[Effects of colpotomic approaches on prognosis and recurrence sites of stage â a2-â ¡a2 cervical cancer after laparoscopic radical hysterectomy].

Objective: To investigate the factors affecting the prognosis of stage Ⅰa2-Ⅱa2 cervical cancer after laparoscopic radical hysterectomy (LRH), and to compare the prognosis and recurrence sites of patients with different colpotomy paths. Methods: The clinical data of 965 patients with stage Ⅰa2-Ⅱa2 cervical cancer who underwent LRH in the First Affiliated Hospital of Army Medical University from January 2015 to December 2018 were collected. The median age was 47.0 years of all patients with a median follow-up of 62 months (48-74 months). Cox regression was used to perform the univariate and multivariate analysis of the clinicopathological factors associated with the prognosis that included disease-free survival (DFS) and overall survival (OS). Patients were categorized into LRH through vaginal colpotomy (VC group, n=475) and LRH through intracorporeal colpotomy (IC group, n=490) according to the colpotomic approaches. The prognosis and recurrence sites of patients in each group were compared. Results: (1) During the follow-up period, 137 cases recurred (14.2%, 137/965) and 98 cases died (10.2%, 98/965). The 5-year DFS and OS were 85.8% and 89.9%, respectively. In univariate analysis, positive vaginal margin (PVM) was significantly affected the 5-year OS of patients with cervical cancer (P=0.023), while clinical stage, maximum diameter of tumor, degree of pathological differentiation, lymph node metastasis (LNM), depth of cervical stromal invasion, parametrium involvement, and uterine corpus invasion (UCI) were significantly associated with 5-year DFS and OS in patients with cervical cancer (all P<0.05). In multivariate analysis, clinical stage (HR=1.882, 95%CI: 1.305-2.716), LNM (HR=2.178, 95%CI: 1.483-3.200) and UCI (HR=3.650, 95%CI: 1.906-6.988) were independent risk factors of 5-year DFS (all P<0.001). Clinical stage (HR=2.500, 95%CI: 1.580-3.956), LNM (HR=2.053, 95%CI: 1.309-3.218), UCI (HR=3.984, 95%CI: 1.917-8.280), PVM (HR=3.235, 95%CI: 1.021-10.244) were independent risk factors of 5-year OS (all P<0.05). (2) Different colpotomy paths did not significantly affect the 5-year DFS and OS of patients with stage Ⅰa2-Ⅱa2 cervical cancer. The 5-year DFS in VC group and IC group were 85.9% and 85.6% (P=0.794), and the 5-year OS were 90.8% and 89.3% (P=0.966), respectively. Recurrence patterns consisted of intraperitoneal recurrence, pelvic recurrence, vaginal stump recurrence, and lymph node and distant metastasis. The intraperitoneal recurrence rate of VC group was significantly lower than that of IC group [0.6%(3/468) vs 2.3% (11/485), P=0.037], while the rates of pelvic recurrence, vaginal stump recurrence, lymph node and distant metastasis and overall recurrence were not significantly different between two groups (all P>0.05). Subgroup analysis of patients with different clinical stages, LNM and UCI showed that statistical differences of the intraperitoneal recurrence rates between two groups were only in patients without LNM (0.5% vs 2.3%, P=0.030) or without UCI (0.7% vs 2.3%, P=0.037). Conclusions: Clinical stage, LNM, PVM and UCI are independent risk factors for the prognosis of patients with stage Ⅰa2-Ⅱa2 cervical cancer. For patients without LNM or UCI, LRH through VC could reduce the intraperitoneal recurrence rate, while it is not enough to improve 5-year DFS and OS of patients. Low proportion of intraperitoneal recurrence, intra-operative tumor cells spillage to vagina stump and pelvic cavity might be the explanation.

Combinatorial ASO-mediated therapy with low dose SMN and the protective modifier Chp1 is not sufficient to ameliorate SMA pathology hallmarks.

Spinal muscular atrophy (SMA) is a devastating genetically inherited neuromuscular disorder characterized by the progressive loss of motor neurons in the spinal cord, leading to muscle atrophy and weakness. Although SMA is caused by homozygous mutations in SMN1, the disease severity is mainly determined by the copy number of SMN2, an almost identical gene that produces ~10% correctly spliced SMN transcripts. Recently, three FDA- and EMA-approved therapies that either increase correctly spliced SMN2 transcripts (nusinersen and risdiplam) or replace SMN1 (onasemnogen abeparvovec-xioi) have revolutionized the clinical outcome in SMA patients. However, for severely affected SMA individuals carrying only two SMN2 copies even a presymptomatic therapy might be insufficient to fully counteract disease development. Therefore, SMN-independent compounds supporting SMN-dependent therapies represent a promising therapeutic approach. Recently, we have shown a significant amelioration of SMA disease hallmarks in a severely affected SMA mouse carrying a mutant Chp1 allele when combined with low-dose of SMN antisense oligonucleotide (ASO) treatment. CHP1 is a direct interacting partner of PLS3, a strong protective modifier of SMA. Both proteins ameliorate impaired endocytosis in SMA and significantly restore pathological hallmarks in mice. Here, we aimed to pharmacologically reduce CHP1 levels in an ASO-based combinatorial therapy targeting SMN and Chp1. Chp1 modulation is a major challenge since its genetic reduction to ~50% has shown to ameliorate SMA pathology, while the downregulation below that level causes cerebellar ataxia. Efficacy and tolerability studies determined that a single injection of 30 µg Chp1-ASO4 in the CNS is a safe dosage that significantly reduced CHP1 levels to ~50% at postnatal day (PND)14. Unfortunately, neither electrophysiological predictors such as compound muscle action potential (CMAP) or motor unit number estimation (MUNE) nor histological hallmarks of SMA in neuromuscular junction (NMJ), spinal cord or muscle were ameliorated in SMA mice treated with Chp1-ASO4 compared to CTRL-ASO at PND21. Surprisingly, CHP1 levels were almost at control level 4-weeks post injection, indicating a rather short-term effect of the ASO. Therefore, we re-administrated Chp1-ASO4 by i.c.v. bolus injection at PND28. However, no significant improvement of SMA hallmarks were seen at 2 month-of-age either. In conclusion, in contrast to the protective effect of genetically-induced Chp1 reduction on SMA, combinatorial therapy with Chp1- and SMN-ASOs failed to significantly ameliorate the SMA pathology. Chp1-ASOs compared to SMN-ASO proved to have rather short-term effect and even reinjection had no significant impact on SMA progression, suggesting that further optimization of the ASO may be required to fully explore the combination.

[Current situation and deliberating the application of open or minimally invasive surgery for the cervical cancer].

Surgery is the primary treatment for early cervical cancer. Radical hysterectomy by laparotomy and minimally invasive surgery have been widely used for years. The results of the LACC study has overturned the clinical practice of the cervical cancer, and the radical hysterectomy by laparotomy is the only standard operation. Based on the studies of laparoscopy or robot-assisted laparoscopy comparing laparotomy for the risk factors of survival outcomes, as well as a series of methods for improving oncology outcomes, it suggests that the minimally invasive surgical approach in early cervical cancer should be reconsidered. Focusing on this topic, this paper discussed the risk factors that might affect the oncology outcome of minimally invasive surgery, and analyzed the surgical indications and recurrence patterns. Hence, to promote the standardized operation of "tumor-free" in the procedure of the minimally invasive surgery might be improve the patient survival outcomes.

Effect of monensin on milk fatty acid profile in dairy cows and on the use of fatty acids for early diagnosis of elevated blood plasma concentrations of nonesterified fatty acids and hyperketonemia.

This work examined the effects of precalving administration of continuous-release monensin capsule on postcalving milk fatty acid (FA) profile and on the accuracy of FA as a biomarker in the early identification of cows with elevated blood plasma nonesterified fatty acids (NEFA) and ß-hydroxybutyrate (BHB) concentrations. Approximately 3 wk before expected calving, 203 multiparous Estonian Holstein cows were randomly divided into control (CO; n = 116) and experimental (MO; n = 87) groups, and a continuous-release capsule of monensin was administered to the MO cows. Blood samples were taken daily in the first 4 d postpartum, then on the sixth or seventh day in milk, twice in the second week, and thenceforth once per week until the end of the sixth week. Milk samples were taken once from 4 to 7 d in milk, twice in the second week, and thenceforth once per week. Blood samples were analyzed for NEFA and BHB, and milk was analyzed for FA concentrations. Cows with postpartum BHB concentrations ≥1.2 mmol/L at least once during the 6 wk were classified as hyperketonemic (HYK), and cows with NEFA concentrations ≥1.0 mmol/L as having elevated concentration of NEFA (NEFAH). The ability of FA to predict NEFAH and HYK cows was studied with logistic regression and receiver operating characteristic curve analysis and the identification accuracy was estimated by area under the receiver operating characteristic curve. For these analyses, we used FA measured on the ninth day after calving. Monensin administration affected FA mobilization and metabolism of the animals as blood NEFA were lower in the MO group on wk 1 and wk 3, and BHB values were considerably lower from wk 1 to wk 4 compared with the CO group. The FA dynamics were generally similar for MO and CO groups. Monensin administration resulted in higher concentrations of C15:0, C16:0, iso C17:0, anteiso C15:0, anteiso C17:0, total trans monounsaturated FA, and C18:2 cis-9,trans-11, and lower proportions of C18:0, C18:1 cis-9, and most of the iso FA. The identification accuracy of NEFAH and HYK cows was higher in the CO compared with the MO group and for the identification of HYK compared with NEFAH cows (0.75-0.77 vs. 0.78-0.80 in the CO group, and 0.61-0.66 vs. 0.68-0.75 in the MO group for NEFAH vs. HYK, respectively). For all FA, the threshold values to identify NEFAH and HYK cows were different in the CO and MO groups. Results suggest that specific threshold values for the identification of NEFAH and HYK cows could be applicable only within similar feeding conditions and rumen environment.

Body condition and insulin resistance interactions with periparturient gene expression in adipose tissue and lipid metabolism in dairy cows.

Adipose tissue plays an important role in a cow's ability to adapt to the metabolic demands of lactation, because of its central involvement in energy metabolism and immunity. High adiposity and adipose tissue resistance to insulin are associated with excessive lipid mobilization. We hypothesized that the response to a glucose challenge differs between cows of different body condition 21 d before and after calving and that the responses are explainable by gene expression in subcutaneous adipose tissue (SAT). In addition, we aimed to investigate insulin resistance with gene expression in SAT and lipid mobilization around parturition. Multiparous Holstein cows were grouped according to body conditions score (BCS) 4 wk before calving, as follows: BCS ≤ 3.0 = thin (T, n = 14); BCS 3.25 to 3.5 = optimal (O, n = 14); BCS ≥ 3.75 = over-conditioned (OC, n = 14). We collected SAT on d -21 and d 21 relative to calving. A reverse-transcriptase quantitative (RT-q)PCR was used to measure gene expression related to lipid metabolism. One hour after the collection of adipose tissue, an intravenous glucose tolerance test was carried out, with administration of 0.15 g of glucose per kg of body weight (with a 40% glucose solution). Once weekly from the first week before calving to the third week after calving, a blood sample was taken. The transition to lactation was associated with intensified release of energy stored in adipose tissue, a decrease in the lipogenic genes lipoprotein lipase (LPL) and diacylglycerol O-acyltransferase 2 (DGAT2), and an increase in the lipolytic gene hormone-sensitive lipase (LIPE). On d -21, compared with T cows, OC cows had lower mRNA abundance of LPL and DGAT2, and the latency of fatty acid response after glucose infusion was also longer (8.5 vs. 23.3 min) in OC cows. Cows with higher insulin area under the curve on d -21 had concurrently lower LPL and DGAT2 gene expression and greater concentration of fatty acids on d -7, d 7, and d 14. In conclusion, high adiposity prepartum lowers the whole-body lipid metabolism response to insulin and causes reduced expression of lipogenic genes in SAT 3 weeks before calving. In addition, more pronounced insulin release after glucose infusion on d -21 is related to higher lipid mobilization around calving, indicating an insulin-resistant state, and is associated with lower expression of lipogenic genes in SAT.

[Oncologic outcomes of early stage cervical cancer performed operation by different laparoscopic surgical procedures: analysis of clinical data from mutiple centers].

Objective: To evaluate the oncologic outcomes of different laparoscopic radical hysterectomy. Methods: From January 2011 to December 2014, the laparoscopic operation cases of cervical cancer at stage Ⅰb1, Ⅰb2, Ⅱa1 and Ⅱa2, including the histologic subtypes of squamous-cell carcinoma, adenocarcinoma and adenosquamous carcinoma, were collected in five clinical centers. The data were divided into two groups according to the surgical procedures, that is, modified laparoscopic-vaginal radical hysterectomy (mLVRH) and total laparoscopic radical hysterectomy (TLRH). The overall survival rate (OS), disease-free survival rate (DFS) at 5 years were retrospectively analyzed in this study. Results: There were 674 cases in total, including 377 cases of mLVRH, 297 cases of TLRH. (1) The OS at 5 years: the mLVRH was 96.1% and the TLRH was 92.0%, and the mLVRH was higher than that of TLRH （P=0.010）. Stratify analysis， including stage of disease （Ⅰb1 and Ⅱa1）， histologic subtypes （squamous-cell carcinoma, adenocarcinoma）， lymph node metastasis， revealed that, ① Stage of disease: in stage Ⅰb1, the OS at five years of mLVRH was higher than that in TLRH group （98.6% vs 93.6%, P=0.012）. In stage Ⅱa1, there was significant difference between the two groups, the OS at five years of mLVRH and TLRH were 93.6% and 77.6% （P=0.007）. ② Histologic subtypes: for the OS at five years of squamous-cell carcinoma, mLVRH and TLRH were 96.1% and 92.3%, and there was significant difference （P=0.046）； for adenocarcinoma, the OS at five years were 91.0% and 88.6%， and there was no difference between two groups （P=0.230）. ③ Lymph node metastasis： the mLVRH and TLRH with lymph node metastasis, the OS at five years were 98.6% and 96.4%; the mLVRH and TLRH without lymph node metastasis, the OS at five years were 89.3% and 80.8%. There were no significant differences between the two groups,respectively (P=0.156， P=0.093）. (2) The DFS at 5 years: there was no significant difference between mLVRH and TLRH (94.1% vs 90.9%, P=0.220). Stratify analysis for stage of disease, the mLVRH group was higher than that in the TLRH group in stage Ⅰb1 (97.0% vs 92.8%, P=0.039). However, for stage Ⅱa1, there was no significant difference between mLVRH and TLRH group （88.2% vs 75.8%, P=0.074）. Conclusions: The results of this retrospective study indicated that different laparoscopy surgical procedures had diverse oncologic outcomes. The OS at 5 years of the mLVRH is superior to the TLRH. The DFS at 5 years in Ⅰb1 stage, the mLVRH is higher than the TLRH. Therefore, the modified laparoscopy is still an alternative surgery for early cervical cancer patients when following the principle of no-tumor-exposure.

Influence of functional food components on gut health.

Intestinal epithelial cells (IECs) lining the gastrointestinal tract establish a barrier between external environments and the internal milieu. An intact intestinal barrier maintains gut health and overall good health of the body by preventing from tissue injury, pathogen infection and disease development. When the intestinal barrier function is compromised, bacterial translocation can occur. Our gut microbiota also plays a fundamentally important role in health, for example, by maintaining intestinal barrier integrity, metabolism and modulating the immune system, etc. Any disruption of gut microbiota composition (also termed dysbiosis) can lead to various pathological conditions. In short, intestinal barrier and gut microbiota are two crucial factors affecting gut health. The gastrointestinal tract is a complex environment exposed to many dietary components and commensal bacteria. Dietary components are increasingly recognized to play various beneficial roles beyond basic nutrition, resulting in the development of the functional food concepts. Various dietary modifiers, including the consumption of live bacteria (probiotics) and ingestible food constituents such as prebiotics, as well as polyphenols or synbiotics (combinations of probiotics and prebiotics) are the most well characterized dietary bioactive compounds and have been demonstrated to beneficially impact the gut health and the overall well-being of the host. In this review we depict the roles of intestinal epithelium and gut microbiota in mucosal defence responses and the influence of certain functional food components on the modulation of gut health, with a particular focus on probiotics, prebiotics and polyphenols.

Effects of human rhinovirus on epithelial barrier integrity and function in children with asthma.

BACKGROUND: Bronchial epithelial tight junctions (TJ) have been extensively assessed in healthy airway epithelium. However, no studies have yet assessed the effect of human rhinovirus (HRV) infection on the expression and resultant barrier function in epithelial tight junctions (TJ) in childhood asthma. OBJECTIVES: To investigate the impact of HRV infection on airway epithelial TJ expression and barrier function in airway epithelial cells (AECs) of children with and without asthma. Furthermore, to test the hypothesis that barrier integrity and function is compromised to a greater extent by HRV in AECs from asthmatic children. METHODS: Primary AECs were obtained from children with and without asthma, differentiated into air-liquid interface (ALI) cultures and infected with rhinovirus. Expression of claudin-1, occludin and zonula occluden-1 (ZO-1) was assessed via qPCR, immunocytochemistry (ICC), in-cell western (ICW) and confocal microscopy. Barrier function was assessed by transepithelial electrical resistance (TER; RT ) and permeability to fluorescent dextran. RESULTS: Basal TJ gene expression of claudin-1 and occludin was significantly upregulated in asthmatic children compared to non-asthmatics; however, no difference was seen with ZO-1. Interestingly, claudin-1, occludin and ZO-1 protein expression was significantly reduced in AEC of asthmatic children compared to non-asthmatic controls suggesting possible post-transcriptional inherent differences. HRV infection resulted in a transient dissociation of TJ and airway barrier integrity in non-asthmatic children. Although similar dissociation of TJ was observed in asthmatic children, a significant and sustained reduction in TJ expression concurrent with both a significant decrease in TER and an increase in permeability in asthmatic children was observed. CONCLUSION: This study demonstrates novel intrinsic differences in TJ gene and protein expression between AEC of children with and without asthma. Furthermore, it correlates directly the relationship between HRV infection and the resultant dissociation of epithelial TJ that causes a continued altered barrier function in children with asthma.

Adipose tissue insulin receptor and glucose transporter 4 expression, and blood glucose and insulin responses during glucose tolerance tests in transition Holstein cows with different body condition.

Glucose uptake in tissues is mediated by insulin receptor (INSR) and glucose transporter 4 (GLUT4). The aim of this study was to examine the effect of body condition during the dry period on adipose tissue mRNA and protein expression of INSR and GLUT4, and on the dynamics of glucose and insulin following the i.v. glucose tolerance test in Holstein cows 21 d before (d -21) and after (d 21) calving. Cows were grouped as body condition score (BCS) ≤3.0 (thin, T; n = 14), BCS = 3.25 to 3.5 (optimal, O; n = 14), and BCS ≥3.75 (overconditioned, OC; n = 14). Blood was analyzed for glucose, insulin, fatty acids, and ß-hydroxybutyrate concentrations. Adipose tissue was analyzed for INSR and GLUT4 mRNA and protein concentrations. During the glucose tolerance test 0.15 g/kg of body weight glucose was infused; blood was collected at -5, 5, 10, 20, 30, 40, 50, and 60 min, and analyzed for glucose and insulin. On d -21 the area under the curve (AUC) of glucose was smallest in group T (1,512 ± 33.9 mg/dL × min) and largest in group OC (1,783 ± 33.9 mg/dL × min), and different between all groups. Basal insulin on d -21 was lowest in group T (13.9 ± 2.32 µU/mL), which was different from group OC (24.9 ± 2.32 µU/mL. On d -21 the smallest AUC 5-60 of insulin in group T (5,308 ± 1,214 µU/mL × min) differed from the largest AUC in group OC (10,867 ± 1,215 µU/mL × min). Time to reach basal concentration of insulin in group OC (113 ± 14.1 min) was longer compared with group T (45 ± 14.1). The INSR mRNA abundance on d 21 was higher compared with d -21 in groups T (d -21: 3.3 ± 0.44; d 21: 5.9 ± 0.44) and O (d -21: 3.7 ± 0.45; d 21: 4.7 ± 0.45). The extent of INSR protein expression on d -21 was highest in group T (7.3 ± 0.74 ng/mL), differing from group O (4.6 ± 0.73 ng/mL), which had the lowest expression. The amount of GLUT4 protein on d -21 was lowest in group OC (1.2 ± 0.14 ng/mL), different from group O (1.8 ± 0.14 ng/mL), which had the highest amount, and from group T (1.5 ± 0.14 ng/mL). From d -21 to 21, a decrease occurred in the GLUT4 protein levels in both groups T (d -21: 1.5 ± 0.14 ng/mL; d 21: 0.8 ± 0.14 ng/mL) and O (d -21: 1.8 ± 0.14 ng/mL; d 21: 0.8 ± 0.14 ng/mL). These results demonstrate that in obese cows adipose tissue insulin resistance develops prepartum and is related to reduced GLUT4 protein synthesis. Regarding glucose metabolism, body condition did not affect adipose tissue insulin resistance postpartum.

Distributed State Estimation Using a Modified Partitioned Moving Horizon Strategy for Power Systems.

In this paper, a distributed state estimation method based on moving horizon estimation (MHE) is proposed for the large-scale power system state estimation. The proposed method partitions the power systems into several local areas with non-overlapping states. Unlike the centralized approach where all measurements are sent to a processing center, the proposed method distributes the state estimation task to the local processing centers where local measurements are collected. Inspired by the partitioned moving horizon estimation (PMHE) algorithm, each local area solves a smaller optimization problem to estimate its own local states by using local measurements and estimated results from its neighboring areas. In contrast with PMHE, the error from the process model is ignored in our method. The proposed modified PMHE (mPMHE) approach can also take constraints on states into account during the optimization process such that the influence of the outliers can be further mitigated. Simulation results on the IEEE 14-bus and 118-bus systems verify that our method achieves comparable state estimation accuracy but with a significant reduction in the overall computation load.

Impaired airway epithelial cell responses from children with asthma to rhinoviral infection.

BACKGROUND: The airway epithelium forms an effective immune and physical barrier that is essential for protecting the lung from potentially harmful inhaled stimuli including viruses. Human rhinovirus (HRV) infection is a known trigger of asthma exacerbations, although the mechanism by which this occurs is not fully understood. OBJECTIVE: To explore the relationship between apoptotic, innate immune and inflammatory responses to HRV infection in airway epithelial cells (AECs) obtained from children with asthma and non-asthmatic controls. In addition, to test the hypothesis that aberrant repair of epithelium from asthmatics is further dysregulated by HRV infection. METHODS: Airway epithelial brushings were obtained from 39 asthmatic and 36 non-asthmatic children. Primary cultures were established and exposed to HRV1b and HRV14. Virus receptor number, virus replication and progeny release were determined. Epithelial cell apoptosis, IFN-ß production, inflammatory cytokine release and epithelial wound repair and proliferation were also measured. RESULTS: Virus proliferation and release was greater in airway epithelial cells from asthmatics but this was not related to the number of virus receptors. In epithelial cells from asthmatic children, virus infection dampened apoptosis, reduced IFN-ß production and increased inflammatory cytokine production. HRV1b infection also inhibited wound repair capacity of epithelial cells isolated from non-asthmatic children and exaggerated the defective repair response seen in epithelial cells from asthmatics. Addition of IFN-ß restored apoptosis, suppressed virus replication and improved repair of airway epithelial cells from asthmatics but did not reduce inflammatory cytokine production. CONCLUSIONS: Collectively, HRV infection delays repair and inhibits apoptotic processes in epithelial cells from non-asthmatic and asthmatic children. The delayed repair is further exaggerated in cells from asthmatic children and is only partially reversed by exogenous IFN-ß.

First Report of Tomato chlorotic spot virus Infecting Tomatoes in Ohio.

Virus-like symptoms including deformation, discoloration, and necrotic ringspots on green and red fruits of tomato (Solanum lycopersicum L. cv. Big Dena) were observed in a 400 m2 commercial high tunnel in Wayne Co., Ohio, in July and August 2013. No symptoms were observed on leaves. Incidence of symptomatic fruits was approximately 15%. Tomato seedlings transplanted into the high tunnel were produced in a greenhouse containing ornamental plants. The grower observed high levels of thrips infestation in the tomato seedlings prior to transplanting. A tospovirus was suspected as a possible causal agent. Four symptomatic fruits were tested using immunostrip tests for Tomato spotted wilt virus (TSWV) and Impatiens necrotic spot virus (INSV) (Agdia, Inc., Elkhart, IN), a double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) for Groundnut ringspot virus (GRSV)/Tomato chlorotic spot virus (TCSV) (Agdia, Inc., Elkhart, IN), and DAS-ELISA for TCSV (AC Diagnostics Inc., Fayetteville, AR). All of the symptomatic fruits tested negative with Agdia immunostrips and positive with the Agdia and AC Diagnostics DAS-ELISAs. Total RNA was extracted from one ELISA-positive sample using TRIZOL Reagent (Life Technologies, Carlsbad, CA) and tested in RT-PCR using GRSV- or TCSV-specific primers (2). An expected RT-PCR product was generated using primers derived from TCSV S-RNA (JAP885, 5'-CTCGGTTTTCTGCTTTTC-3' and JAP886, 5'CGGACAGGCTGGAGAAATCG3') (~290 bp) but not when using primers specific to GRSV S-RNA (JAP887, 5'-CGTATCTGAGGATGTTGAGT-3' and JAP888, 5'-GCTAACTCCTTGTTCTTTTG-3'). The 290-bp RT-PCR product was cloned using a TOPO TA cloning kit (Life Technologies, Grand Island, NY), and six clones were sequenced. Sequences from three clones were identical to a consensus sequence of a 292-bp fragment covering part of the TCSV nucleocapsid gene (GenBank Accession No. KJ744213). Sequences of the remaining three clones contained one, two, or three nucleotide mutations. To confirm the presence of TCSV in this sample, two newly designed primers flanking the entire nucleocapsid protein gene (TCSV-F1, 5'-AGTATTATGCATCTATAGATTAGCACA-3' and TCSV-R1, 5'-ACAAATCATCACATTGCCAGGA-') were used in RT-PCR to generate an expected 948-bp product. Upon cloning and sequencing, this fragment was shown to contain a full nucleocapsid protein gene of TCSV (GenBank Accession No. KM610235). The fragment contained a sequence identical to the first 292-bp RT-PCR product. BLASTn analysis (National Center for Biotechnology Information database) showed that the large fragment sequence had 98% nucleotide sequence identity to the TCSV Florida isolate (GenBank Accession No. JX244196) and 94% to the TCSV Physalis isolate (GenBank Accession No. JQ034525). Tobacco plants were inoculated mechanically with sap from symptomatic tomato fruits. Necrotic local lesions developed, and the presence of TCSV was confirmed using AC Diagnostics' DAS-ELISA. TCSV has been reported in Brazil (1), Puerto Rico (3), and Florida (2). To our knowledge, this is the first report of TCSV infecting tomatoes in Ohio. Because TCSV is transmitted by thrips and has a broad host range, this emerging virus could pose a significant threat to the U.S. vegetable industry. References: (1) A. Colariccio et al. Fitopatol. Bras. 20:347, 1995. (2) A. Londoño et al. Trop. Plant Pathol. 37:333, 2012. (3) C. G. Webster et al. Plant Health Progress doi:10.1094/PHP-2013-0812-01-BR, 2013.

Curative effect of combined lamivudine, adefovir dipivoxil, and stem cell transplantation on decompensated hepatitis B cirrhosis.

This study assessed the clinical efficacy of lamivudine and adefovir dipivoxil combined with autologous bone marrow stem cell transplantation as treatment for patients with hepatitis B and decompensated liver cirrhosis. In total, 77 patients with hepatitis B and decompensated liver cirrhosis were randomly divided into two groups. Under general symptomatic and supportive treatment, the patients in group A (37 cases) were treated with lamivudine and adefovir dipivoxil, whereas those in group B (40 cases) were treated with autologous bone marrow stem cell transplantation in combination with lamivudine and adefovir dipivoxil. After 4 weeks of treatment, the liver function indicators and clinical signs and symptoms of the patients in group B improved more significantly than those of patients in group A. Lamivudine and adefovir dipivoxil in combination with autologous bone marrow stem cell transplantation effectively prevented hepatitis B virus infection and bone marrow stem cell damage. This combination treatment facilitates the differentiation of bone marrow stem cells into normal liver cells to restore liver structure and improve liver function, thereby improving the quality of life of patients.

First Report of Cucumber green mottle mosaic virus Infecting Greenhouse Cucumber in Canada.

In early 2013, greenhouse cucumber growers in Alberta, Canada, observed virus-like disease symptoms on mini-cucumber (Cucumis sativus) crops (e.g., 'Picowell'). Two types of symptoms were commonly observed, green mottle mosaic and necrotic spots. In the early infection, young leaves of infected cucumber plants displayed light green mottle and blisters. The infected plants were stunted in growth, with darker green blisters and green mottle mosaic symptoms on mature leaves. Disease incidence varied from one greenhouse to another. In some severe cases, diseased plants were widely distributed inside the greenhouse, resulting in 10 to 15% yield losses based on grower's estimation. Nine symptomatic samples were collected and subjected to total RNA isolation using the TRIzol reagent (Invitrogen, Carlsbad, CA). Laboratory analyses were conducted using real-time RT-PCR systems for Cucumber green mottle mosaic virus (CGMMV) (1), Melon necrotic spot virus (MNSV, Ling, unpublished), and Squash mosaic virus (SqMV) (3). All nine samples were positive for CGMMV and seven of them were in mixed infections with MNSV. Two samples were selected for validation for the presence of CGMMV using conventional RT-PCR (2) with a new primer set (CGMMVMP F1: 5'-ATGTCTCTAAGTAAGGTGTC-3' and CGMMV3'UTR R1: 5'-TGGGCCCCTACCCGGGG-3') and two previous online published primer sets, one for CGMMV MP (5' TAAGTTTGCTAGGTGTGATC-3', GenBank Accession No. AJ250104 and 5' ACATAGATGTCTCTAAGTAAG-3', AJ250105), and another for CGMMV CP (5' ACCCTCGAAACTAAGCTTTC-3', AJ243351 and 5' GAAGAGTCCAGTTCTGTTTC-3', AJ243352). The expected sizes of RT-PCR products were obtained and sequenced directly. Sequences from these three products overlapped and generated a 1,282-bp contig (KF683202). BLASTn analysis to the NCBI database showed 99% sequence identity to CGMMV isolates identified in Asia, including China (GQ277655, KC852074), India (DQ767631), Korea (AF417243), Myanmar (AB510355), and Taiwan (HQ692886), but only 92% sequence identity to other CGMMV isolates identified in Europe, including Spain (GQ411361) and Russia (GQ495274), and 95% to CGMMV isolate from Israel (KF155231). The strong sequence identity to the CGMMV Asian isolates suggests that the Canadian CGMMV isolate identified in Alberta was likely of Asian origin. In two bioassay experiments using one sample prepared in 0.01 M phosphate buffer, the similar green mottle mosaic symptoms were observed on systemic leaves in the mechanically inoculated plants and the presence of CGMMV, but not MNSV, was confirmed through real-time RT-PCR on four different cucurbits, including three Cucumis sativus cultivars (six plants in 'Marketer,' five plants in 'Poinsett 76,' six plants in 'Straight 8'), seven plants of C. melo 'Athena,' six plants of C. metulifer (PI201681), and two plants of Citrullus lanatus 'Charleston Gray.' To our knowledge, CGMMV has only been reported in Asia, Europe, and the Middle East, and this is the first report of CGMMV in the American continents. CGMMV is highly contagious and is seed borne on cucurbits. With the increasing trend in growing grafted watermelon and other cucurbits in the United States and elsewhere, it is even more important now that a vigilant seed health test program for CGMMV should be implemented. References: (1) H. Chen et al. J. Virol. Methods 149:326, 2008. (2) K.-S. Ling et al. Plant Dis. 92:1683, 2008. (3) K.-S. Ling et al. J. Phytopathol. 159:649, 2011.

First Report of Potato spindle tuber viroid Naturally Infecting Field Tomatoes in the Dominican Republic.

In recent years, viroid disease outbreaks have resulted in serious economic losses to a number of tomato growers in North America (1,2,3). At least three pospiviroids have been identified as the causal agents of tomato disease, including Potato spindle tuber viroid (PSTVd), Tomato chlorotic dwarf viroid (TCDVd), and Mexican papita viroid (MPVd). In the spring of 2013, a severe disease outbreak with virus-like symptoms (chlorosis and plant stunting) was observed in a tomato field located in the Dominican Republic, whose tomato production is generally exported to the United States in the winter months. The transplants were produced in house. The disease has reached an epidemic level with many diseased plants pulled and disposed of accordingly. Three samples collected in May of 2013 were screened by ELISA against 16 common tomato viruses (Alfalfa mosaic virus, Cucumber mosaic virus, Impatiens necrotic spot virus, Pepino mosaic virus, Potato virus X, Potato virus Y, Tobacco etch virus, Tobacco mosaic virus, Tobacco ringspot virus, Tomato aspermy virus, Tomato bushy stunt virus, Tomato mosaic virus, Tomato ringspot virus, Tomato spotted wilt virus, Groundnut ringspot virus, and Tomato chlorotic spot virus), a virus group (Potyvirus group), three bacteria (Clavibacter michiganensis subsp. michiganensis, Pectobacterium atrosepticum, and Xanthomonas spp.), and Phytophthora spp. No positive result was observed, despite the presence of symptoms typical of a viral-like disease. Further analysis by RT-PCR using Agdia's proprietary pospiviroid group-specific primer resulted in positive reactions in all three samples. To determine which species of pospiviroid was present in these tomato samples, full-genomic products of the expected size (~360 bp) were amplified by RT-PCR using specific primers for PSTVd (4) and cloned using TOPO-TA cloning kit (Invitrogen, CA). A total of 8 to 10 clones from each isolate were selected for sequencing. Sequences from each clone were nearly identical and the predominant sequence DR13-01 was deposited in GenBank (Accession No. KF683200). BLASTn searches into the NCBI database demonstrated that isolate DR13-01 shared 97% sequence identity to PSTVd isolates identified in wild Solanum (U51895), cape gooseberry (EU862231), or pepper (AY532803), and 96% identity to the tomato-infecting PSTVd isolate from the United States (JX280944). The relatively lower genome sequence identity (96%) to the tomato-infecting PSTVd isolate in the United States (JX280944) suggests that PSTVd from the Dominican Republic was likely introduced from a different source, although the exact source that resulted in the current disease outbreak remains unknown. It may be the result of an inadvertent introduction of contaminated tomato seed lots or simply from local wild plants. Further investigation is necessary to determine the likely source and route of introduction of PSTVd identified in the current epidemic. Thus, proper control measures could be recommended for disease management. The detection of this viroid disease outbreak in the Dominican Republic represents further geographic expansion of the viroid disease in tomatoes beyond North America. References: (1). K.-S. Ling and M. Bledsoe. Plant Dis. 93:839, 2009. (2) K.-S. Ling and W. Zhang. Plant Dis. 93:1216, 2009. (3) K.-S. Ling et al. Plant Dis. 93:1075, 2009. (4) A. M. Shamloul et al. Can. J. Plant Pathol. 19:89, 1997.

Alterations in milk metabolome and coagulation ability during the lactation of dairy cows.

Milk composition has been known to change during lactation. To help understand the changes in metabolic profile throughout the whole lactation, liquid chromatography mass-spectrometry was used to analyze 306 milk samples from 82 primi- and multiparous dairy cows. Changes in metabolic profile common to all cows throughout lactation were ascertained based on principal component and general linear model analysis. Sets of specific markers; for instance, 225, 397, and 641-642 m/z (positive mode), and 186, 241, and 601-604 (negative mode), with at least a 1.5-fold higher intensity during the first 60 d compared with the last 60 d of lactation were observed. The metabolome was affected by parity and milking time. Markers, identified as peptides differentiating parity, were observed. A significant increase for citrate was observed in evening milk. Milk coagulation traits were strongly animal specific. The curd firmness values were influenced by milking time. Sets of markers were associated with curd firmness in positive (197 m/z) and negative (612, 737, 835, 836, 902, 1000, 1038, and 1079 m/z) ion mode.

First Report of Potato spindle tuber viroid Naturally Infecting Greenhouse Tomatoes in North Carolina.

In spring 2012, a severe disease was observed on a limited number of tomato plants (Solanum lycopersicum L.) in a research greenhouse facility in western North Carolina. The first symptoms noted were downward curling of the terminal leaves accompanied by a rough puckered darker green texture. This was followed in time by greater distortion of the leaves with pale green on leaf margins. Older leaves with symptoms developed necrosis, with necrotic spots and streaks appearing on a few fruits. On some of these affected fruits, stems, peduncles, pedicels, and sepals also showed symptoms. Infected plants were badly stunted, and fruits in the upper parts of plants displaying severe symptoms remained very small. In just a few months, the disease spread to other tomato plants inside the greenhouse. A survey in May 2012 showed a disease incidence of 18% (156 symptomatic plants out of a total of 864) in this greenhouse. Initial screenings for possible viruses using ELISA (Agdia, Elkhart, IN), as well as a reverse transcription (RT)-PCR panel of 15 common tomato viruses in our laboratory were negative. Because of the symptoms and negative results for viruses, a viroid infection was suspected. Total plant RNA was prepared using TRIzol reagent (Invitrogen, Carlsbad, CA) from leaf tissues of eight diseased plants and one seed sample. Using real-time RT-PCR developed against Potato spindle tuber viroid (PSTVd) and some related pospiviroids (1), positive signals were observed with a mean Ct = 13.24 for leaf tissues and Ct = 19.91 for the seed sample. To obtain a full viroid genome, RT-PCR using two different sets of primers, one specific for PSTVd (PSTVd-F and PSTVd-R) (2), and a universal primer set for pospiviroids (MTTVd-F and MTTVd-R) (3) was performed. RT-PCR generated amplicons with expected size of ~360 bp from all eight leaf and one seed samples, but not from a healthy control. PCR products were cloned using the TOPO TA cloning kit (Invitrogen, Carlsbad, CA). A total of 22 full genomic sequences were obtained. A multi-sequence alignment generated a consensus sequence of 360 nt, designated as NC12-01 (GenBank Accession No. JX280944). BLASTn search in the NCBI database revealed the highest sequence identity of 96.9% to Australian (AY962324) and UK (AJ583449) isolates of PSTVd and 95.9% identity to the tomato isolate of PSTVd-CA1 (HM753555). Similar disease symptoms were observed on two 'Rutgers' tomato plants 2 weeks post mechanical inoculation and the presence of PSTVd was confirmed by real-time RT-PCR (1). A mock-inoculated plant did not show any symptoms. In the U.S., natural infection of PSTVd on tomato was first identified in California in 2010 (3). To our knowledge, this is the first report of a natural occurrence of PSTVd on tomato in the eastern U.S. The diseased plants were contained, properly disposed of, and eradicated in this location. The broader geographic distribution of PSTVd on tomato in the U.S., and the potential latent infection in potato and a number of ornamentals (4), emphasizes the need for better plant and seed health tests for viroids on these plants. References: (1) N. Boonham et al. J. Virol. Methods 116:139, 2004. (2) H. Bostan et al. J. Virol. Methods 116:189, 2004. (3) K.-S. Ling and D. Sfetcu. Plant Dis. 94:1376, 2010. (4) R. A. Owens and J. Th. J. Verhoeven. The Plant Health Instructor. DOI: 10.1094/PHI-I-2009-0804-01, 2009.

Development and Field Evaluation of Multiple Virus-Resistant Bottle Gourd (Lagenaria siceraria).

In an effort to develop bottle gourd (Lagenaria siceraria) as a widely adapted rootstock for watermelon grafting, we sought to identify lines with broad resistance to several cucurbit viruses that are economically important in the United States. Preliminary analysis under greenhouse conditions indicated that the currently available commercial watermelon rootstocks were either highly susceptible or somewhat tolerant to one or more viruses. However, in greenhouse screening, several breeding lines of bottle gourd displayed broad-spectrum resistance to four viruses tested, including Zucchini yellow mosaic virus, Watermelon mosaic virus (WMV), Papaya ringspot virus watermelon strain (PRSV-W), and Squash vein yellowing virus. Resistance to PRSV-W and WMV was confirmed through field trials in two consecutive years at two different locations in South Carolina. Two breeding lines (USVL#1-8 and USVL#5-5) with broad-spectrum virus resistance could be useful materials for watermelon rootstock development.

SOX9 directly regulates the type-II collagen gene.

Mutations in human SOX9 are associated with campomelic dysplasia (CD), characterised by skeletal malformation and XY sex reversal. During chondrogenesis in the mouse, Sox9 is co-expressed with Col2a1, the gene encoding type-II collagen, the major cartilage matrix protein. Col2a1 is therefore a candidate regulatory target of SOX9. Regulatory sequences required for chondrocyte-specific expression of the type-II collagen gene have been localized to conserved sequences in the first intron in rats, mice and humans. We show here that SOX9 protein binds specifically to sequences in the first intron of human COL2A1. Mutation of these sequences abolishes SOX9 binding and chondrocyte-specific expression of a COL2A1-driven reporter gene (COL2A1-lacZ) in transgenic mice. Furthermore, ectopic expression of Sox9 trans-activates both a COL2A1-driven reporter gene and the endogenous Col2a1 gene in transgenic mice. These results demonstrate that COL2A1 expression is directly regulated by SOX9 protein in vivo and implicate abnormal regulation of COL2A1 during, chondrogenesis as a cause of the skeletal abnormalities associated with campomelic dysplasia.

Topical insulin for healing of diabetic epithelial defects?: A retrospective review of corneal debridement during vitreoretinal surgery in Malaysian patients.

PURPOSE: To investigate whether topical insulin improves healing rate of corneal epithelial erosions induced during vitreoretinal surgery in diabetics. METHODS: We retrospectively reviewed case notes and serial post-operative photographs of 15 eyes of 14 patients who had corneal epithelial debridement performed during various vitreoretinal surgeries to improve one surgeon's view over a 10 month period in 2010. RESULTS: Three groups were identified: DTI, comprising diabetics who received topical insulin 1 unit qds postoperatively (n=5); DCT comprising diabetics treated with conventional post-operative medications only (n=5) and NDCT comprising non diabetic patients on conventional post operative therapy (n=5). Only eyes in which the corneal epithelial defect had been serially photographed at time, t= 0, 12, 24, 36, 48, 60, 72 and 120 hours following commencement of topical medications were included. The size of the defect was calculated using local software. DTI eyes had a significantly smaller defect size at t= 24 (p=0.009), 36 (p=0.009), 48 (p=0.015) and 60 hours (p=0.005) compared to DCT eyes and had no statistical difference from NDCT eyes at all times in the Mann Whitney U analysis (p>0.05). In the diabetic operated bilaterally, the insulin treated eye re-epithelialised by 48 hours whereas fellow eye treated conventionally re-epithelialised in 72 hours. CONCLUSIONS: Topical insulin or insulin eye drops 1 unit qds may be applied to the corneal surface to normalize the rate of healing of epithelial defects in diabetic patients undergoing epithelial debridement to improve the surgeon's view.