Beet Soil-Borne Virus Is a Helper Virus for the Novel Beta vulgaris Satellite Virus 1A.

Sugar beet (Beta vulgaris) is grown in temperate regions around the world as a source of sucrose used for natural sweetening. Sugar beet is susceptible to a number of viral diseases, but identification of the causal agent(s) under field conditions is often difficult due to mixtures of viruses that may be responsible for disease symptoms. In this study, the application of RNAseq to RNA extracted from diseased sugar beet roots obtained from the field and from greenhouse-reared plants grown in soil infested with the virus disease rhizomania (causal agent beet necrotic yellow vein virus; BNYVV) yielded genome-length sequences from BNYVV, as well as beet soil-borne virus (BSBV). The nucleotide identities of the derived consensus sequence of BSBV RNAs ranged from 99.4 to 96.7% (RNA1), 99.3 to 95.3% (RNA2), and 98.3 to 95.9% (RNA3) compared with published BSBV sequences. Based on the BSBV genome consensus sequence, clones of the genomic RNAs 1, 2, and 3 were obtained to produce RNA copies of the genome through in vitro transcription. Capped RNA produced from the clones was infectious when inoculated into leaves of Chenopodium quinoa and B. vulgaris, and extracts from transcript-infected C. quinoa leaves could infect sugar beet seedling roots through a vortex inoculation method. Subsequent exposure of these infected sugar beet seedling roots to aviruliferous Polymyxa betae, the protist vector of both BNYVV and BSBV, confirmed that BSBV derived from the infectious clones could be transmitted by the vector. Co-inoculation of BSBV synthetic transcripts with transcripts of a cloned putative satellite virus designated Beta vulgaris satellite virus 1A (BvSat1A) resulted in the production of lesions on leaves of C. quinoa similar to those produced by inoculation with BSBV alone. Nevertheless, accumulation of genomic RNA and the encoded protein of the satellite virus in co-inoculated leaves was readily detected on Northern and Western blots, respectively, whereas no accumulation of satellite virus products occurred when satellite virus RNA was inoculated alone. The predicted sequence of the detected protein encoded by BvSat1A bears hallmarks of coat proteins of other satellite viruses, and virions of a size consistent with a satellite virus were observed in samples testing positive for the virus. The results demonstrate that BSBV is a helper virus for the novel satellite virus BvSat1A.

First Report of Impatiens Necrotic Spot Virus (INSV) Infecting Lettuce in Mexico.

Impatiens necrotic spot virus (INSV; Order Bunyavirales, Family Tospoviridae) is transmitted by several thrips species and has emerged as an important pathogen of lettuce (Lactuca sativa) in several countries (Beris et al., 2020 and Hasegawa & Del Pozo-Valdivia, 2023). In 2023, a total of 22,092 hectares of lettuce were planted in Mexico, with a total production of 523,739 tons (Agri-Food and Fisheries Information Service, 2024). In the last several years, increased outbreaks of a disease showing virus-like symptoms have emerged in lettuce in central Mexico. In all cases, plants exhibited symptoms of yellowing, brown necrotic spots and ringspots on the leaves and midribs, and reduced growth. In fall 2023, symptoms were observed in 12 iceberg lettuce fields, with incidences between 5-70% in the municipality of Tenango del Valle, in the state of Mexico. 18 plants collected from 6 fields were initially tested for the presence of two thrips-transmitted viruses, INSV and tomato spotted wilt virus (TSWV) using ImmunoStrips (Agdia Inc., Elkhart, Indiana), which indicated positive results for INSV in 16 plants and TSWV in 2 plants. None of the plants tested positive for both viruses. Follow up sampling was conducted, which included a total of 17 symptomatic lettuce plants from three fields in October 2023, while an additional 11 lettuce plants were collected from Tepeaca, in the neighboring state of Puebla in March 2024. DAS-ELISA confirmed the presence of INSV in 13/17 plants and TSWV in 2/17 plants from Tenango del Valle, while only INSV was detected in the 11 plants from Tepeaca. Based on ELISA, none of the lettuce samples were co-infected by INSV and TSWV, which was similarly observed in California and Greece (Koike et al., 2008 and Beris et al., 2020). Initially, RNA was purified from 3 plants (two from Tenango del Valle, one from Tepeaca) reverse-transcribed, and PCR amplified with primers to the N gene of the INSV S RNA, as previously described (Hasegawa et al., 2022). All three reactions produced a single expected amplicon of 524 bp and were confirmed by bi-directional Sanger sequencing (MCLab, South San Francisco, CA). To obtain the full-length sequences for the N and NSm genes, RNA from a fourth sample (Tenango del Valle) was amplified with primers (Kuo et al., 2014), and Sanger sequenced. The 789 bp N gene (PP726902) shared >99% nucleotide and amino acid identity to the corresponding region of the INSV isolate from orchid in California (KF926828), while the 912 bp NSm gene (PP726901) shared >98% nucleotide and amino acid identity to the INSV isolate from basil in Washington (KX790322). Additionally, all four samples showed >99.5% similarity to one another. INSV was previously reported to affect other crops in Mexico, including tomatillo (Physalis ixocarpa) and pepper (Capsicum spp.) (González-Pacheco and Silva-Rosales, 2013), while TSWV has been reported to infect lettuce (Moreno et al., 2016). To our knowledge, this is the first report of INSV infecting lettuce in Mexico and was the dominant orthotospovirus in lettuce samples that were tested. INSV should be closely monitored throughout central Mexico, where majority of lettuce production occurs. Additional studies are warranted to identify the thrips vector species that are present, and to understand the role of crop and non-crop hosts in the epidemiology of INSV throughout the region.

Emergence of watermelon chlorotic stunt virus in melon and watermelon in the southwestern United States.

Watermelon (Citrullus lanatus) and melon (Cucumis melo) plants with leaves exhibiting mosaic symptoms or chlorotic spotting, respectively, along with limited foliar distortion, predominantly on newer growth, were observed in commercial fields throughout Yuma County, AZ, and Imperial County, CA, in fall 2023. Older leaves also exhibited yellowing typical of infection by whitefly-transmitted viruses common in the region, and whiteflies (Bemisia tabaci) were prevalent in fields. Symptomatic plants were tested using a multiplex RT-PCR for cucurbit yellow stunting disorder virus (CYSDV), cucurbit chlorotic yellows virus (CCYV), squash vein yellowing virus (SqVYV), and cucurbit aphid-borne yellows virus (CABYV) (Mondal et al., 2023), and separately for cucurbit leaf crumple virus (CuLCrV; F: TCAAAGGTTTCCCGCTCTGC, R: TCAAAGGTTTCCCGCTCTGC). Most plants were infected with CYSDV, which has been widely prevalent during the fall production season since its emergence in 2006, but not with the other tested viruses. Although the yellowing of older leaves near the crown was typical of symptoms resulting from CYSDV infection, the unusual symptoms on newer growth suggested the possibility of infection by a begomovirus. Rolling circle amplification and DNA sequencing of nucleic acid extract from a symptomatic melon plant collected in Dome Valley, AZ, identified the presence of watermelon chlorotic stunt virus (WmCSV), a bipartite begomovirus (Geminiviridae) (Jones et al., 1988; Lecoq, 2017), but no other begomoviruses. Sequencing of the complete WmCSV genome from this melon plant determined that DNA A (GenBank accession #PQ399661) shared 99% identity with WmCSV isolates from cactus (MW588390) and melon (KY124280) in Sonora, Mexico, and DNA B (PQ399662) shared 96% and 94% identity with WmCSV isolates from watermelon in Palestine (KC462553) and Sonora (KY124281), respectively. PCR with primers targeting WmCSV DNA A (F: CATGGAGATGAGGTTCCCCATTCT and R: GCTCGTAGGTCGATTCAACGGCCT) and DNA B (F: AGATACAACGTATGGGCAGCATT and R: TACAGATCCCARTCGATGAGACT) was used for secondary confirmation. Sequencing of amplified products confirmed both WmCSV DNA A and B in 12/15 initial melon samples. PCR using the DNA A or B primers confirmed the presence of WmCSV from additional watermelon and melon samples collected from Yuma County (31 positive/37 tested) and Imperial County (20/22). This is the first report of WmCSV in cucurbits in the United States (U.S.); the virus was previously identified in watermelon (Domínguez-Durán et al., 2018) and cactus (Opuntia auberi) from Sonora, Mexico, and from one cactus (O. cochenillifera), lamb's ears (Stachys byzantine), and an unknown Solanum plant from a botanical garden in Arizona (Fontanelle et al., 2021). The geographic distribution of WmCSV and the presence of similar symptoms in melon in 2022 suggests that it may have been present in the U.S. for at least a year. Interestingly, nearly all melon and some watermelon plants infected with WmCSV were co-infected with CYSDV. Most fall cucurbits in the Sonoran Desert production region become infected with CYSDV, and many are also infected with CCYV and/or SqVYV (Mondal et al., 2023). However, incidence of CCYV (4/63) and SqVYV (2/63) in the region was extremely low during fall 2023. Research is in progress to determine the potential impact of WmCSV on the cucurbit virus complex in the Sonoran Desert and the U.S. as a whole, and to understand the epidemiological factors that influence WmCSV infection and spread.

Differential Seasonal Prevalence of Yellowing Viruses Infecting Melon Crops in Southern California and Arizona Determined by Multiplex RT-PCR and RT-qPCR.

Viruses transmitted by the whitefly (Bemisia tabaci) are an increasing threat to cucurbit production in the southwestern United States and many other cucurbit production regions of the world. The crinivirus cucurbit yellow stunting disorder virus (CYSDV) has severely impacted melon production in California and Arizona since its 2006 introduction to the region. Within the past few years, another crinivirus, cucurbit chlorotic yellows virus (CCYV), and the whitefly-transmitted ipomovirus squash vein yellowing virus (SqVYV) were found infecting melon plants in California's Imperial Valley. CYSDV, CCYV, and an aphid-transmitted polerovirus, cucurbit aphid-borne yellows virus (CABYV), occur together in the region and produce identical yellowing symptoms on cucurbit plants. Mixed infections of these four viruses in the Sonoran Desert and other regions pose challenges for disease management and efforts to develop resistant varieties. A multiplex single-step RT-PCR method was developed that differentiates among these viruses, and this was used to determine the prevalence and distribution of the viruses in melon samples from fields in the Sonoran Desert melon production region of California and Arizona during the spring and fall melon seasons from 2019 through 2021. TaqMan probes were developed, optimized, and applied in a single-step multiplex RT-qPCR to quantify titers of these four viruses in plant samples, which frequently carry mixed infections. Results of the multiplex RT-PCR analysis demonstrated that CYSDV is the predominant virus during the fall, whereas CCYV was by far the most prevalent virus during the spring each year. Multiplex RT-qPCR was used to evaluate differential accumulation and spatiotemporal distribution of viruses within plants and suggested differences in competitive accumulation of CCYV and CYSDV within melon. This study provides the first official report of SqVYV in Arizona and offers an efficient method for virus detection and quantification for breeding and disease management in areas impacted by cucurbit yellowing viruses.

First Report of Impatiens Necrotic Spot Virus Infecting Lettuce in Arizona and Southern Desert Regions of California.

Impatiens necrotic spot virus (INSV; family Tospoviridae, genus Orthotospovirus) is a thrips-borne pathogen that infects a wide range of ornamental and vegetable crops. INSV was first reported in lettuce (Lactuca sativa) in the Salinas Valley of CA (Monterey County) in 2006 (Koike et al. 2008). Since then, the pathogen has continued to impact lettuce production in the region, causing severe economic losses with increasing incidence and severity in recent years. Tomato spotted wilt virus (TSWV), another tospovirus, also infects lettuce, but its occurrence is much less frequent than INSV (Kuo et al. 2014). While INSV has not been reported in the desert areas of CA and AZ, there are concerns that the virus could become established in this region. In early March 2021, symptoms resembling those caused by orthotospovirus infection were observed in several romaine and iceberg lettuce fields in the Yuma and Tacna regions of Yuma County, AZ. Symptoms included leaves that exhibited tan to dark brown necrotic spots, distorted leaf shapes, and stunted plant growth. Similar symptoms were also reported in romaine fields and one green leaf and iceberg lettuce field in the neighboring Imperial and Riverside Counties of CA. A total of 14 samples (5 from Tacna, 4 from Yuma, 4 from Imperial, 1 from Riverside) were tested using ImmunoStrips (Agdia, Elkhart, IN) for INSV and TSWV. Results confirmed the presence of INSV in 13 out of 14 samples, and the absence of INSV in one sample originating from Yuma. All 14 samples tested negative for TSWV. The 13 INSV positive samples were processed for RT-PCR validation. Total RNA was extracted from each sample using the RNeasy Plant Mini Kit (Qiagen, Valencia, CA). RT-PCR was performed with OneStep Ahead RT-PCR Kit (Qiagen) with primers to the N gene of INSV S RNA (Accession KF745140.1; INSV F = CCAAATACTACTTTAACCGCAAGT; INSV R = ACACCCAAGACACAGGATTT). All reactions generated a single amplicon at the correct size of 524 bp. One sample each from Yuma, Tacna, and Brawley (Imperial County), as well as a romaine lettuce sample collected from the Salinas Valley in March 2021, were sent for Sanger bi-directional sequencing (Eton Biosciences, San Diego, CA). Sequence analysis revealed that all three desert samples (Yuma, Tacna, and Brawley with Accessions OK340696, OK340697, OK340698, respectively) shared 100% sequence identity and 99.43% identity to the Salinas Valley 2021 sample (SV-L2, Accession OK340699). Additionally, all desert samples shared 99.24% sequence identity to the Salinas Valley lettuce isolate previously described in 2014 (SV-L1, Accession KF745140.1; Kuo et al. 2014), while the SV-L2 and SV-L1 sequences shared 99.43% identity. By the end of the season (April 2021) a total of 43 lettuce fields in Yuma County, AZ, and 9 fields in Imperial and Riverside Counties, CA were confirmed to have INSV infection using ImmunoStrips. Impacted fields included romaine, green leaf, red leaf, and head lettuce varieties, and both direct-seeded and transplanted lettuce, under conventional and organic management regimes. In AZ, INSV incidence in fields ranged between 0.2% and 33%, while in Imperial and Riverside Counties, CA, field incidence remained low at less than 0.1%. It is possible that INSV was introduced from the Salinas Valley of CA through the movement of infected lettuce transplants and/or thrips vectors. To our knowledge, this is the first report of INSV infecting lettuce in Arizona and the southern desert region of California.

Natural Infection Rate of Known Tomato chlorosis virus-Susceptible Hosts and the Influence of the Host Plant on the Virus Relationship With Bemisia tabaci MEAM1.

Tomato chlorosis virus (ToCV; genus Crinivirus, family Closteroviridae) was identified in tomato crops in São Paulo State, Brazil, in 2006. Management strategies to control external sources of inoculum are necessary, because chemical control of the whitefly vector Bemisia tabaci Middle East-Asia Minor 1 (MEAM1) has not efficiently prevented virus infections and no commercial tomato varieties or hybrids are resistant to this crinivirus. We first evaluated the natural infection rate of some known wild and cultivated ToCV-susceptible hosts and their attractiveness for B. tabaci MEAM1 oviposition. Physalis angulata was the most susceptible to natural infection in all six exposures in 2018 and 2019. No plants of Capsicum annuum 'Dahra' or Chenopodium album became infected. Solanum melongena 'Napoli' had only two infected plants of 60 exposed. Capsicum annuum and Chenopodium album were the least preferred, and Nicotiana tabacum and S. melongena were the most preferred for whitefly oviposition. In addition, from 2016 to 2019, we surveyed different tomato crops and the surrounding vegetation to identify ToCV in weeds and cultivated plants in the region of Sumaré, São Paulo State. Only S. americanum, vila vila (S. sisymbriifolium), and Chenopodium album were found naturally infected, with incidences of 18, 20, and 1.4%, respectively. Finally, we estimated the ToCV titer (U.S. and Brazilian isolates ToCV-FL and ToCV-SP, respectively) by quantitative reverse transcription PCR in different ToCV-susceptible host plants and evaluated the relationship between virus acquisition and transmission by B. tabaci MEAM1. The results clearly showed significant differences in ToCV concentrations in the tissues of ToCV-susceptible host plants, which appeared to be influenced by the virus isolate. The concentration of the virus in plant tissues, in turn, directly influenced the ToCV-B. tabaci MEAM1 relationship and subsequent transmission to tomato plants. To minimize or prevent damage from tomato yellowing disease through management of external sources of ToCV, it is necessary to correctly identify potentially important ToCV-susceptible hosts in the vicinity of new plantings.