A novel deep-benthic sea cucumber species of Benthodytes (Holothuroidea, Elasipodida, Psychropotidae) and its comprehensive mitochondrial genome sequencing and evolutionary analysis.

BACKGROUND: The holothurians, commonly known as sea cucumbers, are marine organisms that possess significant dietary, nutritional, and medicinal value. However, the National Center for Biotechnology Information (NCBI) currently possesses only approximately 70 complete mitochondrial genome datasets of Holothurioidea, which poses limitations on conducting comprehensive research on their genetic resources and evolutionary patterns. In this study, a novel species of sea cucumber belonging to the genus Benthodytes, was discovered in the western Pacific Ocean. The genomic DNA of the novel sea cucumber was extracted, sequenced, assembled and subjected to thorough analysis. RESULTS: The mtDNA of Benthodytes sp. Gxx-2023 (GenBank No. OR992091) exhibits a circular structure spanning 17,386 bp, comprising of 13 protein-coding genes (PCGs), 24 non-coding RNAs (2 rRNA genes and 22 tRNA genes), along with two putative control regions measuring 882 bp and 1153 bp, respectively. It exhibits a high AT% content and negative AT-skew, which distinguishing it from the majority of sea cucumbers in terms of environmental adaptability evolution. The mitochondrial gene homology between Gxx-2023 and other sea cucumbers is significantly low, with less than 91% similarity to Benthodytes marianensis, which exhibits the highest level of homology. Additionally, its homology with other sea cucumbers is below 80%. The mitogenome of this species exhibits a unique pattern in terms of start and stop codons, featuring only two types of start codons (ATG and ATT) and three types of stop codons including the incomplete T. Notably, the abundance of AT in the Second position of the codons surpasses that of the First and Third position. The gene arrangement of PCGs exhibits a relatively conserved pattern, while there exists substantial variability in tRNA. Evolutionary analysis revealed that it formed a distinct cluster with B. marianensis and exhibited relatively distant phylogenetic relationships with other sea cucumbers. CONCLUSIONS: These findings contribute to the taxonomic diversity of sea cucumbers in the Elasipodida order, thereby holding significant implications for the conservation of biological genetic resources, evolutionary advancements, and the exploration of novel sea cucumber resources.

A nomogram for predicting risk factors of testicular salvage after testicular torsion in children.

OBJECTIVES: This study aimed to establish a nomogram for predicting the probability of testicular salvage after testicular torsion in children. METHODS: We retrospectively collected data of children with testicular torsion who were treated at Shenzhen Children's Hospital between September 2005 and August 2022. Of the training cohort, 113 patients who underwent orchiectomy and five with testicular atrophy after orchiopexy were included in the failed testicular salvage group. Additionally, 37 patients who underwent orchiopexy without postoperative testicular atrophy were included in the successful testicular salvage group. The predictive factors affecting testicular salvage were determined using univariate and multivariate logistic regression analyses; a nomogram was constructed. The nomogram was verified using data from the validation group. RESULTS: Using multivariate logistic regression analysis, the independent risk factors of testicular salvage after testicular torsion were symptom duration (p = 0.034), intratesticular blood flow (p = 0.003), spermatic cord torsion degree (p = 0.037), and monocyte count (odds ratio: 0.012, p = 0.036). A nomogram was established based on these four risk factors. In the training cohort, the area under the receiver operating characteristic curve was 0.969. The area under the receiver operating characteristic curve of the verification cohort was 0.965, indicating good discrimination ability of the nomogram. Increased symptom duration without intratesticular blood flow increased the monocyte count and spermatic cord torsion degree and decreased the success rate of testicular salvage. CONCLUSION: This prediction model could obtain the corresponding probability of testicular salvage according to the clinical characteristics of different patients with testicular torsion, providing reference for clinicians and parents.

Advantages of single-site laparoscopic orchiopexy for palpable undescended testes in children: a prospective comparison study.

PURPOSE: To evaluate the feasibility of single-site laparoscopic orchiopexy for palpable undescended testes in children. METHODS: We prospectively studied patients with undescended testes between July 2021 and June 2022. In total, 223 patients were included in our study: 105 underwent single-site laparoscopic orchiopexy and 118 underwent conventional laparoscopic orchiopexy. During single-site laparoscopic orchiopexy, 3 ports were inserted within the umbilicus. RESULTS: No differences were observed between the groups in terms of age and laterality. For unilateral undescended testes, the operating time was longer in the single site group than in the conventional group at the early stages (55.31 ± 12.04 min vs. 48.14 ± 14.39 min, P = 0.007), but it was similar to the conventional group at the later stages (48.82 ± 13.49 min vs. 48.14 ± 14.39 min, P = 0.78). Testicular ascent occurred in one patient from each group. There was no significant difference in the success rate between the single-site group and the conventional group (99.0% vs. 99.2%, P = 0.93). In the single-site group, no visible abdominal scarring was observed, while in the conventional group, there were two noticeable scars on the abdomen. CONCLUSION: Single-site laparoscopic orchiopexy offers superior cosmetic results and comparable success rates compared to conventional laparoscopic orchiopexy for palpable undescended testes.

Deciphering the interactions between altertoxins and glutenin based on molecular dynamic simulation: inspiration from detection.

BACKGROUND: Mycotoxin contamination of food has been gaining increasing attention. Hidden mycotoxins that interact with biological macromolecules in food could make the detection of mycotoxins less accurate, potentially leading to the underestimation of the total exposure risk. Interactions of the mycotoxins alternariol (AOH) and alternariol monomethyl ether (AME) with high-molecular glutenin were explored in this study. RESULTS: The recovery rates of AOH and AME (1, 2, and 10 µg kg-1) in three types of grains (rice, corn, and wheat) were relatively low. Molecular dynamics (MD) simulations indicated that AOH and AME bound to glutenin spontaneously. Hydrogen bonds and π-π stacking were the primary interaction forces at the binding sites. Alternariol with one additional hydroxyl group exhibited stronger binding affinity to glutenin than AME when analyzing average local ionization energy. The average interaction energy between AOH and glutenin was -80.68 KJ mol-1, whereas that of AME was -67.11 KJ mol-1. CONCLUSION: This study revealed the mechanisms of the interactions between AOH (or AME) and high-molecular glutenin using MD and molecular docking. This could be useful in the development of effective methods to detect pollution levels. These results could also play an important role in the evaluation of the toxicological properties of bound altertoxins. © 2024 Society of Chemical Industry.

Precipitation pattern changed the content of non-structural carbohydrates components in different organs of Artemisia ordosica.

BACKGROUND: Non-structural carbohydrates (NSC) play a significant role in plant growth and defense and are an important component of carbon cycling in desert ecosystems. However, regarding global change scenarios, it remains unclear how NSCs in desert plants respond to changing precipitation patterns. [Methods] Three precipitation levels (natural precipitation, a 30% reduction in precipitation, and a 30% increase in precipitation) and two precipitation intervals levels (5 and 15 d) were simulated to study NSC (soluble sugar and starch) responses in the dominant shrub Artemisia ordosica. RESULTS: Precipitation level and interval interact to affect the NSC (both soluble sugar and starch components) content of A. ordosica. The effect of precipitation on NSC content and its components depended on extended precipitation interval. With lower precipitation and extended interval, soluble sugar content in roots increased and starch content decreased, indicating that A. ordosica adapts to external environmental changes by hydrolyzing root starch into soluble sugars. At 5 d interval, lower precipitation increased the NSC content of stems and especially roots. CONCLUSIONS: A. ordosica follows the "preferential allocation principle" to preferentially transport NSC to growing organs, which is an adaptive strategy to maintain a healthy physiological metabolism under drought conditions. The findings help understand the adaptation and survival mechanisms of desert vegetation under the changing precipitation patterns and are important in exploring the impact of carbon cycling in desert systems under global environmental change.

RUNX1 knockdown induced apoptosis and impaired EMT in high-grade serous ovarian cancer cells.

Ovarian cancer is the leading cause of death from gynecologic illnesses worldwide. High-grade serous ovarian cancer (HGSOC) is a gynecological tumor that accounts for roughly 70% of ovarian cancer deaths in women. Runt-related transcription factor 1(RUNX1) proteins were identified with overexpression in the HGSOC. However, the roles of RUNX1 in the development of HGSOC are poorly understood. In this study, combined with whole-transcriptome analysis and multiple research methods, RUNX1 was identified as vital in developing HGSOC. RUNX1 knockdown inhibits the physiological function of ovarian cancer cells and regulates apoptosis through the FOXO1-Bcl2 axis. Down-regulated RUNX1 impairs EMT function through the EGFR-AKT-STAT3 axis signaling. In addition, RUNX1 knockdown can significantly increase the sensitivity to clinical drug therapy for ovarian cancer. It is strongly suggested that RUNX1 work as a potential diagnostic and therapeutic target for HGSOC patients with better prognoses and treatment options. It is possible to generate novel potential targeted therapy strategies and translational applications for serous ovarian carcinoma patients with better clinical outcomes.

The SIRT3 activator ganoderic acid D regulates airway mucin MUC5AC expression via the NRF2/GPX4 pathway.

PURPOSE: The expression of MUC5AC, a highly prevalent airway mucin, is regulated by stimulatory factors such as oxidative stress. Ganoderic acid D (GAD) activates mitochondrial deacetylase SIRT3. SIRT3 regulates mitochondrial function through deacetylation of mitochondrial proteins, thereby playing a significant role in alleviating oxidative stress-related diseases. Therefore, this study aimed to investigate the mechanisms and rationale underlying the regulation of MUC5AC expression by GAD. METHODS: Human airway epithelial cells (NCI-H292) were exposed to pyocyanin (PCN) to establish an in vitro cell model of airway mucus hypersecretion. The expression of SIRT3, MUC5AC, and NRF2 pathway proteins in cells was assessed. Cellular mitochondrial morphology and oxidative stress markers were analyzed. C57BL/6 mice were induced with Pseudomonas aeruginosa (PA) to establish an in vivo mouse model of airway mucus hypersecretion. The expression of SIRT3 and MUC5AC in the airways was examined. In addition, the differential expression of target genes in the airway epithelial tissues of patients with chronic obstructive pulmonary disease (COPD) was analyzed using publicly available databases. RESULTS: The results revealed a significant upregulation of MUC5AC expression and a significant downregulation of SIRT3 expression in relation to airway mucus hypersecretion. GAD inhibited the overexpression of MUC5AC in PCN-induced NCI-H292 cells and PA-induced mouse airways by upregulating SIRT3. GAD activated the NRF2/GPX4 pathway and inhibited PCN-induced oxidative stress and mitochondrial morphological changes in NCI-H292 cells. However, ML385 inhibited the regulatory effects of GAD on MUC5AC expression. CONCLUSION: The SIRT3 activator GAD downregulated MUC5AC expression, potentially through activation of the NRF2/GPX4 pathway. Accordingly, GAD may be a potential treatment approach for airway mucus hypersecretions.

A direct approach toward investigating DNA-ligand interactions via surface-enhanced Raman spectroscopy combined with molecular dynamics simulations.

Small molecules that interfere with DNA replication can trigger genomic instability, which makes these molecules valuable in the search for anticancer drugs. Thus, interactions between DNA and its ligands at the molecular level are of great significance. In the present study, a new method based on surface-enhanced Raman spectroscopy (SERS) combined with molecular dynamics simulations has been proposed for analyzing the interactions between DNA and its ligands. The SERS signals of DNA hairpins (ST: d(CGACCAACGTGTCGCCTGGTCG), AP1: d(CGCACAACGTGTCGCCTGTGCG)), pure argininamide, and their complexes, were obtained, and the characteristic peak sites of the DNA secondary structure and argininamide ligand-binding region were analyzed. Molecular dynamics calculations predicted that argininamide binds to the 8C and 9G bases of AP1 via hydrogen bonding. Our method successfully detected the changes of SERS fingerprint peaks of hydrogen bonds and bases between argininamide and DNA hairpin bases, and their binding sites and action modes were consistent with the predicted results of the molecular dynamics simulations. This SERS technology combined with the molecular dynamics simulation detection platform provides a general analysis tool, with the advantage of effective, rapid, and sensitive detection. This platform can obtain sufficient molecular level conformational information to provide avenues for rapid drug screening and promote progress in several fields, including targeted drug design.

Are "additional cuts" effective for positive margins in cervical conization? It varies according to the doctor.

BACKGROUND: High-grade squamous intraepithelial lesion (HSIL) is a disease that is closely related to the development of cervical cancer. In clinical work, cold knife conization and a loop electrosurgical excision procedure (LEEP) are often selected for diagnosis and treatment. OBJECTIVE: In this paper, we aimed to discuss additional cuts, a common practice in cervical conization, and determine whether the doctor's choice to use additional cuts in conization can reduce the occurrence of a positive cone margin. METHODS: From January 2018 to October 2019, 965 patients underwent cervical conization at the First Affiliated Hospital of Dalian Medical University (Dalian, China). Of these, 174 were in the positive cone margin group, and 791 were in the negative cone margin group. Age, preoperative pathology, pathological results of conization, additional cuts, cone depth, and cone volume were studied. Additionally, the additional cut rate and the efficiency of doctors with a habit of additional cuts were analyzed. RESULTS: Of the 965 patients included in the study, the median age was 41 years (range 35-50). Multivariable logistic regression analysis suggested that additional cuts (OR, 2.480; 95% CI 1.608 to 3.826; p = 0.01) and smaller cone depth (OR, 0.591; 95% CI, 0.362 to 0.965, p = 0.036) were independent risk factors for positive margins. Six of the 64 doctors who performed conizations had a habit of making additional cuts, and there was no positive correlation between their additional cut rate and their effective additional cut rate. CONCLUSION: This study showed that a certain proportion of additional cuts can be effectively excised from the positive margin that cannot be removed in the initial conization. The practice of additional cuts in conization tends to be the personal habit of a small number of doctors.

Retinopathy is associated with impaired cognition in patients undergoing peritoneal dialysis.

Objective: Previous studies have shown a relationship between retinopathy and cognition including population with and without chronic kidney disease (CKD) but data regarding peritoneal dialysis (PD) are limited. This study aims to investigate the relationship between retinopathy and cognitive impairment in patients undergoing peritoneal dialysis (PD). Methods: In this observational study, we recruited a total of 107 participants undergoing PD, consisting of 48 men and 59 women, ages ranging from 21 to 78 years. The study followed a cross-sectional design. Retinal microvascular characteristics, such as geometric changes in retinal vascular including tortuosity, fractal dimension (FD), and calibers, were assessed. Retinopathy (such as retinal hemorrhage or microaneurysms) was evaluated using digitized photographs. The Modified Mini-Mental State Examination (3MS) was performed to assess global cognitive function. Results: The prevalence rates of retinal hemorrhage, microaneurysms, and retinopathy were 25%, 30%, and 43%, respectively. The mean arteriolar and venular calibers were 63.2 and 78.5 µm, respectively, and the corresponding mean tortuosity was 37.7 ± 3.6 and 37.2 ± 3.0 mm-1. The mean FD was 1.49. After adjusting for age, sex, education, mean arterial pressure, and Charlson index, a negative association was revealed between retinopathy and 3MS scores (regression coefficient: -3.71, 95% confidence interval: -7.09 to -0.33, p = 0.03). Conclusions: Retinopathy, a condition common in patients undergoing PD, was associated with global cognitive impairment. These findings highlight retinopathy, can serve as a valuable primary screening tool for assessing the risk of cognitive decline.

Protective Effect of Mycosporine-like Amino Acids Isolated from an Antarctic Diatom on UVB-Induced Skin Damage.

Although it is well recognized that mycosporine-like amino acids (MAAs) are ultraviolet (UV) protective agents that can reduce UV damage, the specific biological mechanism of its role in the skin remains unclear. In this study, we investigated the effect of MAAs extracted from Antarctic diatom Phaeodactylum tricornutum ICE-H on UVB-induced skin damage using a mice model. The MAAs components identified by liquid chromatography-tandem mass spectrometry included 4-deoxygadusol, shinorine, and porphyra-334, which were purified using a Supledean Carboxen1000 solid phase extraction column. The antioxidant activities of these MAA compounds were tested in vitro. For UVB-induced skin photodamage in mice, MAAs alleviated skin swelling and epidermal thickening in this study. We detected the content of reactive oxygen species (ROS), malondialdehyde, and collagen in skin tissue. In addition, quantitative real-time polymerase chain reaction was used to detect nuclear factor-κB (NF-κB), tumor necrosis factor α, interleukin-1ß, cyclooxygenase-2, mitogen activated protein kinase (MAPK) family (extracellular signal-regulated kinase, c-Jun amino-terminal kinase, and p38 kinase), and matrix metalloproteinases. The expression of these cytokines and enzymes is related to inflammatory responses and collagen degradation. In comparison to the model group without MAA treatment, the MAA component decreased the concentration of ROS, the degree of oxidative stress in the skin tissue, and the expression of genes involved in the NF-κB and MAPK pathways. In summary, these MAA components extracted from Phaeodactylum tricornutum ICE-H protected against UVB-induced skin damage by inhibiting ROS generation, relieving skin inflammation, and slowing down collagen degradation, suggesting that these MAA components are effective cosmetic candidate molecules for the protection and therapy of UVB damage.

Modification of Multiwalled Carbon Nanotubes and Their Mechanism of Demanganization.

Multiwalled carbon nanotubes (MWCNTs) were modified by oxidation and acidification with concentrated HNO3 and H2SO4, and the modified multiwalled carbon nanotubes (M-MWCNTs) and raw MWCNTs were characterized by several analytical techniques. Then the demanganization effects of MWCNTs and M-MWCNTs were well investigated and elucidated. The experimental data demonstrated that the adsorption efficiency of Mn(II) could be greatly promoted by M-MWCNTs from about 20% to 75%, and the optimal adsorption time was 6 h and the optimal pH was 6. The results of the kinetic model studies showed that Mn(II) removal by M-MWCNTs followed the pseudo-second-order model. Isothermal studies were conducted and the results demonstrated that the experimental data fitted well with the three models. The reliability of the experimental results was well verified by PSO-BP simulation, and the present conclusion could be used as a condition for further simulation. The research results provide a potential technology for promoting the removal of manganese from wastewater; at the same time, the application of various mathematical models also provides more scientific ideas for the research of the mechanism of adsorption of heavy metals by nanomaterials.

Impact of soluble organic matter and particulate organic matter on anammox system: Performance, microbial community and N2O production.

In this study, the effects of soluble readily biodegradable COD (sCOD) and particulate slowly biodegradable COD (pCOD) on anammox process were investigated. The results of the long-term experiment indicated that a low sCOD/N ratio of 0.5 could accelerate the anammox and denitrification activity, to reach as high as 84.9%±2.8% TN removal efficiency. Partial denitrification-anammox (PDN/anammox) and denitrification were proposed as the major pathways for nitrogen removal, accounting for 91.3% and 8.7% of the TN removal, respectively. Anammox bacteria could remain active with high abundance of anammox genes to maintain its dominance. Candidatus Kuenenia and Thauera were the predominant genera in the presence of organic matter. Compared with sCOD, batch experiments showed that the introduction of pCOD had a negative effect on nitrogen removal. The contribution of denitrification to nitrogen removal decreased from approximately 14% to 3% with increasing percentage of pCOD. In addition, the analysis result of the process data using an optimized ASM1 model indicated that high percentage of pCOD resulted in serious N2O emission (the peak value up to 0.25 mg N/L), which was likely due to limited mass diffusion and insufficient available carbon sources for denitrification. However, a high sCOD/N ratio was beneficial for alleviating N2O accumulation.

Greater chemical signaling in root exudates enhances soil mutualistic associations in invasive plants compared to natives.

Invasive plants can change soil properties resulting in improved growth. Although invaders are known to alter soil chemistry, it remains unclear if chemicals secreted by roots facilitate invasive plant-soil mutualisms. With up to 19 confamilial pairs of invasive and native plants, and most of which were congeners, we explored the root exudate-induced changes in plant-arbuscular mycorrhizal (AM) fungal mutualisms. We found that, relative to natives, invaders had greater AM colonization, greater biomass and their root exudates contained higher concentrations of two common chemical signals - quercetin and strigolactones - which are known to stimulate AM fungal growth and root colonization. An exudate exchange experiment showed that root exudates from invaders increased AM colonization more than exudates from natives. However, application of activated carbon led to greater reduction in AM colonization and plant biomass for invaders than natives, suggesting stronger effects of chemical signals in root exudates from invaders. We show that nonnative plants promote interactions with soil mutualists via enhancing root exudate chemicals, which could have important implications for invasion success.

Purification, Chemical Characterization and Immunomodulatory Activity of a Sulfated Polysaccharide from Marine Brown Algae Durvillaea antarctica.

An immunomodulatory polysaccharide (DAP4) was extracted, purified, and characterized from Durvillaea antarctica. The results of chemical and spectroscopic analyses demonstrated that the polysaccharide was a fucoidan, and was mainly composed of (1→3)-α-l-Fucp and (1→4)-α-l-Fucp residues with a small degree of branching at C-3 of (1→4)-α-l-Fucp residues. Sulfate groups were at C-4 of (1→3)-α-l-Fucp, C-2 of (1→4)-α-l-Fucp and minor C-6 of (1→4)-ß-d-Galp. Small amounts of xylose and galactose exist in the forms of ß-d-Xylp-(1→ and ß-d-Gal-(1→. The immunomodulatory activity of DAP4 was measured on RAW 264.7 cells, the results proved that DAP4 exhibited excellent immunomodulatory activities, such as promoted the proliferation of spleen lymphocytes, increased NO production, as well as enhanced phagocytic of macrophages. Besides, DAP4 could also produce better enhancement on the vitality of NK cells. For the high immunomodulatory activity, DAP4 might be a potential source of immunomodulatory fucoidan with a novel structure.

Regulatory Effects of Functional Soluble Dietary Fiber from Saccharina japonica Byproduct on the Liver of Obese Mice with Type 2 Diabetes Mellitus.

Though the relationship between dietary fiber and physical health has been investigated widely, the use of dietary fiber from marine plants has been investigated relatively rarely. The Saccharina japonica byproducts after the production of algin contain a large amount of insoluble polysaccharide, which will cause a waste of resources if ignored. Soluble dietary fiber (SDF)prepared from waste byproducts of Saccharina japonica by alkaline hydrolysis method for the first time had a wrinkled microscopic surface and low crystallinity, which not only significantly reduced liver index, serum levels of aspartate aminotransferase (AST) and alanine amiotransferase (ALT), and liver fat accumulation damage to the livers of obese diabetic mice, but also activated the PI3K/AKT signaling pathway to increase liver glycogen synthesis and glycolysis. By LC-MS/MS employing a Nexera UPLC tandem QE high-resolution mass spectrometer, the 6 potential biomarker metabolites were screened, namely glycerophosphocholine (GPC), phosphocholine (PCho), pantothenic acid, glutathione (GSH), oxidized glutathione (GSSG), and betaine; several pathways of these metabolites were associated with lipid metabolism, glycogen metabolism, and amino acid metabolism in the liver were observed. This study further provided a detailed insight into the mechanisms of SDF from Saccharina japonica byproducts in regulating the livers of obese mice with type 2 diabetes and laid a reliable foundation for the further development and utilization of Saccharina japonica.

Rapid detection of viruses: Based on silver nanoparticles modified with bromine ions and acetonitrile.

Nearly 200 million people have been diagnosed with COVID-19 since the outbreak in 2019, and this disease has claimed more than 5 million lives worldwide. Currently, researchers are focusing on vaccine development and the search for an effective strategy to control the infection source. This work designed a detection platform based on Surface-Enhanced Raman Spectroscopy (SERS) by introducing acetonitrile and calcium ions into the silver nanoparticle reinforced substrate system to realize the rapid detection of novel coronavirus. Acetonitrile may amplify the calcium-induced hot spots of silver nanoparticles and significantly enhanced the stability of silver nanoparticles. It also elicited highly sensitive SERS signals of the virus. This approach allowed us to capture the characteristic SERS signals of SARS-CoV-2, Human Adenovirus 3, and H1N1 influenza virus molecules at a concentration of 100 copies/test (PFU/test) with upstanding reproduction and signal-to-noise ratio. Machine learning recognition technology was employed to qualitatively distinguish the three virus molecules with 1000 groups of spectra of each virus. Acetonitrile is a potent internal marker in regulating the signal intensity of virus molecules in saliva and serum. Thus, we used the SERS peak intensity to quantify the virus content in saliva and serum. The results demonstrated a satisfactory linear relationship between peak intensity and protein concentration. Collectively, this rapid detection method has a broad application prospect in clinical diagnosis of viruses, management of emergent viral infectious diseases, and exploration of the interaction between viruses and host cells.

Preparation of CPD Photolyase Nanoliposomes Derived from Antarctic Microalgae and Their Effect on UVB-Induced Skin Damage in Mice.

UVB radiation is known to trigger the block of DNA replication and transcription by forming cyclobutane pyrimidine dimer (CPD), which results in severe skin damage. CPD photolyase, a kind of DNA repair enzyme, can efficiently repair CPDs that are absent in humans and mice. Although exogenous CPD photolyases have beneficial effects on skin diseases, the mechanisms of CPD photolyases on the skin remain unknown. Here, this study prepared CPD photolyase nanoliposomes (CPDNL) from Antarctic Chlamydomonas sp. ICE-L, which thrives in harsh, high-UVB conditions, and evaluated their protective mechanisms against UVB-induced damage in mice. CPDNL were optimized using response surface methodology, characterized by a mean particle size of 105.5 nm, with an encapsulation efficiency of 63.3%. Topical application of CPDNL prevented UVB-induced erythema, epidermal thickness, and wrinkles in mice. CPDNL mitigated UVB-induced DNA damage by significantly decreasing the CPD concentration. CPDNL exhibited antioxidant properties as they reduced the production of reactive oxygen species (ROS) and malondialdehyde. Through activation of the NF-κB pathway, CPDNL reduced the expression of pro-inflammatory cytokines including IL-6, TNF-α, and COX-2. Furthermore, CPDNL suppressed the MAPK signaling activation by downregulating the mRNA and protein expression of ERK, JNK, and p38 as well as AP-1. The MMP-1 and MMP-2 expressions were also remarkably decreased, which inhibited the collagen degradation. Therefore, we concluded that CPDNL exerted DNA repair, antioxidant, anti-inflammation, and anti-wrinkle properties as well as collagen protection via regulation of the NF-κB/MAPK/MMP signaling pathways in UVB-induced mice, demonstrating that Antarctic CPD photolyases have the potential for skincare products against UVB and photoaging.

Combination of paeoniflorin and calycosin-7-glucoside alleviates ischaemic stroke injury via the PI3K/AKT signalling pathway.

CONTEXT: Paeoniflorin (PF) and calycosin-7-glucoside (CG, Paeonia lactiflora Pall. extract) have demonstrated protective effects in ischaemic stroke. OBJECTIVE: To investigate the synergistic effects of PF + CG on ischaemia/reperfusion injury in vivo and in vitro. MATERIALS AND METHODS: Male Sprague-Dawley rats were subjected to the middle cerebral artery occlusion/reperfusion (MCAO/R). After MCAO/R for 24 h, rats were randomly subdivided into 5 groups: sham, model (MCAO/R), study treatment (PF + CG, 40 + 20 mg/kg), LY294002 (20 mg/kg), and study treatment + LY294002. Males were given via intragastric administration; the duration of the in vivo experiment was 8 days. Neurologic deficits, cerebral infarction, brain edoema, and protein levels were assessed in vivo. Hippocampal neurons (HT22) were refreshed with glucose-free DMEM and placed in an anaerobic chamber for 8 h. Subsequently, HT22 cells were reoxygenated in a 37 °C incubator with 5% CO2 for 6 h. SOD, MDA, ROS, LDH and protein levels were measured in vitro. RESULTS: PF + CG significantly reduced neurobehavioral outcomes (21%), cerebral infarct volume (44%), brain edoema (1.6%) compared with the MCAO/R group. Moreover, PF + CG increased p-PI3K/PI3K (4.69%, 7.4%), p-AKT/AKT (6.25%, 60.6%) and Bcl-2/BAX (33%, 49%) expression in vivo and in vitro, and reduced GSK-3ß (10.5%, 9.6%) expression. In vitro, PF + CG suppressed apoptosis in HT22 cells and decreased ROS and MDA levels (20%, 50%, respectively). CONCLUSIONS: PF + CG showed a synergistic protective effect against ischaemic brain injury, potentially being a future treatment for ischaemic stroke.

KIFC1 promotes aerobic glycolysis in endometrial cancer cells by regulating the c-myc pathway.

Endometrial cancer (EC) is a common gynecological malignant tumor worldwide. It is imperative to study pathogenesis and therapeutic targets for improving the prognosis of EC. The present study aimed to explore the function and mechanism of kinesin family member C1 (KIFC1) in EC. EC tumor and adjacent normal tissues were collected from 68 pairs of patients. The expression of KIFC1 in tissues and EC cells was analyzed by immunohistochemistry, qRT-PCR or western blot. MTT assay was used to test the cell viability. Flow cytometry was used to determine apoptosis and the cell cycle. Glucose uptake, lactate production, ATP contents and lactate dehydrogenase (LDH) activity were evaluated by a glucose metabolism kit. The expression of HMGA1, c-myc and glycolytic genes was assessed using western blot or qRT-PCR. A mouse xenograft model was established in BALB/c mice to detect tumor growth in vivo. KIFC1 was significantly upregulated in EC tumor tissues compared to adjacent normal control tissues. The upregulated expression of KIFC1 was correlated with poor prognosis in patients. Lentiviral-mediated overexpression of KIFC1 observably enhanced cell viability and reduced the apoptotic rate of Ishikawa and HEC-1B cells. Cell cycle progression was also expedited in the KIFC1 vector group. Moreover, overexpression of KIFC1 elevated glucose uptake, lactate production, ATP contents and LDH activity. However, knockdown of KIFC1 by short hairpin RNA (shRNA) showed the reverse effect on cellular functions. In addition, the expression of c-myc, GLUT1, LDHA and HK2 was increased by the KIFC1 vector. Moreover, HMGA1 regulated the expression of c-myc and glycolytic genes. Upregulated HMGA1 could rescue the effect of KIFC1 knockdown on cellular functions and the expression of glycolytic genes. Finally, KIFC1 knockdown inhibits tumor growth in vivo. The upregulation of KIFC1 was correlated with poor prognosis in EC. KIFC1 promoted aerobic glycolysis in endometrial cancer cells by regulating the HMGA1/c-myc pathway. KIFC1 may be a potential target for the diagnosis and therapy of EC.