An Edge-Supported Blockchain-Based Secure Authentication Method and a Cryptocurrency-Based Billing System for P2P Charging of Electric Vehicles.

The popularity of electric vehicles (EVs) is constantly increasing, as they use relatively greener, sustainable energy. However, it is a fact that the charging stations for EVs are yet to meet the demand. It could be a great solution if a peer-to-peer (P2P) charging system could be initiated by anyone who wants to make their garage's charge points publicly available for commercial purposes, named a home charging station (HCS). In this work, our idea is to bring interested charging stations under a network of nodes and a blockchain-based management system, where the blockchain is responsible for ensuring the authenticity of both the charging stations and charge receiver. A cryptocurrency-based payment system has also been proposed to ensure transactions' security, integrity, transparency, and immutability. A reputation management system is applied to maintain the quality of service. Miners with high processing power are used to alleviate lagging during block creation, supported by edge servers. The proposed system has been implemented by using virtual machines. A theoretical analysis is presented to assess the compatibility and possible cost requirements to implement the system in a real-world scenario.

Intravaginal insemination depth influences fertility outcomes in Indian red jungle fowl (Gallus gallus murghi).

The depth of intravaginal insemination to achieve optimum fertility with frozen-thawed semen is highly species specific in birds and differ even in breed and/or strains of a species. Therefore, study was designed to evaluate the influence of intravaginal insemination depths (2 and 4 cm) on fertility outcome in Indian red jungle fowl. Semen collected from eight mature cocks was pooled, diluted in extender and cooled to 4 °C. Glycerol (20%) was added to chilled semen, equilibrated for 10 min and cryopreserved. After 3 days of storage, frozen semen was thawed in water bath at 37 °C for 30 s. After glycerol removal, intravaginal Inseminations were performed at the depth of 2 and 4 cm. The no. of fertilized eggs (31.4 ± 1.6 vs. 27.7 ± 1.8), fertility rate (65.7 ± 3.6 vs. 58.8 ± 4.0), no. of hatched chicks (27.8 ± 1.9 vs. 23.5 ± 1.6), hatchability of set eggs (58.8 ± 4.3 vs. 49.7 ± 3.2) and hatchability of fertilized eggs (88.4 ± 2.8 vs. 84.3 ± 2.2) were recorded higher with intravaginal depth of 4 cm compared to 2 cm. It is concluded that intravaginal insemination at the depth of 4 cm enhances the fertility outcomes of the frozen-thawed Indian red jungle fowl semen.

A Blockchain-Based Authentication Protocol for Cooperative Vehicular Ad Hoc Network.

The efficiency of cooperative communication protocols to increase the reliability and range of transmission for Vehicular Ad hoc Network (VANET) is proven, but identity verification and communication security are required to be ensured. Though it is difficult to maintain strong network connections between vehicles because of there high mobility, with the help of cooperative communication, it is possible to increase the communication efficiency, minimise delay, packet loss, and Packet Dropping Rate (PDR). However, cooperating with unknown or unauthorized vehicles could result in information theft, privacy leakage, vulnerable to different security attacks, etc. In this paper, a blockchain based secure and privacy preserving authentication protocol is proposed for the Internet of Vehicles (IoV). Blockchain is utilized to store and manage the authentication information in a distributed and decentralized environment and developed on the Ethereum platform that uses a digital signature algorithm to ensure confidentiality, non-repudiation, integrity, and preserving the privacy of the IoVs. For optimized communication, transmitted services are categorized into emergency and optional services. Similarly, to optimize the performance of the authentication process, IoVs are categorized as emergency and general IoVs. The proposed cooperative protocol is validated by numerical analyses which show that the protocol successfully increases the system throughput and decreases PDR and delay. On the other hand, the authentication protocol requires minimum storage as well as generates low computational overhead that is suitable for the IoVs with limited computer resources.

Risk of multi-drug resistant Campylobacter spp. and residual antimicrobials at poultry farms and live bird markets in Bangladesh.

BACKGROUND: Understanding potential risks of multi-drug resistant (MDR) pathogens from the booming poultry sector is a crucial public health concern. Campylobacter spp. are among the most important zoonotic pathogens associated with MDR infections in poultry and human. This study systematically examined potential risks and associated socio-environmental factors of MDR Campylobacter spp. in poultry farms and live bird markets (LBMs) of Bangladesh. METHODS: Microbial culture and PCR-based methods were applied to examine the occurrence and MDR patterns of Campylobacter spp. in potential sources (n = 224) at 7 hatcheries, 9 broiler farms and 4 LBMs in three sub-districts. Antimicrobial residues in broiler meat and liver samples (n = 50) were detected by advanced chromatographic techniques. A questionnaire based cross-sectional survey was conducted on socio-environmental factors. RESULTS: Overall, 32% (71/ 224) samples were found contaminated with Campylobacter spp. In poultry farms, Campylobacter spp. was primarily found in cloacal swab (21/49, 43%), followed by drinking water (8/24, 33%), and meat (8/28, 29%) samples of broilers. Remarkably, at LBMs, Campylobacter spp. was detected in higher prevalence (p < 0.05) in broiler meat (14/26, 54%), which could be related (p < 0.01) to bacterial contamination of drinking water (11/21, 52%) and floor (9/21, 43%). Campylobacter isolates, one from each of 71 positive samples, were differentiated into Campylobacter jejuni (66%) and Campylobacter coli (34%). Alarmingly, 49 and 42% strains of C. jejuni and C. coli, respectively, were observed as MDR, i.e., resistant to three or more antimicrobials, including, tetracycline, amoxicillin, streptomycin, fluoroquinolones, and macrolides. Residual antimicrobials (oxytetracycline, ciprofloxacin and enrofloxacin) were detected in majority of broiler liver (79%) and meat (62%) samples, among which 33 and 19%, respectively, had concentration above acceptable limit. Inadequate personal and environmental hygiene, unscrupulously use of antimicrobials, improper waste disposal, and lack of health surveillance were distinguishable risk factors, with local diversity and compound influences on MDR pathogens. CONCLUSION: Potential contamination sources and anthropogenic factors associated with the alarming occurrence of MDR Campylobacter, noted in this study, would aid in developing interventions to minimize the increasing risks of poultry-associated MDR pathogens under 'One Health' banner that includes poultry, human and environment perspectives.

Non-Hodgkin's lymphoma by immunohistochemistry.

Non Hodgkin's lymphomas (NHL) constitute a heterogeneous group of neoplasm of the lymphoid system. There are many histological subtype of NHL based on WHO classification of hematopoietic and lymphoid neoplasm. This cross-sectional study was carried out in the department of Pathology, Dhaka Medical College, Dhaka from January 2009 to December 2010 to observe the different subtypes of NHL using immunohistochemistry (IHC) with CD3. A total of 50 microscopically diagnosed case of NHL irrespective of age and sex were included in the study. The diagnostic morphologic criteria of each lymphoma subcategory were compiled and diagnosis was made. Mean age of the study subjects were 42.0±19.7 years with range 3-75 years and male female ratio was 1.8:1. Nodal NHL was 66% and extranodal cases were 34%. Maximum number of histolgic subtypes belonged to diffuse large B-cell lymphoma (DLBCL) and male was predominant in all histological subtypes, except peripheral T-cell lymphoma (PTCL). DLBCL was predominant in all B-cell NHL whereas PTCL was predominant in all T-cell NHL. The most childhood patients belonged to lymphoblastic lymphoma. Regarding cell lineage B-cell NHL was more common than T-cell NHL (88% vs. 12%), but high grade pattern was more predominant in T-cell type (83.3% vs. 65.9%). Among 50 study subjects histological (H & E) diagnosis reveals 46 cases as B-cell NHL and 4 as T-cell NHL but IHC confirms 6 cases as T-cell NHL.

Prevalence of Abnormal Semen Parameters among the Infertile Couples Seeking Infertility Treatment.

Infertility, affecting 60 to 80 million couples globally, is clinically defined as the inability to conceive after 12 months of unprotected sexual contact. Male factors contribute significantly, comprising 40.0% to 50.0% of infertility cases. While the prevalence ranges from 5.0% to 30.0% in developing countries, the exact global prevalence remains unknown. The study, conducted at CMH and Ibn Sina Hospital, Jashore from October 2020 to September 2023, utilized a cross-sectional approach; examining 4173 samples aged 21 to 41. Exclusion criteria considered known female reproductive abnormalities or medications impacting male fertility. Standardized procedures, in-depth questionnaires and SPSS software version 15.0 were employed, adhering to World Health Organization Guidelines. In a study of 4173 seeking infertility treatment, 63.0% had abnormal semen parameters, with 45.0% aged 31-40 years. Addiction patterns: 76.0% used tobacco, 14.0% reported alcohol and tobacco. Occupations: 43.0% government workers, 41.0% private workers. Marriage duration: 44.0% married 5-10 years, infertility duration: 64.0% less than 6 years. Semen analysis showed 40% with sperm count above 65 million, 46.0% with 60.0-90.0% motile sperm, and 78.0% with sperm morphology below 15.0%. The most prevalent abnormality is asthenozoospermia 59%, with oligozoospermia and azoospermia observed in 31% and 3% of cases, respectively. This study highlights the global complexity of male infertility, emphasizing genetic factors in infertile couples. Addressing sample bias and the lack of national epidemiological data underscores the ongoing need for comprehensive research to advance global infertility diagnosis and treatment.

Animal, human, and environmental perspectives on anthrax in Bangladesh.

Background: In Bangladesh, the zoonotic transmission of anthrax from animals to humans poses substantial challenges for prevention and control programs, especially in resource-constrained settings. A comprehensive literature review was conducted focusing on anthrax infections in animals, humans, and the environment to enable better design of prevention and control strategies. Materials and methods: We followed PRISMA guidelines to collect data on anthrax infection in animals and humans from reports between 1980 and January 2023. We used a standardized data extraction template to collect data on study location, year, hosts, deaths and risk factors responsible for anthrax occurrences at the animal, human and environmental sectors. Subsequently, we conducted a thorough analysis of the data gathered to identify the factors responsible for anthrax occurrences and to propose updated strategies for anthrax prevention and control. Results: Of the 27 articles analyzed, 20 focused on animal or human anthrax, while seven addressed environmental contaminations. A total of 6354 cases of anthrax infection in animals were recorded, with 998 fatalities and an overall case fatality of 15.7 %. In humans, inadequate knowledge about anthrax and its transmission was a significant factor. Risk factors for human cutaneous anthrax included activities such as slaughtering diseased animals and contact with contaminated raw meat or blood. Risky practices such as disposal of animal carcasses in floodwaters or water bodies were observed in some areas, contributing to the persistence of the anthrax pathogen in the environment. Conclusions: Our study highlights the necessity of a multisectoral One Health approach to effectively control and prevent anthrax outbreaks in both animals and humans. This approach should include comprehensive vaccination programs, social and behavioral change activities, environmental management, and the establishment of surveillance systems. Implementing these recommendations will be crucial in addressing the complex challenges posed by anthrax in low-resource settings.

Histological scoring and associated risk factors of non-alcoholic fatty liver disease.

Non alcoholic steatohepatitis is a hepatic disorder with histological features of alcohol induced liver disease that occurs in individual who do not consume significant alcohol. Liver biopsy is an important part of the evaluation in term of both grade & stage. A cross sectional study was carried out in the department of Pathology, Dhaka Medical College, Dhaka & department of Hepatology, Bangabandhu Sheikh Mujib Medical University (BSMMU) from July 2007 to June 2009. Total 55 adult subjects of both sex were included on the basis of predefined inclusion & exclusion criteria in this study to evaluate the histological pattern of non alcoholic fatty liver disease (NAFLD) and its correlation with risk factors. Liver biopsy was done and H & E and Masson's Trichrome stain slides were examined to evaluate the grade and stage of NAFLD. Scoring and semiquantitative assessment of steatosis and NAFLD severity was done according to Kleiner scale known as NAFLD activity score (NAS). The results of Pearson correlation showed only BMI and triglyceride level significantly correlated with NAS score. The results of Spearman's rank correlation showed that BMI, central obesity, triglyceridaemia and age significantly correlated with staging of fibrosis. The results of multiple regression analysis showed that variation of NAS depend on BMI and triglyceride level. The study also revealed that risk factors contributed about 29% risk for the occurrence of non alcoholic steatohepatitis.

Antioxidant associated chemoprophylaxis effect of natural spice and green vegetable on hepatotoxicity.

This is a case control and cohort study, conducted at Department of Biochemistry in FUAST, compressing 24 number of albino Wistar rats. Illicium verum (star anise) natural spice and green vegetable broccoli are used for chemo-preventive herbal treatment in relation with vitamin C antioxidant activity. Hepatotoxicity was induced in liver of model rats by giving interperitoneally single injection of 200 mg/kg bod weight (B.W) of N-nitrosodiethylamine and orally giving 1 mg/kg BW phenobarbital for 14 days during disease prorogation period. The vitamin C analysis from Illicium verum (star anise), green broccoli, orange juice, orange peel and orange pulp was done by iodometric quantitative and qualitative titration method. Rats were given compound according to their bodyweight as 1 mg/kg B.W. After 14 days (Disease Promotion and Propagation Period) and 28 days (Disease cure period) of treatment behavioral activity was monitored by locomotors activity in open field experiment, stimulatory activity in home cage and anxiolytic effects observed in light and dark apparatus and also in T maze. Behavioral activity were significantly increased in Illicium verum and green broccoli treated rats. Hematological study including hemoglobin (Hb), white blood cells (WBC), red blood cells (RBC), mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), mean corpuscular hemoglobin concentration (MCHC), red cell distribution width (RDW) and Platelets was done by abbot laboratory analyzer cell. The value of Hb and RBC was also significantly increased in star anise and broccoli treated rats, showed proper function of RBC in microcirculation. WBC was also in normal range revealed that no disease regards to bone marrow and leukemia's. The biochemical activity of rats including urea, creatinine, total protein, albumin, globulin, A/G ratio, amylase and calcium in blood serum were analyzed while, liver health or performance was also determined by LFT (liver function test). Behavioral and laboratorial variables were analyzed by using SPSS v. 20 and p-value < 0.05 was considered statistically significant. The study report noticeable significant effect of Illicium verum and broccoli on hepatotoxicity of experimental model. Recent experimental study statistical outcomes show reciprocal relationship between the consumption of vegetable diet and natural spice with the risk of Hepatotoxicity. Thus, the aim of the study is to enhance the function of star anise or illicium verum natural spice and green vegetable broccoli as an anticancer or chemoprophylaxis agent.

Prevalence and risk factors associated with human Intestinal Parasitic Infections (IPIs) in rural and urban areas of Quetta, Pakistan.

Intestinal parasitic infections (IPIs) are endemic worldwide and more prevalent in countries with unhygienic conditions. The objective of the research was to identify the prevalence of intestinal parasitic infections in rural and urban areas of Quetta, Balochistan and to check their associated risk factors including; age, gender, educational status, sanitary system and any other immunodeficiency. For this instance 204 stool samples were collected from the urban and rural population of Quetta, Balochistan. The participants with positive results for Intestinal Parasitic Infections were interviewed using close-ended questionnaire. From the findings of this study, it has been revealed that prevalence of Intestinal parasitic infections in rural and urban areas was 21%. Males were found more prevalent (66%) as compared to females (34%) due to higher risk of contacting to outer environment. The prevalence was higher in rural areas (23%). The most prevalent intestinal parasite was Entamoeba histolytica (48%). Other prevailing parasites were Hymenolepis nana (26%), Giardia Intestinalis (17%), Trichomonas hominis (5%) and Trichuris trichiura (5%). The majority of patients were having lower socio-economic (52%) and educational status (48%). Educational status of 48% patients was primary or below primary. Most of the participants with positive results did not have hand washing habit (62%) and didn't have the closed sanitary system (71%). The intestinal parasitic infections were more prevalent among children aged from 1-10 (33%). This may be a result of poor hygiene in children. The study will contribute to lower down the prevalence in the studied areas by the application of different preventive measures in future.

In vitro up-regulation of HLA-G using dexamethasone and hydrocortisone in first-trimester trophoblast cells of women experiencing recurrent miscarriage.

The trophoblast cells at the maternal-fetal interface express an unusual combination of human leukocyte antigen (HLA)-C, HLA-E and HLA-G. Altered expression of HLA-G on the extravillous cytotrophoblast has been implicated in the etiology of recurrent miscarriages (RMs). We have assessed HLA-G expression in extravillous cytotrophoblast in cell cultures prepared from RM patients and compared with those of first-trimester voluntarily terminated normal pregnancies (control). Glucocorticoids, dexamethasone and hydrocortisone were examined for their role in modulation of the HLA-G expression. HLA-G promoter and 3'UTR variants were investigated for their effect on the transcription of HLA-G. Cultured cytotrophoblast cells from the first-trimester RM patients were treated with dexamethasone and hydrocortisone (dose concentration 0-1000 ng/ml). HLA-G gene transcription was determined by semiquantitative and quantitative real-time polymerase chain reaction (RT-PCR), while protein expression was determined by a specific enzyme-linked immunosorbent assay (ELISA), flow cytometry and western blot analyses. HLA-G polymorphisms were detected by PCR and/or sequence-based typing. Low level of HLA-G was observed in untreated trophoblast cells obtained from RM patients as compared with controls. Upon treatment with glucocorticoids, the expression of HLA-G in these cells was up-regulated in a dose-dependent manner (P < 0.05), with no change in cellular proliferation and viability. There was no significant association between HLA-G polymorphism in RM patients and controls. HLA-G is minimally expressed in cultured trophoblast cells of RM patients. It can be up-regulated upon exposure with both dexamethasone and hydrocortisone. Glucocorticoids have the potential to modulate HLA-G expression in vitro, and can be further examined for their therapeutic applicability in RM.

The challenging airway: Tracheal agenesis in the newborn.

A preterm female presented with severe respiratory distress in the delivery room and was found to have tracheal agenesis with a tracheoesophageal fistula and a congenital heart defect. Tracheal agenesis is uncommon and is often associated with other congenital abnormalities. Although there are surgical options for repair, mortality remains high.

Assessment of aquatic macro-invertebrates communities and water quality parameters of River Zhob, Balochistan, Pakistan.

Environmental stress caused by pollution is often assessed by diversity of macro-invertebrate species in specific aquatic habitat. To find out seasonal fluctuations in various macro-invertebrates communities and different water quality parameters of River Zhob, a research trial was conducted on River Zhob, Balochistan. Samples of macro-invertebrates and water were taken from four different stations of River Zhob. A total 18 taxa of various macro-invertebrates were identified from the area. Phylum Arthropoda constitute 94.8% of the total population followed by Mollusca (3.6%) and Annelida (1.4%). A large number of arthropods were belonged to order Diptera (1148), while the order Trichoptera was stood second with respect to macro-invertebrate´s number (441). The maximum numbers of macro-invertebrates were observed in the month of January. All physico-chemical parameters of River Zhob such as air temperature, water temp, pH, dissolved oxygen (DO) and total dissolved solids (TDS) were within the range, suitable for the healthy growth of macro-invertebrates. Diversified populations of various macro-invertebrates confirm good ecological condition of environment and water in the studied site especially ample concentration of DO in River. The documented data on macro-invertebrates in studied site will provide a baseline for future research.

Rhus coriaria extracts inhibit quorum sensing-related virulence and biofilm production in drug-resistant Pseudomonas aeruginosa recovered from burn wounds.

Objectives: Numerous studies have confirmed sumac's ability to inhibit pathogens and even eradicate chronic drug-resistant infections. Current research was conducted to demonstrate the action of various sumac extracts at sub-inhibitory concentrations in modulating pathogen-related characteristics instead of killing them. Materials and Methods: The influence of sumac extracts on the quorum sensing dependent virulence of multidrug-resistant isolates of Pseudomonas aeruginosa recovered from burn wounds was considered by detecting the effect on biofilm development, various virulence factors, and expression of bacterial exotoxin A and quorum sensing related genes. Results: Experiments to characterize and measure sumac extract's impact on the P. aeruginosa growth, biofilm, exoproteases, pyocyanin, motility, and the quorum sensing networks revealed that all studied characteristics were reduced by concentrations below inhibition without affecting bacterial growth. Furthermore, the expression of exotoxin A, rhl, and las glucons was declined or even inhibited by lower levels of sumac fruit fractions. Conclusion: The findings revealed that sumac fights infections either by its inhibitory effect on the bacterial cells or by reducing bacterial signaling and virulence by disruption of the bacterial signal system.

Effect of glutathione on pre and post-freezing sperm quality of Indian red jungle fowl (Gallus gallus murghi).

During cryopreservation sperm encounter oxidative stress due to higher production of ROS molecules and insufficient natural antioxidant defence system. Therefore, present study was designed to identify the effects of various glutathione (GSH) concentrations on Indian red jungle fowl (Gallus gallus murghi) sperm quality and fertility pre-freezing and post-thaw incubation hours. Semen was collected from eight cocks and qualified semen ejaculates having motility >65% were pooled after initial evaluation. Semen was divided in four aliquots, diluted with red fowl extender (1:5) at 37 °C having GSH 0 mM (control), 0.1 mM, 0.5 mM and 1.0 mM, cryopreserved and stored at (-196 °C) in liquid nitrogen. Semen quality was assessed at post dilution, cooling, equilibration, and freeze-thawing at 0, 2 and 4 h of incubation at 37 °C. Sperm motility, plasma membrane integrity, viability, acrosome integrity and mitochondrial function were recorded highest (P < 0.05) with 0.5 mM GSH in extender at post-dilution, cooling, equilibration, freeze-thawing and 0, 2 and 4 h of incubation. Lipid peroxidation in sperm and seminal plasma were recorded lowest (P < 0.05) with 0.5 mM GSH during cryopreservation stages and post-thawing incubation. Moreover, antioxidant activities (total antioxidant potential and free radical scavenging capacity) were recorded highest (P < 0.05) in extender having 0.5 mM GSH. Fertility rates were recorded higher (P < 0.05) with 0.5 mM GSH compared to control. It is concluded that 0.5 mM GSH in extender improves sperm structural (sperm viability, plasma membrane integrity and acrosome integrity), functional integrity (motility, mitochondrial function) and fertility parameters of Indian red jungle fowl through enriching antioxidant potential and ameliorating the oxidative stress.

Effect of dimethylformamide on sperm quality and fertilizing ability of Indian red jungle fowl (Gallus gallus murghi).

The present study investigates the efficacy of dimehtlyformamide (DMF) as a permeable cryoprotectant and its effect on quality and fertility of Indian red jungle fowl sperm. Semen was collected from eight mature roosters, pooled, divided into five aliquots and diluted with red fowl extender having DMF (0%, 4%, 6%, 8% and 10%). Diluted semen samples were cooled from 37 °C to 4 °C, 20% glycerol added to control (0% DMF), equilibrated for 10 min and filled in 0.5 mL French straws, kept over liquid nitrogen vapors for 10 min and plunged into liquid nitrogen. Sperm motility, plasma membrane functionality, viability and acrosome integrity were assessed at post dilution, cooling, equilibration and freeze-thawing stage of cryopreservation. Cryopreservation stages had negative effects (P < 0.05) on semen quality parameters. Percentages of sperm motility, plasma membrane functionality, viability and acrosome integrity were recorded highest in extender having 8% DMF at post-dilution, cooling, equilibration and freeze-thawing stage. Fertility results after artificial insemination were recorded higher (P < 0.05) with 8% DMF compared to 20% glycerol. Dimehtlyformamide (8%) in red fowl extender improves the post thaw semen quality and fertility in Indian red jungle fowl and can be used effectively to avoid the contraceptive effects of glycerol.

Identification and characterization of Salmonella spp. from samples of broiler farms in selected districts of Bangladesh.

BACKGROUND AND AIM: Salmonella spp. are an important group of pathogens responsible for human and animal diseases. This study aimed to estimate the prevalence and identify and characterize of Salmonella spp. isolated from broiler farms of Gazipur, Tangail, and Dhaka districts of Bangladesh. This study also evaluated the difference of Salmonella positivity status between two groups of farms, good practices adapted in broiler rearing at the project intervened farms, and non-project intervened traditional farms. MATERIALS AND METHODS: A total of 352 samples including 128 cloacal swabs, 32 whole carcasses, 64 feed, 64 water, and 64 attendants' hand rinses were collected through convenient sampling technique from 16 poultry food safety project of Food and Agricultural Organization of United Nations Bangladesh intervened farms and other 16 non-project intervened farms in the same location. Various cultural based techniques and biochemical methods were employed for the estimation of prevalence, isolation, and identification of Salmonella spp. which was further evaluated by polymerase chain reaction. Antimicrobial susceptibility test using disk diffusion methods and serogrouping by slide agglutination test was accomplished for additional characterization. RESULTS: Among the samples, an overall prevalence of Salmonella spp. was 31.25% (110/352) (95% confidence interval [CI]=26.44-36.38%). However, the prevalence of Salmonella spp. was 24.43% (43/176) (95% CI=18.28-31.47) in project intervened farms and 38.07% (67/176) (95% CI=30.87-45.68%) in non-intervened farms. Among the 110 isolates, 31.82% (35/110) were fitted under serogroup B, and the rest of the isolates 75 (68.18%) under serogroup D. Of 110 isolates, 82.72%, 77.27%, 81.82%, and 79.09% were susceptible to ciprofloxacin, gentamycin, norfloxacin, and streptomycin, respectively. In addition, 81.82% and 80% isolates were resistant to erythromycin and tetracycline, respectively. Isolated Salmonella spp. presented moderate resistance to both amoxicillin and azithromycin. Alarmingly, 80.91% (89/110) isolates were shown to be multidrug-resistant Salmonella spp. CONCLUSION: The study has presented a significant variation of the prevalence of Salmonella spp. between project intervened and non-project intervened farms, and this indicates project intervened farms are comparatively safer than the non-intervened farms considering public health and food safety grounds. This research outcome also has highlighted a substantial proportion of poultry origin multidrug resistance Salmonella spp. is a potential source of public health hazards. In this regard, proper awareness creation and motivational activities on good agriculture practices in poultry rearing and maintaining good personal hygiene at the farmers' level are warranted through participatory training.

Occurrence of Campylobacter spp. in Selected Small Scale Commercial Broiler Farms of Bangladesh Related to Good Farm Practices.

Poultry origin Campylobacter is considered as one of the leading causal agents of human foodborne illness. This study was conducted to estimate the occurrence, molecular identification, and antimicrobial resistance (AMR) of Campylobacter species from the broiler farms in Bangladesh. Samples (352) were collected from 32 farms and comprised of 128 cloacal swab, 64 feed, 64 drinking water, 64 attendants' hand rinsed water, and 32 whole carcasses. All samples were tested for the presence of Campylobacter via cultural, biochemical, and PCR. The AMR was determined via the disc diffusion method. An overall occurrence of Campylobacter spp. was estimated as 26.4%. The level of Campylobacter contamination was found to be higher in conventional farms (36.4%) than the good practice farms (16.5%) including all sample categories (p = 0.000). Of 93 isolates, 67.74% and 32.26% were confirmed as C. jejuni and C. coli respectively, of which 34.92% C. jejuni, and 30% C. coli were shown to be multidrug-resistant. A significant occurrence of Campylobacter contamination in broiler farms with multidrug resistant patterns might be cogitated as serious food safety and public health concern linking to poultry food chain. A risk reduction approach through good farming practices targeting the prudent use of antimicrobials for broiler production is thus necessitated.

A Severe Leaf Curl Disease on Chilies in Pakistan is Associated with Multiple Begomovirus Components.

Chili leaf curl disease is an important limiting factor for chilies in the Indian subcontinent and is associated with begomoviruses (2,3). Field visits of commercially grown chilies in 2007 and 2008 identified a very severe leaf curl disease with 100% incidence and severe yield losses at several locations in Faisalabad District, Punjab, Pakistan. Symptoms of the disease were severe leaf curl with cup-shaped, upward curling, yellowing, and stunted plant growth. To identify the causative agent, symptomatic plant samples were collected from 10 locations and total DNA was extracted with a cetyltrimethylammoniumbromide method. Universal primers that amplify begomovirus DNA A, Begomo F (ACGCGT GCCGTGCTGCTGCCCCCATTGTCC) and Begomo R (ACGCGT ATGGGCTGYCGAAGTTSAGAC), were used in PCR. A PCR product of the expected size (approximately 2.8 kb) was amplified from all symptomatic plants, and no amplification products of the expected size were obtained from healthy or asymptomatic plants, confirming the association of a begomovirus with the disease. When used as a probe in Southern hybridization, a full-length clone of Cotton leaf curl Multan virus detected characteristic viral DNA forms and further confirmed the association of begomovirus with the disease. To identify the begomovirus associated with the disease at the species level, the PCR product obtained with universal primers was cloned into a TA cloning vector and five clones were partially sequenced. Comparison of the DNA sequence of the coat protein gene of clones resulted in identification of two begomovirus species; the first clone (GenBank Accession No. FN179278) showed 94% DNA sequence identity with the bipartite virus Tomato leaf curl New Delhi virus (ToLCNDV), while the second clone (GenBank Accession No. FN252382) showed 97% sequence identity with the monopartite begomovirus Chili leaf curl Multan virus (ChLCMV). Rolling circle amplification was used to clone the DNA B of ToLCNDV from samples showing typical chili leaf curl disease symptoms. Sequence analysis of the DNA B clone (GenBank Accession No. FN179276) in the intergenic region and movement protein gene showed 94% identity with ToLCNDV DNA B. To confirm association of betasatellite with the disease, universal primers (ß-01 and ß-02) were used for the amplification of betasatellite by PCR (1). DNA sequence analysis of betasatellite (GenBank Accession No. FN179279) associated with the disease showed 90% identity with the previously cloned chili leaf curl betasatellite (1). No evidence for the association of alphasatellite with the disease was found. The multiple infection of a begomovirus complex, consisting of a monopartite virus with a bipartite begomovirus where DNA B is maintained in the presence of betasatellite, presents yet another example of rapid changes in begomovirus complexes that infect important crops in the region. The appearance of chili leaf curl disease at a higher incidence and symptom severity may be attributed to the synergistic action of geminivirus disease complex comprising a monopartite and a bipartite begomovirus along with DNA betasatellite. High yield losses resulting from this severe disease threatens chili cultivation in the area and is forcing farmers to grow other crops. References: (1) R. W. Briddon et al. Virology 312:106, 2003. (2) B. Chattopadhyay et al. Arch Virol. 10:7, 2007. (3) M. Hussain et al. Plant Pathol. 53:794, 2004.

Low concentrations of local honey modulate Exotoxin A expression, and quorum sensing related virulence in drug-resistant Pseudomonas aeruginosa recovered from infected burn wounds.

OBJECTIVES: Honey's ability to kill microorganisms and even eradication of chronic infections with drug-resistant pathogens has been documented by numerous studies. The present study is focused on the action of honey in its sub-inhibitory levels to impact on the pathogens coordinated behaviors rather than killing them. MATERIALS AND METHODS: The impact of local honey on the quorum sensing related virulence of multidrug resistant Pseudomonas aeruginosa burn isolates was investigated by detection its effect on the virulence, biofilm formation and expression of quorum sensing related and exotoxin A genes. RESULTS: Experiments to characterise and quantify the impact of honey on the P. aeruginosa quorum sensing networks showed that the expression of exotoxin A ( ETA), las and rhl glucons reduced by low concentrations of honey including the associated virulence factors. CONCLUSION: Our results indicated that honey fights infections either by its bactericidal components which vigorously kill cells or by weakening bacterial coordination and virulence through interruption of quorum sensing system.