Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Results 1 - 20 de 164
Filter
1.
Biol Pharm Bull ; 47(1): 175-186, 2024 Jan 13.
Article in English | MEDLINE | ID: mdl-38092386

ABSTRACT

Autophagy and M1 macrophage polarization play important roles in the regulation of inflammation in atopic dermatitis (AD). Dictamnine is one of the main ingredients in Cortex Dictamni, a widely used traditional Chinese medicine for the treatment of dermatitis. In the present study, we investigated the anti-inflammatory effects of dictamnine on AD like skin lesions and M1 macrophage polarization. A 2,4-dinitrofluorobenzene (DNFB) triggered AD like skin lesions models in mice was established to identify the ameliorative effects of dictamnine on AD in vivo. In addition, an M1 macrophage polarization model was co-stimulated by lipopolysaccharide (LPS) and interferon-γ (IFN-γ) using phorbol myristate acetate (PMA) differentiated THP-1 cells, to investigate the effect of dictamnine on promoting autophagy and inhibiting inflammatory factor release. Dictamnine suppressed DNFB-induced skin inflammation by inhibiting M1 macrophage polarization, up-regulating the expression of microtubule-associated protein 1A/1B-light chain 3 (LC3) expression, and promoting macrophage autophagy at inflammatory sites. Dictamnine also could reduce the release of interleukin-1ß (IL-1ß), tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6), monocyte chemotactic protein-1 (MCP-1), and interleukin-8 (IL-8), and down-regulate the mRNA expression of these genes in LPS-IFN-γ triggered M1 polarized macrophages. Dictamnine ameliorates AD like skin lesions by inhibiting M1 macrophage polarization and promoting autophagy. Hence, dictamnine is expected to be a potential therapeutic candidate for AD.


Subject(s)
Dermatitis, Atopic , Quinolines , Mice , Animals , Dermatitis, Atopic/chemically induced , Dermatitis, Atopic/drug therapy , Dermatitis, Atopic/metabolism , Dinitrofluorobenzene , Lipopolysaccharides , Inflammation/metabolism , Macrophages/metabolism , Autophagy , Interferon-gamma/genetics , Interferon-gamma/metabolism
2.
Plant Dis ; 2024 Apr 10.
Article in English | MEDLINE | ID: mdl-38598853

ABSTRACT

The cultivated aromatic medicinal herb Atractylodes lancea (Thunb.) DC. is widely used in the pharmaceuticals, nutraceuticals, and cosmetics industries (Na-Bangchang et al. 2014; Zhan et al. 2023). Huanggang in Hubei Province is a major production area for A. lancea (Huang et al. 2022; Wang et al. 2023). In April 2023, more than two-thirds of the surveyed plant leaves in this region exhibited virus-like symptoms, such as curling and mosaic patterns. To identify the underlying cause, 80 symptomatic plant leaf samples were collected from four fields (20 leaves per field) in this region and pooled for virome analysis. Total RNA, including ribosomal RNA, was extracted from the pooled samples using the Plant RNA Extraction Mini Kit (Onrew Biotech, Guangdong, China), for sequencing library construction. The Illumina NovaSeq 6000 platform was used to sequence the library and generate 150 bp paired-end reads. After processing the raw data with Trimmomatic software, a total of 44,354,650 high-quality clean reads were obtained. The clean reads were aligned against ribosomal RNA using BWA software (v0.7.17) to avoid interference and eliminate corresponding sequences. After removing potential contamination, contig assembly of the clean reads was performed using Megahit software (v1.2.9). The resulting contigs were compared with the virus NT database using the BLASTn program. Sequence pairwise comparison revealed 8 contigs (574 nt to 2243 nt) with identities ranging from 81.88% to 90.77% with Atractylodes mild mottle virus (AMMV, NC_027924.1, Lim et al., 2015). Additionally, contigs mapped to Carlavirus, Pelarspovirus, and other plant viruses in our virome dataset had low coverage and pairwise identity (less than 70%), which need to be further investigated. The presence of AMMV was confirmed by aligning the clean reads to the reference sequence (NC_027924.1) using BWA and SAMtools software, resulting in a consensus sequence (8024 nt) with gaps. DNA extraction from the pooled samples was performed using the Rapid Universal Genomic DNA Extraction Kit (Simgen, Zhejiang, China). Two pairs of specific primers, 3399F (5'-AAAGAAGAACCTCCTGATACGG-3')/5924R (5'-TGAACCTGATTCTCTTGGC-3') and 1830F (5'- CTCAGGAAATCCCAATGC -3')/3640R(5'-TTTCCCAATGTTCTTCGGG-3'), were designed to amplify the complete gene sequences of polymerase and coat protein (CP), based on the consensus sequence. The PCR products with the lengths of 2521 bp and 1814 bp were cloned into the pMD18-T vector (Takara Biotech, Dalian, China) for sequencing. The BLASTn analysis showed that the polymerase and CP gene sequences shared an identity of 94.51% (1929/2041 nt) and 88.41% (1419/1605 nt) with the AMMV isolate (NC_027924.1), respectively. The sequences have been deposited in GenBank under the accession numbers OR544810 and OR544811. We collected leaves from 32 A. lancea plants (16 symptomatic and 16 asymptomatic) in the fields. RT-PCR was conducted using CPF (5'-CTGCGAATATGAAAGTGC-3') and CPR (5'-GGTGAGCTTGTCTGTTAGG-3') primers, which were designed targeting a 527bp fragment of the CP gene (OR544811). Amplicons of the expected size (527bp) were detected in 24 plants (11 symptomatic and 13 asymptomatic), three of which were sequenced by Sanger sequencing, showing a 100% match to OR544811. These findings indicate that AMMV is prevalent in the major production area of A. lancea. Further research is needed to better characterize the potential risks of AMMV to A. lancea cultivation in China as well as other countries.

3.
J Pak Med Assoc ; 74(7): 1355-1357, 2024 Jul.
Article in English | MEDLINE | ID: mdl-39028070

ABSTRACT

Hepatic sinus obstruction syndrome (HSOS) is easy to be misdiagnosed or missed, and there is no unified and effective treatment for it. A patient was considered to have Budd-Chiari syndrome. He underwent a transjugular liver biopsy, and pathological examination revealed HSOS without liver cirrhosis. After the failure of anticoagulation therapy, he successfully received a transjugular intrahepatic portosystemic shunt (TIPS). After discharge, he was followed-up for four years with a good prognosis. G. segetum-induced HSOS can be easily overlooked, especially in patients with underlying liver diseases. When medical therapy fails, TIPS can control ascites and portal hypertension, and the long-term prognosis is optimistic.


Subject(s)
Liver Diseases, Alcoholic , Portasystemic Shunt, Transjugular Intrahepatic , Humans , Male , Liver Diseases, Alcoholic/complications , Hepatic Veno-Occlusive Disease/diagnosis , Hepatic Veno-Occlusive Disease/complications , Budd-Chiari Syndrome/complications , Budd-Chiari Syndrome/diagnosis , Budd-Chiari Syndrome/etiology , Middle Aged
4.
J Cell Mol Med ; 27(22): 3478-3490, 2023 11.
Article in English | MEDLINE | ID: mdl-37610095

ABSTRACT

Breast cancer is a highly prevalent malignancy with the first morbidity and the primary reason for female cancer-related deaths worldwide. Acid ground nano-realgar processed product (NRPP) could inhibit breast cancer cell proliferation and induce autophagy in our previous research; however, the underlying mechanisms are still unclear. Therefore, this research aimed to verify whether NRPP induces breast cancer mitophagy and explore the mitophagy-mediated mechanism. Primarily, rhodamine-123 assay and transmission electron microscopy were applied to detect mitochondrial membrane potential (MMP) and ultrastructural changes in the MDA-MB-435S cells, respectively. Mito-Tracker Green/Lyso-Tracker Red staining, western blot, immunofluorescence and RT-PCR were used to explore molecular mechanisms of NRPP-induced mitophagy in vitro. MDA-MB-435S breast cancer xenograft models were established to assess the activity and mechanisms of NRPP in vivo. Our results showed that NRPP decreased MMP and increased autophagosome numbers in MDA-MB-435S cells and activated mitophagy. Furthermore, mitophagy was consolidated because mitochondria and lysosomes colocalized phenomenology were observed, and the expression of LC3II/I and COXIV was upregulated. Additionally, we found the p53/BNIP3/NIX pathway was activated. Finally, NRPP inhibited tumour growth and downregulated the levels of TNF-α, IL-1ß and IL-6. Necrosis, damaged mitochondria and autophagosomes were observed in xenograft tumour cells, and proteins and mRNA levels of LC3, p53, BNIP3 and NIX were increased. Overall, NRPP inhibited MDA-MB-435S cell proliferation and tumour growth by inducing mitophagy via the p53/BNIP3/NIX pathway. Thus, NRPP is a promising candidate for breast cancer treatment.


Subject(s)
Breast Neoplasms , Mitophagy , Humans , Female , Mitophagy/genetics , Tumor Suppressor Protein p53/genetics , Tumor Suppressor Protein p53/metabolism , Breast Neoplasms/drug therapy , Breast Neoplasms/metabolism , Autophagy , Mitochondria/metabolism , Mitochondrial Proteins/metabolism , Membrane Proteins/genetics , Proto-Oncogene Proteins/metabolism
5.
J Physiol ; 601(18): 4105-4120, 2023 09.
Article in English | MEDLINE | ID: mdl-37573529

ABSTRACT

An interlude of dark exposure for about 1 week is known to shift excitatory/inhibitory (E/I) balance of the mammalian visual cortex, promoting plasticity and accelerating visual recovery in animals that have experienced cortical lesions during development. However, the translational impact of our understanding of dark exposure from animal studies to humans remains elusive. Here, we used magnetic resonance spectroscopy as a probe for E/I balance in the primary visual cortex (V1) to determine the effect of 60 min of dark exposure, and measured binocular combination as a behavioural assay to assess visual plasticity in 14 normally sighted human adults. To induce neuroplastic changes in the observers, we introduced 60 min of monocular deprivation, which is known to temporarily shift sensory eye balance in favour of the previously deprived eye. We report that prior dark exposure for 60 min strengthens local excitability in V1 and boosts visual plasticity in normal adults. However, we show that it does not promote plasticity in amblyopic adults. Nevertheless, our findings are surprising, given the fact that the interlude is very brief. Interestingly, we find that the increased concentration of the excitatory neurotransmitter is not strongly correlated with the enhanced functional plasticity. Instead, the absolute degree of change in its concentration is related to the boost, suggesting that the dichotomy of cortical excitation and inhibition might not explain the physiological basis of plasticity in humans. We present the first evidence that an environmental manipulation that shifts cortical E/I balance can also act as a metaplastic facilitator for visual plasticity in humans. KEY POINTS: A brief interlude (60 min) of dark exposure increased the local concentration of glutamine/glutamate but not that of GABA in the visual cortex of adult humans. After dark exposure, the degree of the shift in sensory eye dominance in favour of the previously deprived eye from short-term monocular deprivation was larger than that from only monocular deprivation. The neurochemical and behavioural measures were associated: the magnitude of the shift in the concentration of glutamine/glutamate was correlated with the boost in perceptual plasticity after dark exposure. Surprisingly, the increase in the concentration of glutamine/glutamate was not correlated with the perceptual boost after dark exposure, suggesting that the physiological mechanism of how E/I balance regulates plasticity is not deterministic. In other words, an increased excitation did not unilaterally promote plasticity.


Subject(s)
Glutamine , Visual Cortex , Animals , Humans , Adult , Visual Cortex/physiology , Dominance, Ocular , Neuronal Plasticity/physiology , Sensory Deprivation/physiology , Mammals
6.
J Clin Immunol ; 43(5): 989-998, 2023 07.
Article in English | MEDLINE | ID: mdl-36877313

ABSTRACT

PURPOSE: The first step in diagnosing hemophagocytic lymphohistiocytosis (HLH) is to suspect its presence and then order the appropriate diagnostic tests. The development of screening procedures for HLH could facilitate early diagnosis. In this study, we evaluated the utility of fever, splenomegaly, and cytopenias as screening criteria for identifying pediatric HLH at an early stage, built a screening model using commonly measured laboratory parameters, and developed a step-wise screening procedure for pediatric HLH. METHODS: The medical records of 83,965 pediatric inpatients, including 160 patients with HLH, were collected retrospectively. The utility of fever, splenomegaly, hemoglobin level, and platelet and neutrophil counts at hospital admission as screening criteria for HLH was evaluated. For HLH patients who might be missed by screening based on the presence of fever, splenomegaly, and cytopenias, a screening model using common laboratory parameters was developed. Following that, a three-step screening procedure was then developed. RESULTS: The criteria of cytopenias affecting two or more lineages plus fever or splenomegaly had a sensitivity of 51.9% and a specificity of 98.4% for identifying HLH in pediatric inpatients. Our screening score model comprises six parameters: splenomegaly, platelet count, neutrophil count, albumin level, total bile acid level, and lactate dehydrogenase level. The use of the validation set had a sensitivity of 87.0% and a specificity of 90.6%. A three-step screening procedure has been developed: Step 1: Is fever or splenomegaly present? (Yes: risk for HLH should be considered, go to Step 2; No: less likely HLH); Step 2: Are cytopenias affecting at least two lineages? (Yes: consider HLH; No: go to Step 3); Step 3: Calculate the screening score. Is the sum of the score greater than 37? (Yes: consider HLH; No: less likely HLH). The overall sensitivity and specificity of the three-step screening procedure were 91.9% and 94.4%, respectively. CONCLUSION: A significant proportion of pediatric HLH patients present at the hospital without having all three symptoms: fever, splenomegaly, and cytopenias. Our three-step screening procedure, utilizing commonly available clinical and laboratory parameters, can effectively identify pediatric patients who may be at high risk for HLH.


Subject(s)
Anemia , Leukopenia , Lymphohistiocytosis, Hemophagocytic , Thrombocytopenia , Humans , Child , Lymphohistiocytosis, Hemophagocytic/diagnosis , Splenomegaly/diagnosis , Retrospective Studies , Fever/diagnosis , Fever/etiology
7.
J Clin Immunol ; 43(8): 1997-2010, 2023 11.
Article in English | MEDLINE | ID: mdl-37653176

ABSTRACT

Hemophagocytic lymphohistiocytosis (HLH) is a life-threatening hyperinflammatory syndrome characterized by excessive activation of the immune system, along with uncontrolled proliferation of activated macrophages and lymphocytes. The clinical features of HLH often overlap with the clinical features of other severe inflammatory conditions such as sepsis, hindering accurate and timely diagnosis. In this study, we performed a data-independent acquisition mass spectrometry-based plasma proteomic analysis of 33 pediatric patients with HLH compared with four control groups: 39 healthy children, 43 children with sepsis, 39 children hospitalized in the pediatric intensive care unit without confirmed infections, and 21 children with acute Epstein-Barr virus infection. Proteomic comparisons between the HLH group and each of the control groups showed that HLH was characterized by alterations in complement and coagulation cascades, neutrophil extracellular trap formation, and platelet activation pathways. We identified eight differentially expressed proteins in patients with HLH, including plastin-2 (LCP1), vascular cell adhesion protein 1, fibrinogen beta chain, fibrinogen gamma chain, serum amyloid A-4 protein, extracellular matrix protein 1, apolipoprotein A-I, and albumin. LCP1 emerged as a candidate diagnostic marker for HLH with an area under the curve (AUC) of 0.97 in the original cohort and an AUC of 0.90 (sensitivity = 0.83 and specificity = 1.0) in the validation cohort. Complement C1q subcomponent subunit B was associated with disease severity in patients with HLH. Based on comparisons with multiple control groups, this study provides a proteomic profile and candidate biomarkers of HLH, offering researchers novel information to improve the understanding of this condition.


Subject(s)
Epstein-Barr Virus Infections , Lymphohistiocytosis, Hemophagocytic , Sepsis , Humans , Child , Lymphohistiocytosis, Hemophagocytic/diagnosis , Epstein-Barr Virus Infections/diagnosis , Critical Illness , Proteomics , Herpesvirus 4, Human , Sepsis/diagnosis , Biomarkers , Complement Factor B , Fibrinogen
8.
J Med Virol ; 95(10): e29173, 2023 10.
Article in English | MEDLINE | ID: mdl-37822119

ABSTRACT

The impact of hepatitis B virus (HBV) infection on the progression of coronavirus disease 2019 (COVID-19) disease remains controversial. We aimed to investigate whether pre-existing chronic HBV (CHB) infection and therapy with anti-HBV nucleos(t)ide analogs (NAs) influence the clinical presentation of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) Omicron variant infection. In this study, clinical information was collected via a questionnaire from patients with COVID-19, and their clinical symptoms were quantitatively assessed for comparative analyses. Additionally, hepatitis B-related laboratory data were collected for CHB patients. Propensity score matching (PSM) was used to minimize confounding biases. A total of 785 patients with COVID-19 were included in the cohort, of which 387 were identified as being infected with CHB infection and they were categorized as being in the immune control or clearance phase. After PSM, the CHB group (n = 222) had a shorter duration of fever and disease course, milder clinical symptoms, and lower incidence of pneumonia than the non-CHB group (n = 222) after Omicron variant infection (p < 0.05). After the adjustment of confounding factors, CHB patients showed a lower risk of prolonged fever, severe clinical symptoms, and pneumonia (p < 0.05). However, there were no statistically significant differences in the clinical symptoms and incidence of pneumonia between CHB patients who received and did not receive NAs, or CHB patients who received tenofovir disoproxil fumarate and entecavir (p > 0.05). In conclusion, our findings suggest that the crosstalk of anti-HBV immunity may contribute to the alleviated symptoms of SARS-CoV-2 Omicron variants infection in the CHB patients, independent of anti-HBV NA therapy.


Subject(s)
COVID-19 , Hepatitis B, Chronic , Humans , Hepatitis B, Chronic/complications , Hepatitis B, Chronic/drug therapy , Hepatitis B, Chronic/diagnosis , SARS-CoV-2 , Antiviral Agents/therapeutic use , Hepatitis B virus
9.
Hepatology ; 76(3): 564-575, 2022 09.
Article in English | MEDLINE | ID: mdl-35184318

ABSTRACT

BACKGROUND AND AIMS: Autoimmune hepatitis (AIH) is a rare and chronic autoimmune liver disease. While genetic factors are believed to play a crucial role in the etiopathogenesis of AIH, our understanding of these genetic risk factors is still limited. In this study, we aimed to identify susceptibility loci to further understand the pathogenesis of this disease. APPROACH AND RESULTS: We conducted a case-control association study of 1,622 Chinese patients with AIH type 1 and 10,466 population controls from two independent cohorts. A meta-analysis was performed to ascertain variants associated with AIH type 1. A single-nucleotide polymorphism within the human leukocyte antigen (HLA) region showed the strongest association with AIH (rs6932730: OR = 2.32; p = 9.21 × 10-73 ). The meta-analysis also identified two non-HLA loci significantly associated with AIH: CD28/CTLA4/ICOS on 2q33.3 (rs72929257: OR = 1.31; p = 2.92 × 10-9 ) and SYNPR on 3p14.2 (rs6809477: OR = 1.25; p = 5.48 × 10-9 ). In silico annotation, reporter gene assays, and CRISPR activation experiments identified a distal enhancer at 2q33.3 that regulated expression of CTLA4. In addition, variants near STAT1/STAT4 (rs11889341: OR = 1.24; p = 1.34 × 10-7 ), LINC00392 (rs9564997: OR = 0.81; p = 2.53 × 10-7 ), IRF8 (rs11117432: OR = 0.72; p = 6.10 × 10-6 ), and LILRA4/LILRA5 (rs11084330: OR = 0.65; p = 5.19 × 10-6 ) had suggestive association signals with AIH. CONCLUSIONS: Our study identifies two novel loci (CD28/CTLA4/ICOS and SYNPR) exceeding genome-wide significance and suggests four loci as potential risk factors. These findings highlight the importance of costimulatory signaling and neuro-immune interaction in the pathogenesis of AIH.


Subject(s)
Hepatitis, Autoimmune , CD28 Antigens/genetics , CTLA-4 Antigen/genetics , Genetic Predisposition to Disease , Genome-Wide Association Study , HLA Antigens , Hepatitis, Autoimmune/genetics , Humans , Polymorphism, Single Nucleotide
10.
Dev Growth Differ ; 65(9): 546-553, 2023 Dec.
Article in English | MEDLINE | ID: mdl-37963088

ABSTRACT

Research in neuroscience has greatly benefited from the development of genetic approaches that enable lineage tracing, cell type targeting, and conditional gene regulation. Recent advances in combinatorial strategies, which integrate multiple cellular features, have significantly enhanced the spatiotemporal precision and flexibility of these manipulations. In this minireview, we introduce the concept and design of these strategies and provide a few examples of their application in genetic fate mapping, cell type targeting, and reversible conditional gene regulation. These advancements have facilitated in-depth investigation into the developmental principles underlying the assembly of brain circuits, granting experimental access to highly specific cell lineages and subtypes, as well as offering valuable new tools for modeling and studying neurological diseases. Additionally, we discuss future directions aimed at expanding and improving the existing genetic toolkit for a better understanding of the development, structure, and function of healthy and diseased brains.


Subject(s)
Brain , Animals , Mice , Cell Lineage/genetics , Phenotype
11.
Mol Psychiatry ; 27(1): 422-435, 2022 01.
Article in English | MEDLINE | ID: mdl-34561609

ABSTRACT

The mammalian brain is composed of a large number of highly diverse cell types with different molecular, anatomical, and functional features. Distinct cellular identities are generated during development under the regulation of intricate genetic programs and manifested through unique combinations of gene expression. Recent advancements in our understanding of the molecular and cellular mechanisms underlying the assembly, function, and pathology of the brain circuitry depend on the invention and application of genetic strategies that engage intrinsic gene regulatory mechanisms. Here we review the strategies for gene regulation on DNA, RNA, and protein levels and their applications in cell type targeting and neural circuit dissection. We highlight newly emerged strategies and emphasize the importance of combinatorial approaches. We also discuss the potential caveats and pitfalls in current methods and suggest future prospects to improve their comprehensiveness and versatility.


Subject(s)
Brain , Neurons , Animals , Brain/physiology , Gene Expression Regulation , Mammals/genetics , Neurons/physiology
12.
BMC Infect Dis ; 23(1): 715, 2023 Oct 23.
Article in English | MEDLINE | ID: mdl-37872485

ABSTRACT

BACKGROUND: CHF (Congenital hepatic fibrosis) is a rare hereditary disease characterized by periportal fibrosis and ductal plate malformation. Little is known about the clinical presentations and outcome in CHF patients with an extraordinary complication with biliary sepsis. Our case described a 23-year-old female diagnosed as CHF combined with biliary sepsis. Her blood culture was positive for KP (Klebsiella pneumoniae), and with a high level of CA19-9 (> 1200.00 U/ml, ref: <37.00 U/ml). Meanwhile, her imaging examinations showed intrahepatic bile duct dilatation, portal hypertension, splenomegaly, and renal cysts. Liver pathology revealed periportal fibrosis and irregularly shaped proliferating bile ducts. Whole-exome sequencing identified two heterozygous missense variants c.3860T > G (p. V1287G) and c.9059T > C (p. L3020P) in PKHD1 gene. After biliary sepsis relieved, her liver function test was normal, and imaging examination results showed no significant difference with the results harvested during her biliary sepsis occurred. CONCLUSION: The diagnosis of CHF complicated with biliary sepsis in the patient was made. Severely biliary sepsis due to KP infection may not inevitably aggravate congential liver abnormality in young patients. Our case provides a good reference for timely treatment of CHF patients with biliary sepsis.


Subject(s)
Bile Duct Diseases , Liver Diseases , Sepsis , Female , Humans , Young Adult , Liver Cirrhosis/complications , Liver Cirrhosis/genetics , Sepsis/complications
13.
BMC Pulm Med ; 23(1): 350, 2023 Sep 15.
Article in English | MEDLINE | ID: mdl-37715219

ABSTRACT

BACKGROUND: Respiratory syncytial virus (RSV) infection in adults remains less recognized and understood, both socially and clinically, compared to influenza virus infection. This retrospective study aims to delineate and compare the clinical manifestations of adult RSV and influenza virus infections in the lower respiratory tract, thereby enhancing awareness of RSV lower respiratory tract infection and providing strategic insights for its prevention and treatment. METHODS: Clinical data from January 2019 to December 2020 were analyzed for 74 patients with RSV and 129 patients with influenza A/B virus lower respiratory tract infections who were admitted to respiratory or intensive care units. All patients had complete clinical data with positive IgM and negative IgG viral antibodies. Comparison parameters included onset timing, baseline data, clinical manifestations, supplementary examination results, treatment methods, and prognosis, while logistic regression was employed to ascertain the correlation of clinical features between the two patient groups. RESULTS: In comparison to the influenza group, the RSV group presented less frequently with fever at admission but exhibited a higher incidence of dyspnea and wheezing on pulmonary auscultation (P < 0.01). RSV infection was more prevalent among patients with underlying diseases, particularly chronic obstructive pulmonary disease (COPD) and demonstrated a higher probability of co-infections, most notably with Mycoplasma (P < 0.01). The RSV group had significantly higher lymphocyte counts (P < 0.01) and exhibited more incidences of pleural thickening, pulmonary fibrosis, and emphysema (P < 0.05). The use of non-invasive mechanical ventilation was more common, and hospital stays were longer in the RSV group compared to the influenza group (P < 0.05). Logistic multivariate regression analysis further revealed that age and tachypnea incidence were significantly higher in the RSV group (P < 0.05). CONCLUSION: Compared to influenza virus infection, adults with COPD are more susceptible to RSV infection. Moreover, RSV infection elevates the risk of co-infection with Mycoplasma and may lead to conditions such as pleural thickening, pulmonary fibrosis, and emphysema. The requirement for non-invasive mechanical ventilation is higher in RSV-infected patients, who also tend to have longer hospital stays. Therefore, greater awareness and preventive strategies against RSV infection are imperative.


Subject(s)
Coinfection , Emphysema , Influenza, Human , Orthomyxoviridae , Pulmonary Disease, Chronic Obstructive , Pulmonary Emphysema , Pulmonary Fibrosis , Respiratory Tract Infections , Adult , Humans , Respiratory Syncytial Viruses , Retrospective Studies , Influenza, Human/complications , Influenza, Human/epidemiology , Respiratory Tract Infections/epidemiology , Coinfection/epidemiology
14.
Environ Microbiol ; 24(8): 3420-3435, 2022 08.
Article in English | MEDLINE | ID: mdl-35170184

ABSTRACT

Botrytis cinerea is a broad-host-range necrotrophic phytopathogen responsible for serious diseases in leading crops. To facilitate infection, B. cinerea secretes a large number of effectors that induce plant cell death. In screening secretome data of B. cinerea during infection stage, we identified a phytotoxic protein (BcSSP2) that can also induce immune resistance in plants. BcSSP2 is a small, cysteine-rich protein without any known domains. Transient expression of BcSSP2 in leaves caused chlorosis that intensifies with time and eventually leads to death. Point mutations in eight of 10 cysteine residues abolished phytotoxicity, but residual toxic activity remained after heating treatment, suggesting contribution of unknown epitopes to protein phytotoxicity. The expression of bcssp2 was low during the first 36 h after inoculation and increased sharply upon transition to late infection stage. Deletion of bcssp2 did not cause statistically significant changes in lesions size on bean and tobacco leaves. Further analyses indicated that the phytotoxicity of BcSSP2 is negatively regulated by the receptor-like kinases BAK1 and SOBIR1. Collectively, our findings show that BcSSP2 is an effector protein that toxifies the host cells, but is also recognized by the plant immune system.


Subject(s)
Cysteine , Plant Diseases , Botrytis/genetics , Botrytis/metabolism , Cysteine/metabolism , Plant Diseases/genetics , Plant Immunity/genetics , Plant Leaves/genetics , Plants
15.
BMC Cancer ; 22(1): 299, 2022 Mar 21.
Article in English | MEDLINE | ID: mdl-35313857

ABSTRACT

BACKGROUND: Lung cancer is the most common malignant tumor, and it has a high mortality rate. However, the study of miRNA-mRNA regulatory networks in the plasma of patients with non-small cell lung cancer (NSCLC) is insufficient. Therefore, this study explored the differential expression of mRNA and miRNA in the plasma of NSCLC patients. METHODS: The Gene Expression Omnibus (GEO) database was used to download microarray datasets, and the differentially expressed miRNAs (DEMs) were analyzed. We predicted transcription factors and target genes of the DEMs by using FunRich software and the TargetScanHuman database, respectively. The Database for Annotation, Visualization, and Integrated Discovery (DAVID) was used for GO annotation and KEGG enrichment analysis of downstream target genes. We constructed protein-protein interaction (PPI) and DEM-hub gene networks using the STRING database and Cytoscape software. The GSE20189 dataset was used to screen out the key hub gene. Using The Cancer Genome Atlas (TCGA) and UALCAN databases to analyze the expression and prognosis of the key hub gene and DEMs. Then, GSE17681 and GSE137140 datasets were used to validate DEMs expression. Finally, the receiver operating characteristic (ROC) curve was used to verify the ability of the DEMs to distinguish lung cancer patients from healthy patients. RESULTS: Four upregulated candidate DEMs (hsa-miR199a-5p, hsa-miR-186-5p, hsa-miR-328-3p, and hsa-let-7d-3p) were screened from 3 databases, and 6 upstream transcription factors and 2253 downstream target genes were predicted. These genes were mainly enriched in cancer pathways and PI3k-Akt pathways. Among the top 30 hub genes, the expression of KLHL3 was consistent with the GSE20189 dataset. Except for let-7d-3p, the expression of other DEMs and KLHL3 in tissues were consistent with those in plasma. LUSC patients with high let-7d-3p expression had poor overall survival rates (OS). External validation demonstrated that the expression of hsa-miR-199a-5p and hsa-miR-186-5p in peripheral blood of NSCLC patients was higher than the healthy controls. The ROC curve confirmed that the DEMs could better distinguish lung cancer patients from healthy people. CONCLUSION: The results showed that miR-199a-5p and miR-186-5p may be noninvasive diagnostic biomarkers for NSCLC patients. MiR-199a-5p-KLHL3 may be involved in the occurrence and development of NSCLC.


Subject(s)
Carcinoma, Non-Small-Cell Lung/genetics , Gene Regulatory Networks , Lung Neoplasms/genetics , MicroRNAs/genetics , RNA, Messenger/genetics , Adaptor Proteins, Signal Transducing/genetics , Biomarkers, Tumor/blood , Biomarkers, Tumor/genetics , Carcinoma, Non-Small-Cell Lung/blood , Carcinoma, Non-Small-Cell Lung/pathology , Elafin/genetics , Female , Gene Expression Regulation, Neoplastic , Humans , Lung Neoplasms/blood , Lung Neoplasms/pathology , Male , MicroRNAs/blood , Microfilament Proteins/genetics , Proto-Oncogene Proteins c-akt/genetics , RNA, Messenger/blood , Signal Transduction , Up-Regulation
16.
BMC Pulm Med ; 22(1): 486, 2022 Dec 23.
Article in English | MEDLINE | ID: mdl-36564744

ABSTRACT

BACKGROUND: Lung adenocarcinoma (LUAD) is a common cancer with a bad prognosis. Numerous investigations have indicated that the metabolism of fatty acids plays an important role in the occurrence, progression, and treatment of cancer. Consequently, the objective of the current investigation was to elucidate the role and prognostic significance of genes associated with fatty acid metabolism in patients diagnosed with LUAD. MATERIALS AND METHODS: The data files were acquired from The Cancer Genome Atlas database and GSE31210 dataset. Univariate Cox and least absolute shrinkage and selection operator regression analyses were conducted to establish a prognostic risk scoring model depending on fatty acid metabolism-associated genes to predict the prognosis of patients with LUAD. pRRophetic algorithm was utilized to evaluate the potential therapeutic agents. Gene set variation analysis combined with cell-type identification based on the estimation of relative subsets of RNA transcript and single-sample gene set enrichment analysis was used to determine the association between immune cell infiltration and risk score. Tumor immune dysfunction and exclusion algorithm was employed to predict immunotherapeutic sensitivity. RESULTS: To forecast the prognosis of patients with LUAD, a risk scoring model based on five genes associated with fatty acid metabolism was developed, including LDHA, ALDOA, CYP4B1, DPEP2, and HPGDS. Using the risk score algorithm, patients were divided into higher- and lower-risk categories. Patients classified as minimal risk showed superior prognosis than those with elevated risk. In addition, individuals in the higher-risk group had a proclivity toward chemoresistance and amenable to immunotherapy. CONCLUSION: The prognostic risk scoring model aids in estimating the prognosis of LUAD patients. It may also provide new insights into LUAD carcinogenesis and therapeutic strategies.


Subject(s)
Adenocarcinoma of Lung , Lung Neoplasms , Humans , Adenocarcinoma of Lung/drug therapy , Adenocarcinoma of Lung/genetics , Lipid Metabolism , Immunotherapy , Risk Factors , Lung Neoplasms/drug therapy , Lung Neoplasms/genetics , Prognosis
17.
Plant Dis ; 2022 Aug 16.
Article in English | MEDLINE | ID: mdl-35973082

ABSTRACT

Atractylodes lancea (Thunb.) DC. is a well-known medicinal plant with high medicinal and economic value, and currently more than 6000 hectares are planted in China. Root-knot nematodes Meloidogyne hapla has been one of the most important pathogens on A. lancea. In September 2019, A. lancea plants exhibiting symptoms of severely stunting and gall formation in the roots associated with root-knot nematode (RKN; Meloidogyne spp.) were detected in a commercial production field in Yingshan, Hubei Province, China (30.96°N; 115.94° E). Females and second-stage juveniles (J2s) collected from roots had the following morphometric characteristics: females (n=20) were pear-shaped, the front part of the worm had a prominent neck, and the stylet was short and obvious. The perineal pattern of females were generally round hexagonal or round-shaped, with a squared-off dorsal arch or a rounded-off arch, some had lateral lines marked (Eisenback et al. 1980). Body length (L) = 750.49 ± 87.02 µm (578.75 - 902.65 µm), maximum body width (W) = 471.97 ± 70.95 µm (318.7 - 586.3 µm), stylet length = 15.18 ± 0.96 µm (13.52 - 17.04 µm), dorsal pharyngeal gland orifice to stylet base (DGO) = 3.07 ± 0.37 µm (2.60 - 3.80µm). The second-stage juveniles (n=20): L = 480.05 ± 42.73 µm (375.3 - 552.5 µm), stylet length =12.59 ± 1.39 µm (10.5 - 16.8 µm), tail length= 53.35 ± 1.55 µm (51.8 - 54.9 µm), hyaline tail terminus =11.45 ± 0.65 µm (10.2 - 12.1 µm). The morphological characteristics matched the original description of M. hapla (Chitwood 1949). Males were not found. Matrix code for the polytomous key proposed by Castillo (Castillo et al. 2021): Female: A23, B43, C213, D1 (A, Body length; B, Stylet length; C, The excretory pore position in the female in relation to the stylet length (EP/ST) ratio; D, Perineal pattern morphology); J2: A3, B3, C34, D324, E32, F3 (A, Body length; B, Stylet length; C, Tail length; D, Hyaline region length; E, The long tail length to the short tail length ratio; F, The long hyaline region length to the short hyaline region length ratio). The DNA, extracted from six single females, was used for species identification, and 28S rDNA D2/D3 universal primers D2A (5'ACAAGTACCGTGAGGGAAAGTTG3') and D3B (5'TCGGAAGGAACCAGCTACTA3') were used (Nunn 1992). The DNA fragment obtained showed that the amplified sequences of the D2/D3 region (GenBank Accession No. MZ 570969, 769bp) shared 100% homology with the sequences of M. hapla (MN752204.1, MN752204.1, MN752204.1). Furthermore, species-specific SCAR primers JMV1 (5'GGATGGCGTGCTTTCAAC3') and JMV hapla (5'AAAAATCCCCTCGAAAAATCCACC3') were used as described by Dong et al. (2015). PCR produced 442-bp sequences. Fragments were sequenced (GenBank Accession No. OM 864510, 442bp) and compared with available sequences on NCBI. Sequences were 99%-100% identical to the M. hapla sequences (GenBank Accession Nos. AJ421708.1, GQ130137.1 and AJ421707.1). To verify the nematode pathogenicity on A. lancea, ten RKN-free A. lancea seedlings were transplanted into plastic pots. After 21 days, the roots of eight plants were inoculated with 1,200 J2s and eggs of M. hapla that were the same isolate collected from the field per plant and two uninoculated plants were used as control. Plants were maintained in a greenhouse at 25°C and 70% relative humidity with a 12-h/12-h light/dark photoperiod. After 70 days, all inoculated plants exhibited stunting and had scarce galling on roots. This is similar to those fieldgrown plants. No galling or symptoms were observed on the control plants. The nematode reproduction factor (RF = final population/initial population) was 2.3. These results had confirmed that the root-knot nematode population on A. lancea was M. hapla. The rhizome yields and quality of the A. lancea infected by M. hapla were seriously affected, which caused severe economic losses. Moreover, the infected plants tended to be more susceptible to some bacterial and fungal diseases, such as root rot disease. To our knowledge, this is the first report of A. lancea as a new host of M. hapla in Hubei Province, China.

18.
Acta Orthop Belg ; 88(4): 685-690, 2022 Dec.
Article in English | MEDLINE | ID: mdl-36800651

ABSTRACT

To analyze the correlation between the occurrence of vertebral artery ostium stenosis (VAOS) and the severity of osteoporosis in elderly patients with atherosclerosis (AS), and disclose the physiopathologic mechanism of the correlation between VAOS and osteoporosis. 120 patients were divided into two groups. The baseline data of both groups were collected. The biochemical indicators of patients in both groups were collected. The EpiData database was established to enter all the data into the database for statistical analysis. There were significant differences in the incidence of dyslipidemia among risk factors of cardia-cerebrovascular disease (P<0.05). LDL-C, Apoa and Apob were significantly lower than the control group (P<0.05). BMD, T-value and Ca in the observation group were significantly lower than the control group, while BALP and serum phosphorus in the observation group were significantly higher than the control group (P<0.05). The more severe the VAOS stenosis, the higher the incidence of osteoporosis, and there was a statistical difference in the risk of osteoporosis among different VAOS stenosis degrees (P<0.05). Apolipoprotein A, B and LDL-C in blood lipids are important factors affecting the development of bone and artery diseases. There is a significant correlation between VAOS and the severity of osteoporosis. The pathological calcification process of VAOS has many similarities with the process of bone metabolism and osteogenesis, and shows preventable and reversible physiological characteristics.


Subject(s)
Atherosclerosis , Osteoporosis , Humans , Aged , Vertebral Artery/diagnostic imaging , Vertebral Artery/pathology , Constriction, Pathologic/pathology , Cholesterol, LDL , Atherosclerosis/complications , Atherosclerosis/epidemiology , Atherosclerosis/pathology , Osteoporosis/complications , Osteoporosis/epidemiology , Osteoporosis/pathology
19.
J Neurosci ; 40(37): 7169-7186, 2020 09 09.
Article in English | MEDLINE | ID: mdl-32801153

ABSTRACT

Conditional gene inactivation and restoration are powerful tools for studying gene functions in the nervous system and for modeling neuropsychiatric diseases. The combination of the two is necessary to interrogate specific cell types within defined developmental stages. However, very few methods and animal models have been developed for such purpose. Here we present a versatile method for conditional gene inactivation and in situ restoration through reversibly inverting a critical part of its endogenous genomic sequence by Cre- and Flp-mediated recombinations. Using this method, we generated a mouse model to manipulate Mecp2, an X-linked dosage-sensitive gene whose mutations cause Rett syndrome. Combined with multiple Cre- and Flp-expressing drivers and viral tools, we achieved efficient and reliable Mecp2 inactivation and restoration in the germline and several neuronal cell types, and demonstrated phenotypic reversal and prevention on cellular and behavioral levels in male mice. This study not only provides valuable tools and critical insights for Mecp2 and Rett syndrome, but also offers a generally applicable strategy to decipher other neurologic disorders.SIGNIFICANCE STATEMENT Studying neurodevelopment and modeling neurologic disorders rely on genetic tools, such as conditional gene regulation. We developed a new method to combine conditional gene inactivation and restoration on a single allele without disturbing endogenous expression pattern or dosage. We applied it to manipulate Mecp2, a gene residing on X chromosome whose malfunction leads to neurologic disease, including Rett syndrome. Our results demonstrated the efficiency, specificity, and versatility of this new method, provided valuable tools and critical insights for Mecp2 function and Rett syndrome research, and offered a generally applicable strategy to investigate other genes and genetic disorders.


Subject(s)
Gene Targeting/methods , Methyl-CpG-Binding Protein 2/metabolism , Phenotype , Rett Syndrome/genetics , Animals , DNA Nucleotidyltransferases/genetics , DNA Nucleotidyltransferases/metabolism , Germ-Line Mutation , Integrases/genetics , Integrases/metabolism , Male , Methyl-CpG-Binding Protein 2/genetics , Mice , Mice, Inbred C57BL , Movement , Neurons/metabolism , Neurons/physiology , Rett Syndrome/pathology
20.
BMC Cancer ; 21(1): 626, 2021 May 27.
Article in English | MEDLINE | ID: mdl-34044809

ABSTRACT

BACKGROUND: Lung cancer is one of the most lethal and most prevalent malignant tumors worldwide, and lung squamous cell carcinoma (LUSC) is one of the major histological subtypes. Although numerous biomarkers have been found to be associated with prognosis in LUSC, the prediction effect of a single gene biomarker is insufficient, especially for glycolysis-related genes. Therefore, we aimed to develop a novel glycolysis-related gene signature to predict survival in patients with LUSC. METHODS: The mRNA expression files and LUSC clinical information were obtained from The Cancer Genome Atlas (TCGA) dataset. RESULTS: Based on Gene Set Enrichment Analysis (GSEA), we found 5 glycolysis-related gene sets that were significantly enriched in LUSC tissues. Univariate and multivariate Cox proportional regression models were performed to choose prognostic-related gene signatures. Based on a Cox proportional regression model, a risk score for a three-gene signature (HKDC1, ALDH7A1, and MDH1) was established to divide patients into high-risk and low-risk subgroups. Multivariate Cox regression analysis indicated that the risk score for this three-gene signature can be used as an independent prognostic indicator in LUSC. Additionally, based on the cBioPortal database, the rate of genomic alterations in the HKDC1, ALDH7A1, and MDH1 genes were 1.9, 1.1, and 5% in LUSC patients, respectively. CONCLUSION: A glycolysis-based three-gene signature could serve as a novel biomarker in predicting the prognosis of patients with LUSC and it also provides additional gene targets that can be used to cure LUSC patients.


Subject(s)
Biomarkers, Tumor/genetics , Carcinoma, Squamous Cell/genetics , Lung Neoplasms/genetics , Warburg Effect, Oncologic , Aged , Aldehyde Dehydrogenase/genetics , Carcinoma, Squamous Cell/mortality , Carcinoma, Squamous Cell/pathology , Datasets as Topic , Female , Gene Expression Profiling , Gene Expression Regulation, Neoplastic , Hexokinase/genetics , Humans , Kaplan-Meier Estimate , Lung/pathology , Lung Neoplasms/mortality , Lung Neoplasms/pathology , Malate Dehydrogenase/genetics , Male , Middle Aged , Prognosis , Transcriptome
SELECTION OF CITATIONS
SEARCH DETAIL