A novel strategy for improving bowel preparation based on social software-enhanced education: A prospective, multicenter, randomized controlled study.

BACKGROUND AND AIM: The compliance and timeliness of oral laxatives have always been the key factors restricting bowel preparation (BP). We have constructed a novel enhanced-educational content and process based on social software (SS) for BP to optimize these issues. METHODS: A multicenter, prospective, randomized controlled study was conducted at 13 hospitals in China from December 2019 to December 2020. A total of 1774 enrollees received standard instructions for BP and were randomly assigned (1:1) to the SS group (SSG) that received a smartphone-based enhanced-education strategy starting 4 h before colonoscopy or the control group (CG). RESULTS: A total of 3034 consecutive outpatient colonoscopy patients were assessed for eligibility, and 1774 were enrolled and randomly assigned. Ultimately, data from 1747 (SSG vs CG: 875 vs 872) enrollees were collected. The BP adequacy rate was 92.22% (95% CI: 90.46-93.98) in the SSG vs 88.05% (95% CI: 85.91-90.18) in the CG (P = 0.005), and the total Boston Bowel Preparation Scale scores (6.89 ± 1.15 vs 6.67 ± 1.15, P < 0.001) of those in the SSG were significantly higher than those in the CG. The average number of polyps detected in the SSG was considerably higher than that in the CG (0.84 ± 2.00 vs 0.53 ± 1.19, P = 0.037), and the average diameter of the polyps was significantly lower than that of the control group (4.0 ± 2.5 vs 4.9 ± 3.7, P < 0.001). CONCLUSIONS: This SS-enhanced education strategy can improve the BP adequacy rate and increase the average number of polyps detected, especially those of small diameter.

Changes of gut microbiota and short chain fatty acids in patients with Peutz-Jeghers syndrome.

Peutz-Jeghers Syndromeis a rare autosomal dominant genetic disease characterized by gastrointestinal hamartomatous polyps and skin and mucous membrane pigmentation. The pathogenesis of PJS remains unclear; however, it may be associated with mutations in the STK11 gene, and there is currently no effective treatment available. The gut microbiota plays an important role in maintaining intestinal homeostasis in the human body, and an increasing number of studies have reported a relationship between gut microbiota and human health and disease. However, relatively few studies have been conducted on the gut microbiota characteristics of patients with PJS. In this study, we analyzed the characteristics of the gut microbiota of 79 patients with PJS using 16 S sequencing and measured the levels of short-chain fatty acids in the intestines. The results showed dysbiosis in the gut microbiota of patients with PJS, and decreased synthesis of short-chain fatty acids. Bacteroides was positively correlated with maximum polyp length, while Agathobacter was negatively correlated with age of onset. In addition, acetic acid, propionic acid, and butyric acid were positively correlated with the age of onset but negatively correlated with the number of polyps. Furthermore, the butyric acid level was negatively correlated with the frequency of endoscopic surgeries. In contrast, we compared the gut microbiota of STK11-positive and STK11-negative patients with PJS for the first time, but 16 S sequencing analysis revealed no significant differences. Finally, we established a random forest prediction model based on the gut microbiota characteristics of patients to provide a basis for the targeted diagnosis and treatment of PJS in the future.

Endoscopic characteristics of Meckel's diverticulum in adults: a retrospective case-series from two tertiary general hospitals in China.

BACKGROUND: To analyze the diversity in endoscopic manifestations of Meckel's diverticulum (MD) in adults by using balloon-assisted enteroscopy (BAE) and supply more information on the application of BAE. METHODS: A retrospective study was carried out on adult patients diagnosed with MD by BAE in two tertiary general hospitals in China, from May 2007 to September 2021. The patients were divided into a small bowel bleeding (SBB) group and a control group according to their main symptoms. Clinical charts and endoscopic images were reviewed, analyzed, and summarized. RESULTS: Single diverticulum in the ileum and double-lumen sign were observed in all patients. The SBB group consisted of 51 patients, among which 35 cases of ulcerative lesions, 9 cases of erosive lesions, 9 cases of active bleeding/blood clots, and 4 cases of lumps inside the diverticulum were observed respectively. Majority of ulcerative lesions were inside the diverticulum (23/35). A circumferential stricture inside the diverticulum was discovered in 11 cases, and ulcerative lesions tended to occur at this structure (10/11). In the control group consisting of 15 patients, 1 case of erosive lesions at the orifice edge was observed. The percentage of patients with MD-associated ulcerative lesions was significantly higher in the SBB group than that in the control group (p < 0.001). CONCLUSIONS: The endoscopic manifestations of MD in adults are extraordinarily complex and connected with the patients' primary symptoms. The internal features of MD should be regarded as crucial observational objectives in adult patients.

Efficacy and Safety of Sirolimus for Blue Rubber Bleb Nevus Syndrome: A Prospective Study.

INTRODUCTION: Blue rubber bleb nevus syndrome (BRBNS) is a rare systemic venous malformation (VM) disease. The characteristic gastrointestinal (GI) bleeding from multiple VM lesions causes severe chronic anemia which renders most patients depend on lifelong blood transfusion and frequent endoscopic treatment with dismayed outcomes. Although recent case reports suggest that oral sirolimus (rapamycin) is effective, a comprehensive evaluation of its efficacy and safety is in need. METHODS: A prospective study was conducted for both pediatric and adult BRBNS patients with administration of sirolimus at the dose of 1.0 mg/m2 to maintain a trough concentration of 3-10 ng/mL. Laboratory tests including complete blood count, biochemical profile, D-dimer, and whole-body magnetic resonance imaging were performed at baseline and 3, 6, and 12 months after treatment. Clinical indicators such as hemoglobin level, lesion size, and transfusion need were evaluated. Adverse effects were recorded regularly. RESULTS: A total of 11 patients (4 males and 7 females) with median age of 14 (range, 5-49) years were recruited. The average lesion size was reduced by 7.4% (P < 0.001), 9.3% (P < 0.001), and 13.0% (P < 0.05) at 3, 6, and 12 months of sirolimus treatment, respectively. Hemoglobin increased significantly after 6- and 12-month treatment (P = 0.006 and 0.019, respectively). Only 1 patient received blood transfusion once during the study. Patients' quality of life and coagulation function were improved. Grade 1-2 adverse effects including oral ulcers (81.8%), acne (27.3%), transient elevation of liver enzymes (18.2%), and hair loss (9.1%) were observed. DISCUSSION: Sirolimus reduces the size of VMs, alleviates GI bleeding, and eliminates transfusion dependence of patients with BRBNS. The drug-related adverse effects are mild and mostly self-limited. These findings support sirolimus as a first-line treatment for GI and cutaneous VMs of BRBNS (see Visual abstract, Supplementary Digital Content, http://links.lww.com/AJG/B819).

Predictors for Small Bowel Stenosis in Balloon-Assisted Enteroscopy.

BACKGROUND: Predictors besides symptoms of obstruction indicating small bowel stenosis are little known. AIMS: To detect predictors of small bowel stenosis in balloon-assisted enteroscopy. METHODS: Over a 6-year period, 461 patients had enteroscopy for suspected small intestinal disease. Details of clinical manifestations, medical history, demographic characteristics, findings of examinations, information on enteroscopy, and treatment were retrospectively collected based on medical records. Small bowel stenosis was defined as stricture that over-tube cannot go through in enteroscopy. Univariate and multivariate analyses were performed to identify predictors for small bowel stenosis. RESULTS: A total of 314 patients had definite diagnosis after enteroscopy, imaging modalities, and/or even surgical exploration. They were included in this study for analyses. Mean age for them was 48.2 years old (range 15-81 years). Small bowel stenosis was present in 59 patients (18.8%). Analyses showed that CT/MRI indicating stenosis was significantly associated with severe stenosis (p = 0.014) but insignificant related to general stenosis (p = 0.097). Predictive factors that accompanied stenosis were age ≥ 60 years (OR = 2.1, 95% CI 1.1-4.0), underweight (BMI ≤ 18.5) (OR = 3.4, 95% CI 1.4-8.4), symptoms of obstruction (OR = 3.6, 95% CI 1.8-7.4), and overt small bowel bleeding (OR = 0.5, 95% CI 0.2-0.9). CONCLUSIONS: Small bowel stenosis more tended to occur to patients with symptoms of obstruction, no overt small bowel bleeding, age ≥ 60 years, or underweight.

Primary experience of small bowel polypectomy with balloon-assisted enteroscopy in young pediatric Peutz-Jeghers syndrome patients.

For Peutz-Jeghers syndrome (PJS) patients, small bowel polyps develop and result in symptoms at an early age. Balloon-assisted enteroscopy (BAE) is verified as a safe and efficient choice to evaluate and remove small intestinal polyps in adult PJS. But the safety of BAE, especially BAE-facilitated polypectomy for young pediatrics, is little known. This prospective study focused on the effectiveness and safety of BAE-facilitated polypectomy in small bowel for young pediatric PJS. PJS patients (aged 0-14 years old) with BAE (including both single-balloon and double-balloon enteroscopies) were included from 1 September 2012 to 30 April 2018. The demographic data, medical history, and details of BAE were recorded. BAE-related complications and symptom relief after BAE were evaluated and compared between the PJS patients aged 5-10 years old (the younger pediatric group) and those aged 11-14 years old (the older pediatric group). A total of 41 pediatric PJS patients (5-14 years old) subjected to 82 BAEs were included. BAE-facilitated polypectomy was performed for 33 children (80.5%), and 242 polyps in small bowel were removed. For 10 (24.4%) patients, one or more giant polyps (maximum diameter larger than 5 cm) were removed. For eight patients, no polypectomy was done as no polyps were observed (six subjects) or not suitable for BAE-facilitated polypectomy (two subjects) because of high risk of perforation. The complication rates of BAE and BAE-facilitated polypectomy were 1.2% (1/82) and 1.8% (1/55), and the symptom relief rate was 70.8% (17/24). Compared with the older pediatric group, the younger pediatric group showed no increased BAE complication rate (0.0% vs. 5.0%, p = 0.488) and a comparable rate of symptom relief after BAE therapy (80.8% vs. 55.6%, p = 0.356).Conclusion: BAE-facilitated polypectomy in young pediatric PJS is safe and effective.What is known:• Small bowel evaluation and prophetic polypectomy are important for pediatric PJS patients to avoid polyp-related intussusception, obstruction, and bleeding.• BAE polypectomy was a recommended intervention for removing small bowel polyps in adult PJS patients.What is new:• BAE-facilitated small bowel polypectomy is safe and effective for young pediatric PJS, even for those aged less than 10 years old.

Early screening the small bowel is key to protect Peutz-Jeghers syndrome patients from surgery: a novel mutation c.243delG in STK11 gene.

BACKGROUND: Peutz-Jeghers syndrome (PJS) is a Mendelian disease, whose causative gene is STK11, mainly characterized by gastrointestinal polyposis and increased cancer risk. Clinical observation reveals intussusception in childhood are more frequent and severe than in adults, and it is difficult to prevent this knotty complication. CASE PRESENTATION: A boy without a positive family history grew oral MP after birth and developed abdominal pain and bloody stood at 7 years old. Endoscopy revealed multiple polyps within the colon and the ileum, and endoscopic polypectomy and regular surveillance protected him from severe complications and open surgeries. A heterozygous deletion in STK11, c.243delG, was detected in the proband but not in his parents. This mutation has not been documented in databases. CONCLUSIONS: We suspect a child of PJS may need a more thorough endoscopic examination including enteroscopy or capsule endoscopy to take care of small bowel when PJS related symptoms comes up.

Gender, Age, and Concomitant Diseases of Colorectal Diverticulum in China: A Study of 7,964 Cases.

AIM: To analyze the epidemiological features of colorectal diverticulum (CRD) in China. METHODS: We retrospectively analyzed CRD patients in 8 tertiary hospitals located in 5 regions of China from 2000 to 2016. The detection rates, number and distribution, demographic information, concomitant disorders, and their associations were investigated. RESULTS: Of 3,446,118 cases, 7,964 (2.3%) were CRD with a mean age of 56 years (11-92 years). The detection rate increased yearly and with increasing age. Males had a higher detection rate than females (3.0 vs. 1.47%, p < 0.01) and 1.8-times higher increase rate. The detection rate increased with age; however, females of > 60 years had a 2.8-times increasing rate than males. CRD occurred most frequently in the right-side colon, followed by rectum. Multiple diverticula were common in males and increased with age, with a 3-times higher increase rate than single lesion. Single-segment CRD occurred more frequently in males than in females (80.1 vs. 76.4%, p < 0.01). Concurred colon polyps were seen in 51.05% cases. CONCLUSION: CRD detection rates increased annually and with age, particularly in senior females in China. Multiple diverticula were common in males and increased with age. CRD was predominant in the right-side colon. Polyps are the most common comorbidity associated with CRD.

[Analysis of STK11 gene variants among 64 patients with Peutz-Jeghers syndrome].

OBJECTIVE: To screen for pathogenic variants in the coding regions of STK11 gene among Chinese patients with Peutz-Jeghers syndrome (PJS). METHODS: Peripheral blood samples were collected from 64 patients. The coding regions of the STK11 gene were detected by PCR and Sanger sequencing. RESULTS: Fourty-eight patients were found to harbor STK11 gene variants, which included 39 types of variants consisting of missense, nonsense, insertional, deletional and splice site variants. Among 64 PJS patients, the detection rate of point variants was 75.00% (48/64), of which missense variants accounted for 29.17% (14/48), nonsense variants accounted for 29.17%(14/48), insertion variants accounted for 2.08% (1/48), deletional variants accounted for 10.42% (5/48), and splice site variants accounted for 29.17% (14/48). The detection rates of sporadic cases and those with a family history were 71.8% (28/39) and 80.0% (20/25), respectively. Two variants (c.250A>T, c.580G>A) occurred in 3 PJS probands. Thirteen variants were unreported previously and were considered to be pathogenic. CONCLUSION: The detection rate of variants among Chinese PJS patients is similar to that of other countries. A number of novel common variant sites were discovered, which enriched the spectrum of PJS-related variants.

The altered activity of P53 signaling pathway by STK11 gene mutations and its cancer phenotype in Peutz-Jeghers syndrome.

BACKGROUND: Peutz-Jeghers syndrome (PJS) is caused by mutations in serine/threonine kinase 11 (STK11) gene. The increased cancer risk has been connected to P53 pathway. METHODS: PJS probands with STK11 mutation were included in the function analysis. P53 activity elevated by STK11 mutants was investigated using dual-luciferase reporter assay in vitro after constructing expression vectors of STK11 wild type and mutants generated by site-directed substitution. The association between the P53 activity and clinicopathological factors was analysis, especially the cancer history. RESULTS: Thirteen probands with STK11 mutations were involved, and within the mutations, c.G924A was novel. P53 activity elevation caused by 6 truncating mutations were significantly lower than that of STK11 wild type (P < 0.05). Family history of cancer was observed in 5 families. Within them, P53 activity was reduced and cancer occurred before 40 in 2 families, while it was not significantly changed and cancers happened after 45 in the other 3 families. CONCLUSIONS: The affected P53 activity caused by STK11 mutations in PJS patients is significantly associated with protein truncation, while cancer risk in PJS can be elevated through pathways rather than P53 pathway. P53 activity test is probably a useful supporting method to predict cancer risk in PJS, which could be helpful in clinical practice.

Close and regular surveillance is key to prevent severe complications for Peutz-Jeghers syndrome patients without gastrointestinal polyps: case report of a novel STK11 mutation (c.471_472delCT) in a Chinese girl.

BACKGROUND: Peutz-Jeghers syndrome (PJS) is a Mendelian disease characterized by gastrointestinal hamartomas, mucocutaneous pigmentation (MP), and increased cancer risk. Serine/threonine kinase 11 (STK11) is the only validated causative gene in PJS. Clinical observation reveals MP and intussusception in childhood are more frequent and severe than in adults. CASE PRESENTATION: We report here a girl without a positive family history, who grew oral and fingertip MP at her age of 2 and got abdomen dull pain from 7 years old. Endoscopy revealed no obvious polyps in the stomach or the colon until 10 years old, when she received enteroscopy. Tens of polyps were resected during enteroscopy, and pathological examination confirmed them hamartomas. A heterozygous deletion in STK11, c.471_472delCT, was detected in the proband but not in her parents, which is not recorded in databases. CONCLUSION: The mutation we reported here is a novel one and a de-novo one, so our results enlarge the spectrum of STK11. We speculate close and regular endoscopy especially enteroscopy is necessary for complication prevention when the former endoscopy discovers no polyps temporarily in a child of suspect PJS.

Sanger sequencing in exonic regions of STK11 gene uncovers a novel de-novo germline mutation (c.962_963delCC) associated with Peutz-Jeghers syndrome and elevated cancer risk: case report of a Chinese patient.

BACKGROUND: Peutz-Jeghers syndrome (PJS) is caused by mutations in the tumor suppressor gene, STK11, and is characterized by gastrointestinal hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing cancer. CASE PRESENTATION: We reported an isolated PJS patient who died of colon cancer, whose blood sample was collected together with all the available family members'. The entire coding region of the STK11 gene was amplified by PCR and analyzed by Sanger sequencing, through which, a novel mutation, c.962_963delCC in exon 8 was identified in this patient. This mutation causes a frameshift mutation and a premature termination at codon 358. Protein structure prediction by Swiss-Model indicated a dramatic change and partial loss of the C-terminal domain. We did not observe this mutation in both parents of the proband. Therefore, it is considered a novel de-novo mutation. Furthermore, the mutation was not found in 50 unrelated healthy people. CONCLUSIONS: The novel mutation we reported here had not been recorded in databases or literature, and the patient who possessed it suffered from PJS and colon cancer. So our results enlarge the spectrum of STK11 variants in PJS patients. This mutation is most likely responsible for development of the PJS phenotype, especially the cancer occurrence.

Cancer risk in patients with Peutz-Jeghers syndrome: A retrospective cohort study of 336 cases.

Peutz-Jeghers syndrome is a rare autosomal dominant inherited disorder characterized by mucocutaneous pigmentation and hamartomatous gastrointestinal polyposis. A growing body of evidence has shown that Peutz-Jeghers syndrome could cause an increased risk of various cancers, yet the range of cancer risk estimates was wide among different studies. In this retrospective cohort study, 336 patients with Peutz-Jeghers syndrome in China were enrolled. The clinical characteristics, cancer spectrum, relative cancer risks, and cumulative cancer risks were analyzed. In total, 52 patients were diagnosed of cancer in the follow-up period, at a median age of 41 years (range: 21-67). The relative risk for cancer in Peutz-Jeghers syndrome patients was 63.858 (confidence interval: 47.514-85.823), and the cumulative cancer risk at the age of 60 years was 55%. Colorectal cancer was the most common cancer for Peutz-Jeghers syndrome patients (relative risk: 237.918, confidence interval: 154.417-366.572) and the cumulative cancer risk at the age of 60 years was 28%. There was a statistically significant difference in the cumulative cancer risk between patients with family history and those without family history, as well as between patients living in rural area and those living in urban areas ( p < 0.05), while no significant effects of gender and intussusception history on the cumulative cancer risk was found ( p > 0.05). Hopefully, our study may contribute to the management of this rare disorder and establishment of related surveillance projects, especially in China.

A 23-Nucleotide Deletion in STK11 Gene Causes Peutz-Jeghers Syndrome and Malignancy in a Chinese Patient Without a Positive Family History.

BACKGROUND AND AIMS: Peutz-Jeghers syndrome (PJS) is an autosomal-dominant genetic disease caused by mutations in the tumor suppressor gene, STK11, which is characterized by gastrointestinal hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing both gastrointestinal and extraintestinal malignancies. METHODS AND RESULTS: We treated a PJS patient without a positive family history, who possessed typical clinical manifestations including polyp canceration. In order to explore the genotype of this patient, blood samples were collected from all the available family members. The whole coding region and the flanking regions of the STK11 gene were amplified by polymerase chain reaction and analyzed by Sanger sequencing. Molecular analysis of the STK11 gene here revealed a 23-nucleotide deletion (c.426-448delCGTGCCGGAGAAGCGTTTCCCAG) in exon 3, resulting in a change of 13 codons and a truncating protein (p.S142SfsX13). This mutation was not found in normal individuals in this family including her parents or in 100 control individuals. Protein structure prediction indicated a dramatic loss of the kinase domain and complete loss of the C-terminal regulatory domain. CONCLUSIONS: The results presented here enlarge the spectrum of STK11 mutation both disease-causing and malignancy-causing.

Extracorporeal shock wave lithotripsy is a safe and effective treatment for pancreatic stones coexisting with pancreatic pseudocysts.

BACKGROUND AND AIMS: We aimed to investigate outcomes of pancreatic extracorporeal shock wave lithotripsy (P-ESWL) for the removal of large pancreatic stones coexisting with pancreatic pseudocysts (PPCs) in chronic pancreatitis (CP). METHODS: This is a prospective study performed in CP patients with at least 1 stone (≥5 mm). Patients were divided into the PPC group (stones coexisting with PPCs) or the control group (stones alone). Patients were initially subjected to successive P-ESWL treatments, followed by ERCP. Primary outcomes were P-ESWL adverse events, and secondary outcomes were stone clearance, long-term pain relief, improved quality-of-life scores, and PPC regression. RESULTS: A total of 849 patients (59 in the PPC group and 790 in the control group) was subjected to P-ESWL between March 2011 and October 2013. Occurrences of P-ESWL adverse events were similar between the PPC group and the control group (11.86% vs 12.41%, P = .940). After the treatment of initial P-ESWL combined with ERCP, the complete, partial, and nonclearance of stones occurred in 67.24%, 20.69%, and 12.07%, respectively, of patients in PPC group, with no significant difference from the control group (complete, partial, and nonclearance: 83.17%, 10.40%, and 11.39%, respectively; P = .106). Fifty-five of 59 patients (93.22%) with PPCs were followed for a median period of 21.9 months (range, 12.0-45.1). PPCs disappeared in 56.36% (31/55) and 76.36% (42/55) of patients after 3 months and 1 year of follow-up visits, respectively. Moreover, complete and partial pain relief were achieved in 63.64% (35/55) and 25.45% (14/55) of patients, respectively. The scores for quality of life (P < .001), physical health (P < .001), and weight loss (P < .001) improved. CONCLUSIONS: In our multispecialty tertiary center, initial P-ESWL followed by ERCP was safe in patients with coexisting pancreatic stones and PPCs and effective for stone clearance, main pancreatic duct drainage, and pain relief.

[Mutations of the STK11 and FHIT genes among patients with Peutz-Jeghers syndrome].

OBJECTIVE: To correlate the clinical characteristics with mutations of the STK11 and FHIT genes in 16 patients with Peutz-Jeghers syndrome (PJS). METHODS: Potential mutations in the coding regions and flanking sequences of the STK11 and FHIT genes were detected with PCR and Sanger sequencing. RESULTS: Of the 16 patients with PJS, 8 had novel mutations in the coding region of the STK11 gene, 1 had a previously reported mutation. 1 carried a mutation in the exon 10 of the FHIT gene, which is a non-coding region. None of the mutations was detected in the immediate family members. None of the patients with STK11 gene mutations had mutation in the FHIT gene. The mutation rate of the STK11 gene among patients with PJS was 56.25%. CONCLUSION: Mutations of the STK11 gene are the major cause of PJS. Few such patients had mutations of the FHIT gene. Mutations of the FHIT gene may play a part in the pathogenesis of PJS.

Enteroscopic sclerotherapy in blue rubber bleb nevus syndrome.

Blue rubber bleb nevus syndrome (BRBNS) is a rare syndrome characterized by multiple vascular malformations of varying size and appearance that present predominantly on the skin and within the gastrointestinal tract and, less often, in other internal organs. Gastrointestinal lesions of BRBNS can cause acute or chronic bleeding, and the treatment is challenging. In this case, we reported a successful treatment of vascular malformations in all segments of gastrointestinal tract, including the small intestine, by endoscopic sclerotherapy, in a 10-year-old boy with BRBNS.

Proposal of a Risk Scoring System to Facilitate the Treatment of Enteroenteric Intussusception in Peutz-Jeghers Syndrome.

Background/Aims: Enteroenteric intussusception in Peutz-Jeghers syndrome (EI-PJS) is traditionally treated by surgery. However, enteroscopic treatment is a minimally invasive approach worth attempting. We aimed to develop a risk scoring system to facilitate decision-making in the treatment of EI-PJS. Methods: This was a single-center case-control study, including 80 patients diagnosed with PJS and coexisting intussusception between January 2015 and January 2021 in Air Force Medical Center. We performed logistic regression analysis to identify independent risk factors and allocated different points to each subcategory of risk factors; the total score of individuals ranged from 0 to 9 points. Then, we constructed a risk stratification system based on the possibility of requiring surgery: 0-3 points for "low-risk," 4-6 points for "moderate-risk," and 7-9 points for "high-risk." Results: Sixty-one patients (76.25%) were successfully treated with enteroscopy. Sixteen patients (20.0%) failed enteroscopic treatment and subsequently underwent surgery, and three patients (3.75%) received surgery directly. Abdominal pain, the diameter of the responsible polyp, and the length of intussusception were independent risk factors for predicting the possibility of requiring surgery. According to the risk scoring system, the incidence rates of surgery were 4.44% in the low-risk tier, 30.43% in the moderate-risk tier, and 83.33% in the high-risk tier. From low- to high-risk tiers, the trend of increasing risk was significant (p<0.001). Conclusions: We developed a risk scoring system based on abdominal pain, diameter of the responsible polyps, and length of intussusception. It can preoperatively stratify patients according to the risk of requiring surgery for EI-PJS to facilitate treatment decision-making.