Detection of Herpes Simplex Virus DNA in Clinical specimens by Polymerasde Chain Reaction (PCR)

ABSTRACT

The rapid and sensitive diagnostic methods for herpes simplex virus (HSV) infection have been developed. In this study, we employed the polymerase chain reaction (PCR) technique with primer 5 CATCACCGACCCGGAGACGGAC 3 for detection HSV DNA from specimens obtained from the corneal lesion of patients who were suspected of HSV keratitis. The products of PCR was confirmed with agarose gel electrophoresis and southern blot hybridization. Positive results were obtained 4 of 7 typical lesions(2 of 5 dendritic lesions and 2 of 2 geographic lesions) and 7 including 4 without a history of herpetic keratitis of 17 atypical lesions. With these results we could find that PCR technique would be a useful tool for the detection of HSV DNA in both typical and atypical lesion of herpetic keratitis as well as in cases hard to diagnose clinically.