 9.62)%. At the same time, the sPD-L1 level on H1299 cells was low [(0.17 ± 0.01) ng/ml], compared with HO8910 cells (0.30 ± 0.03) ng/ml, SPCA-1cells (0.59 ± 0.03) ng/ml, H446 cells (0.34 ± 0.02) ng/ml, and H460 cells (0.57 ± 0.03) ng/ml, but not expressed on A549 cells. PD-L1 expressing H1299 cells inhibited the proliferation of T lymphocytes in the co-culture system. Supernatant of the cultured PD-L1(+) lung cancer cells also inhibited T cell proliferation. Anti-human PD-L1 blocking antibody could partly restore the proliferation capacity of T lymphocytes.</p><p><b>CONCLUSIONS</b>Membrane-bound PD-L1 and soluble PD-L1 released from lung cancer cells can effectively inhibit the proliferation of T lymphocytes in mixed culture system and down-regulate cell-mediated immunity in vitro. This may lead to inactivation of tumor antigen-specific T cells and immune escape of lung cancer cells.</p>


Assuntos
Humanos , Antígeno B7-H1 , Metabolismo , Linhagem Celular Tumoral , Proliferação de Células , Técnicas de Cocultura , Imunidade Celular , Neoplasias Pulmonares , Metabolismo , Patologia , Ativação Linfocitária , Receptor de Morte Celular Programada 1 , Metabolismo , Linfócitos T , Biologia Celular , Alergia e Imunologia , Evasão Tumoral , Regulação para Cima
4.
Chinese Journal of Oncology ; (12): 405-409, 2010.
Artigo em Chinês | WPRIM | ID: wpr-260390

RESUMO

<p><b>OBJECTIVE</b>To investigate the changes in expression profiles of angiomotin (Amot), schlafen5 (Slfn5), metalloproteinase-9 (MMP-9) and vascular endothelial cell growth factor (VEGF), which are genes associated with angiogenesis, tumor growth and invasion, after gene silencing of pleiotrophin (PTN) in human small cell lung cancer H446 cells.</p><p><b>METHODS</b>PTN expression in H446 cells was determined by RT-PCR and Western blot. After constructing a lentiviral vector interfering PTN expression, it was packaged into virus in 293T cells. Then the virus was used to infect human small cell lung cancer H446 cells. The expressions of Amot, Slfn5, MMP-9 and VEGF were detected by RT-PCR in normal non-interference group, negative control group, PTN-interference group and group combining PTN interference and chemotherapy.</p><p><b>RESULTS</b>The results of RT-PCR and Western blot test showed that PTN expression in H446 cells was high. The interference efficiency of constructed ShRNA sequences (GCAGCTGTGGATACTGCTGAA) targeting PTN was as high as 72.1% and 59.2% at the mRNA and protein levels, respectively, in H446 cells. Compared with the negative control group, the expressions of Slfn5 and MMP-9 in H446 cells were increased by 165.1% and 47.3%, while the ones of Amot and VEGF were down-regulated by 33.1% and 26.6%, respectively, after gene silencing of PTN. The changes of gene expression profile became more evident when chemotherapy was superimposed on PTN interference.</p><p><b>CONCLUSION</b>Gene silencing of PTN using siRNA lentiviral expressing vector can influence the expression of proliferation and metastasis-related genes in human small cell lung cancer H446 cells.</p>


Assuntos
Humanos , Proteínas de Transporte , Genética , Metabolismo , Proteínas de Ciclo Celular , Metabolismo , Linhagem Celular Tumoral , Citocinas , Genética , Metabolismo , Perfilação da Expressão Gênica , Regulação Neoplásica da Expressão Gênica , Vetores Genéticos , Peptídeos e Proteínas de Sinalização Intercelular , Metabolismo , Lentivirus , Genética , Neoplasias Pulmonares , Genética , Metabolismo , Patologia , Metaloproteinase 9 da Matriz , Metabolismo , Proteínas de Membrana , Metabolismo , Interferência de RNA , RNA Mensageiro , Metabolismo , RNA Interferente Pequeno , Genética , Carcinoma de Pequenas Células do Pulmão , Genética , Metabolismo , Patologia , Fator A de Crescimento do Endotélio Vascular , Metabolismo
5.
Artigo em Chinês | WPRIM | ID: wpr-253148

RESUMO

<p><b>AIM</b>To investigate the effects of 1 alpha hydroxylase and serum calcium on the expression of 24-hydroxylase gene in mice kidney.</p><p><b>METHODS</b>Mice with targeted deletion of the 25-hydroxyvitamin D 1 alpha hydroxylase gene(1alpha (OH)ase-/-), and the vitamin D receptor gene (VDR-/-) were used. The study of each mutant had two groups which were (1) mutant with high calcium diet, which maintained fertility but left mice hypocalcaemia; (2) mutant with high lactose diet, which normalized calcium in two mutant. Mice in same litter were as control. There were six groups in total and each group had five mice. All mice were killed at 10-week-old. Serum calcium was determined by an autoanalyzer. RNA was isolated from mouse kidney and the express of 1 alpha hydroxylase gene and 24-Hydroxylase gene were studied by RT-PCR.</p><p><b>RESULTS</b>On the high calcium intake, all mutant animals were hypocalcaemia (1alpha (OH)ase-/- (78 +/- 10.4) mg/L, P < 0.05; VDR-/- (68 +/- 9.8) mg/L, P < 0.05. WT (111 +/- 16.5 mg/L), but when the high lactose diet was administered, serum calcium levels in two mutant mice rose to wild-type levels. The 1 alpha hydroxylase gene was expressed at very higher levels in the vitamin D receptor mutant mice than in wild-type mice when animals received a high calcium intake; This was reduced by eliminating hypocalcaemia with the high lactose diet. Expression of the 24(OH)ase gene was extremely down-regulated in two mutant mice on the high calcium diet but was restored to wild-type levels on the high lactose diet.</p><p><b>CONCLUSION</b>The express of 24-hydroxylase gene was directly regulated by serum calcium rather than 1 alpha-hydroxylase. These studies indicate that both the serum calcium and 1 alpha-hydroxylase exert effects on the expression of 24-hydroxylase gene, but 1 alpha-hydroxylase take the effects by elevated the concentration of serum calcium. There are no direct interaction between 1 alpha-hydroxylase gene and 24-hydroxylase gene.</p>


Assuntos
Animais , Camundongos , 25-Hidroxivitamina D3 1-alfa-Hidroxilase , Genética , Cálcio , Sangue , Expressão Gênica , Camundongos Knockout , Soro , Química , Esteroide Hidroxilases , Genética , Metabolismo , Vitamina D3 24-Hidroxilase
6.
Acta Physiologica Sinica ; (6): 573-576, 2006.
Artigo em Chinês | WPRIM | ID: wpr-265414

RESUMO

It is well known that estrogen can inhibit bone absorption, decrease bone turnover and preserve bone mass. Some studies indicated that the effect of estrogen on calcium and bone is relative to vitamin D system, while others also reported that this effect of estrogen is independent of vitamin D. The genomic effect of 1alpha, 25(OH)(2)D(3)is mediated by the nuclear vitamin D receptor (VDR) in a ligand-dependent manner. Hypocalcemia, hyperparathyroidism and osteomalacia are developed in VDR gene knockout mice. To determine whether the effect of estrogen on calcium and bone is dependent on VDR, this study examined the effect of exogenous estrogen on calcium and bone homeostasis in VDR gene knockout mice. Male and female wild type (WT) and VDR gene knockout heterozygous mice were mated each other and the genotyping of their offsprings were determined by PCR. At age of 21-day, WT and knockout mice were weaned and treated by one of three different regimens: (1) WT-vehicle group: the WT mice were injected with normal saline; (2) VDR KO-vehicle group: the VDR gene knockout mice were injected with normal saline; (3) VDR KO-E group: the VDR gene knockout mice were subcutaneously injected with estradiol, 0.2 mug per mouse, once daily for 1 month. The bone mineral density (BMD) of mice was measured using dual-energy X-ray absorptiometry. All mice were sacrificed at age of 50-day. Blood was taken by heart puncture under anesthesia and serum calcium was measured by autoanalyser.Tibiae were removed, fixed and embedded with the methylmethacrylate (MMA), and undecalcified sections were cut. These sections were stained for mineral with the von Kossa staining procedure and counterstained with toluidine blue. Static histomorphometric analyses were performed on those stained sections. The results showed that the serum calcium level was (2.10+/-0.37) mmol/L in the VDR KO-vehicle mice and rose to (2.80+/-0.41) mmol/L in the VDR KO-E mice although it was still lower than WT-vehicle mice [(3.10+/-0.48) mmol/L]. BMD and mineralized trabeculer volume were increased significantly in VDR KO-E group compared with that in VDR KO-vehicle group. These results suggest that exogenous estrogen can improve calcium absorption and skeletal mineralization in a VDR-independent manner.


Assuntos
Animais , Feminino , Camundongos , Densidade Óssea , Calcificação Fisiológica , Cálcio , Metabolismo , Estrogênios , Farmacologia , Técnicas de Inativação de Genes , Homeostase , Camundongos Knockout , Receptores de Calcitriol , Genética
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA