A six-amino-acid motif is a major determinant in functional evolution of HOX1 proteins.

Gene duplication and divergence is a major driver in the emergence of evolutionary novelties. How variations in amino acid sequences lead to loss of ancestral activity and functional diversification of proteins is poorly understood. We used cross-species functional analysis of Drosophila Labial and its mouse HOX1 orthologs (HOXA1, HOXB1, and HOXD1) as a paradigm to address this issue. Mouse HOX1 proteins display low (30%) sequence similarity with Drosophila Labial. However, substituting endogenous Labial with the mouse proteins revealed that HOXA1 has retained essential ancestral functions of Labial, while HOXB1 and HOXD1 have diverged. Genome-wide analysis demonstrated similar DNA-binding patterns of HOXA1 and Labial in mouse cells, while HOXB1 binds to distinct targets. Compared with HOXB1, HOXA1 shows an enrichment in co-occupancy with PBX proteins on target sites and exists in the same complex with PBX on chromatin. Functional analysis of HOXA1-HOXB1 chimeric proteins uncovered a novel six-amino-acid C-terminal motif (CTM) flanking the homeodomain that serves as a major determinant of ancestral activity. In vitro DNA-binding experiments and structural prediction show that CTM provides an important domain for interaction of HOXA1 proteins with PBX. Our findings show that small changes outside of highly conserved DNA-binding regions can lead to profound changes in protein function.

Occurrence, molecular characterization and antimicrobial-resistance pattern of Staphylococcus species isolates from buck semen.

Staphylococcus aureus is one of the most prevalent pathogens, and a causative agent of a variety of infections in humans and animals. Most studies concentrated on characterization of staphylococcus isolates and its antimicrobial resistance from various illness of veterinary importance, but there is no specific study that is available on isolates from reproductive tract of small ruminants and especially its semen. Hence, in the current study, a total of 48 semen samples were collected from healthy bucks of different breeds to investigate the occurrence of S. aureus. Antimicrobial resistance and virulence of the Staphylococcus isolates were determined to assess the adverse effects of them on buck fertility. The bacterial isolates were tentatively confirmed as Staphylococcus spp. based on the Gram's staining, growth on Mannitol salt agar and catalase test. Overall, 75% (n = 36) of the samples were positive for Staphylococcus spp. from the total 48 buck semen ejaculates from different breeds and among them 23 (63.89%) were coagulase-negative (CoNS) and 13 (36.11%) were coagulase-positive Staphylococcus (CoPS) strains. The species identified by molecular characterization are S. aureus, S. chromogenes, S. haemolyticus, S. sciuri, S. simulans, and S. epidermidis from buck semen. Further, these isolates exhibited varying degrees of multidrug resistance genotypically as well as phenotypically. The presence of antibiotic resistance and virulence genes may pose a potential threat to reproductive health of animals, the animal handlers and livestock keepers, while simultaneously highlighting the need for vigilant monitoring of these isolates at the time of semen cryopreservation.

Transgenic chickpea (Cicer arietinum L.) harbouring AtDREB1a are physiologically better adapted to water deficit.

BACKGROUND: Chickpea (Cicer arietinum L.) is the second most widely grown pulse and drought (limiting water) is one of the major constraints leading to about 40-50% yield losses annually. Dehydration responsive element binding proteins (DREBs) are important plant transcription factors that regulate the expression of many stress-inducible genes and play a critical role in improving the abiotic stress tolerance. Transgenic chickpea lines harbouring transcription factor, Dehydration Responsive Element-Binding protein 1A from Arabidopsis thaliana (AtDREB1a gene) driven by stress inducible promoter rd29a were developed, with the intent of enhancing drought tolerance in chickpea. Performance of the progenies of one transgenic event and control were assessed based on key physiological traits imparting drought tolerance such as plant water relation characteristics, chlorophyll retention, photosynthesis, membrane stability and water use efficiency under water stressed conditions. RESULTS: Four transgenic chickpea lines harbouring stress inducible AtDREB1a were generated with transformation efficiency of 0.1%. The integration, transmission and regulated expression were confirmed by Polymerase Chain Reaction (PCR), Southern Blot hybridization and Reverse Transcriptase polymerase chain reaction (RT-PCR), respectively. Transgenic chickpea lines exhibited higher relative water content, longer chlorophyll retention capacity and higher osmotic adjustment under severe drought stress (stress level 4), as compared to control. The enhanced drought tolerance in transgenic chickpea lines were also manifested by undeterred photosynthesis involving enhanced quantum yield of PSII, electron transport rate at saturated irradiance levels and maintaining higher relative water content in leaves under relatively severe soil water deficit. Further, lower values of carbon isotope discrimination in some transgenic chickpea lines indicated higher water use efficiency. Transgenic chickpea lines exhibiting better OA resulted in higher seed yield, with progressive increase in water stress, as compared to control. CONCLUSIONS: Based on precise phenotyping, involving non-invasive chlorophyll fluorescence imaging, carbon isotope discrimination, osmotic adjustment, higher chlorophyll retention and membrane stability index, it can be concluded that AtDREB1a transgenic chickpea lines were better adapted to water deficit by modifying important physiological traits. The selected transgenic chickpea event would be a valuable resource that can be used in pre-breeding or directly in varietal development programs for enhanced drought tolerance under parched conditions.

Comprehensive RNAseq analysis for identification of genes expressed under heat stress in lentil.

Lentils are highly sensitive to abrupt increases in temperature during the mid to late reproductive stages, leading to severe biomass and seed yield reduction. Therefore, we carried out an RNAseq analysis between IG4258 (heat tolerant) and IG3973 (heat sensitive) lentil genotypes at the reproductive stage under both normal and heat stress conditions in the field. It resulted in 209,549 assembled transcripts and among these 161,809 transcripts had coding regions, of which 94,437 transcripts were annotated. The differential gene expression analysis showed upregulation of 678 transcripts and downregulation of 680 transcripts between the tolerant and sensitive genotypes at the early reproductive stage. While 76 transcripts were upregulated and 47 transcripts were downregulated at the late reproductive stage under heat stress conditions. The validation of 12 up-or downregulated transcripts through RT-PCR corresponded well with the expression analysis data of RNAseq, with a correlation of R2  = 0.89. Among these transcripts, the DN364_c1_g1_i9 and DN2218_c0_g1_i5 transcripts encoded enzymes involved in the tryptophan pathway, indicating that tryptophan biosynthesis plays a role under heat stress in lentil. Moreover, KEGG pathways enrichment analysis identified transcripts associated with genes encoding proteins/regulating factors related to different metabolic pathways including signal transduction, fatty acid biosynthesis, rRNA processing, ribosome biogenesis, gibberellin (GA) biosynthesis, and riboflavin biosynthesis. This analysis also identified 6852 genic-SSRs leading to the development of 4968 SSR primers that are potential genomic resources for molecular mapping of heat-tolerant genes in lentil.

First report of Fusarium equiseti (Corda) Sacc. causing wilt of Cajanus scarabaeoides, a wild relative of pigeonpea in India.

Wild species or crop wild relatives (CWRs) provide a unique opportunity to introduce novel traits and expand the genetic base of the cultivated pigeonpea (Bohra et al. 2010, 2020). Among the wild relatives of pigeonpea, Cajanus scarabaeoides is cross-compatible with cultivated pigeonpea (C. cajan). To identify the resistant sources for use in the pigeonpea breeding, the present study was conducted using 79 wild pigeonpea accessions at ICAR-Indian Institute of Pulses Research, Kanpur, India during 2016-17 and 2017-18 (Figures 1 a and b). The pigeonpea accessions belonged to three different genera Cajanus, Rhynchosia and Flemingia. During field scouting, seedlings were observed with foliar chlorosis and wilting (Fig. 2a). Infected stem tissue exhibited brown to black discoloration, followed by gradual plant drying, and ultimately plant death (Fig. 2b). Infected plants were collected from the field and pathological examination was performed in the laboratory conditions. Wilted plant parts were surface-disinfected with 1% sodium hypochlorite for two minutes and 5.0 mm size pieces of stem tissue were transferred to petri-dishes containing 90ml of Fusarium Specific Medium (FSM) (Nash and Snyder 1962) and incubated at 27oC. After 48 hrs of incubation, white to orange aerial mycelial growth was observed (Fig. 2c). The fungus was transferred to fresh FSM and purified by the single-spore technique (Choi et al. 1999). Macroconidia had four to six septa, slightly curved at the apex ranged from 20.0 to 25.0 × 3.0 to 5.5 µm (Fig. 2d). Microconidia were absent. The isolated fungus was putatively identified as belonging to the F. equiseti species complex based on colony morphology and macroconidia characteristics and size (Booth, 1977; Leslie and Summerell 2004). The pathogenicity test was conducted on 15-day old healthy seedlings of wild pigeonpea using 'root dip inoculation' and 'soil inoculation' technique (Haware and Nene 1994). Plant roots were immersed in a conidial suspension (6×106 conidia/ml water as determined by a hemocytometer) for 3-4 minutes (Marley and Hillocks 1996), while the roots of control plant were immersed in sterilized distilled water. A single spore culture of F. equiseti was grown on PDA-containing perti-dishes. Two actively grown mycelia discs (5 mm dia) from the periphery of 7-day old pure culture of F. equiseti were separately inoculated in 500 ml conical flasks containing 100g pigeonpea meal medium. The flasks were incubated at 28±2°C for 10 days. A fungus-soil mixture was prepared by mixing 200 g of inoculums with 2kg of autoclaved sand: soil mixture (3:7). Earthen pots having 15-cm diameter were sterilized by formalin (0.1%). These pots were then filled with fungus-soil mixture. Seeds sterilized with mercuric chloride (1%) were sown in each pot. Seeds sown in uninoculated pots served as control. Five seeds were sown in each pot with three replications. Disease symptoms developed 10 days after inoculation of wild pigeonpea plants in greenhouse. Symptoms were identical to those observed in the field. No symptoms were observed in control. Re-isolating the F. equiseti pathogen from the inoculated wild pigeonpea seedlings corroborated Koch's postulates. Reference cultures of three isolates of F. equiseti were deposited in Indian Type of Culture Collection (ITCC), Division of Plant Pathology, ICAR-Indian Agricultural Research Institute (IARI), New Delhi with the accession numbers ITCC8413, ITCC8414 and ITCC8415. Fungal genomic DNA was extracted through modified CTAB method (Murray and Thompson 1980). The ITS regions 1 and 2, including 5.8S ribosomal DNA (rDNA) region, and part of translation elongation factor 1-α (TEF) were amplified by using the ITS6F (GAAGGTGAAGTCGTAACAGG) and ITS4R (TCCTCCGCTTATTGATATGC) and tef (F: ATGGGTAAGGAAGACAAGAC; R: GGAAGTACCAGTGAATCATGTT) primers. BLASTn analysis of the sequences generated showed a 98.78% homology with F. equiseti. The sequences were deposited at GenBank (Accession numbers of ITS region: MF351849, MF351850, MF351851, and Tef region: MK259963, MK264345, MK264346). Phylogenetic analysis of the ITS and Tef region sequences revealed that all Fusarium isolates belong to the F. equiseti species complex and other available sequences of Fusarium spp. (Fig. 3). Occurrence of F. equiseti on various plant species is reported worldwide by several researchers (Liang et al. 2011; Ramachandra and Bhatt 2012; Prasad et al. 2017). To the best of our knowledge and based on the literature, this is the first report of wilt disease on wild pigeonpea in India, caused by F. equiseti (Corda) Sacc.

Effect of elevated carbon-dioxide on plant growth, physiology, yield and seed quality of chickpea (Cicer arietinum L.) in Indo-Gangetic plains.

In the present scenario of climate change with constantly increasing CO2 concentration, there is a risk of altered crop performance in terms of growth, yield, grain nutritional value and seed quality. Therefore, an experiment was conducted in open top chamber (OTCs) during 2017-18 and 2018-19 to assess the effect of elevated atmospheric carbondioxide (e[CO2]) (600 ppm) on chickpea (cv. JG 14) crop growth, biomass accumulation, physiological function, seed yield and its quality in terms of germination and vigour. The e[CO2] treatment increased the plant height, leaf and stem biomass over ambient CO2 (a[CO2]) treatment. The e[CO2] increased seed yield by 11-18% which was attributed to an increase in the number of pods (6-10%) and seeds plant-1 (8-9%) over a[CO2]. However, e[CO2] reduced the seed protein (7%), total phenol (13%) and thiobarbituric acid reactive substances (12%) and increased the starch (21%) and water uptake rate as compared to seeds harvested from a[CO2] environment. Exposing chickpea plant to e[CO2] treatment had no impact on germination and vigour of the harvested seeds. Also, the physical attributes, total soluble sugar and antioxidant enzymes activities of harvested seeds were comparable in a[CO2] and e[CO2] treatment. Hence, the experimental findings depict that e[CO2] upto 600 ppm could add to the growth and productivity of chickpea in a sub-tropical climate with an implication on its nutritional quality of the produce.

HOXA1 and TALE proteins display cross-regulatory interactions and form a combinatorial binding code on HOXA1 targets.

Hoxa1 has diverse functional roles in differentiation and development. We identify and characterize properties of regions bound by HOXA1 on a genome-wide basis in differentiating mouse ES cells. HOXA1-bound regions are enriched for clusters of consensus binding motifs for HOX, PBX, and MEIS, and many display co-occupancy of PBX and MEIS. PBX and MEIS are members of the TALE family and genome-wide analysis of multiple TALE members (PBX, MEIS, TGIF, PREP1, and PREP2) shows that nearly all HOXA1 targets display occupancy of one or more TALE members. The combinatorial binding patterns of TALE proteins define distinct classes of HOXA1 targets, which may create functional diversity. Transgenic reporter assays in zebrafish confirm enhancer activities for many HOXA1-bound regions and the importance of HOX-PBX and TGIF motifs for their regulation. Proteomic analyses show that HOXA1 physically interacts on chromatin with PBX, MEIS, and PREP family members, but not with TGIF, suggesting that TGIF may have an independent input into HOXA1-bound regions. Therefore, TALE proteins appear to represent a wide repertoire of HOX cofactors, which may coregulate enhancers through distinct mechanisms. We also discover extensive auto- and cross-regulatory interactions among the Hoxa1 and TALE genes, indicating that the specificity of HOXA1 during development may be regulated though a complex cross-regulatory network of HOXA1 and TALE proteins. This study provides new insight into a regulatory network involving combinatorial interactions between HOXA1 and TALE proteins.

Root-specific expression of chickpea cytokinin oxidase/dehydrogenase 6 leads to enhanced root growth, drought tolerance and yield without compromising nodulation.

Cytokinin group of phytohormones regulate root elongation and branching during post-embryonic development. Cytokinin-degrading enzymes cytokinin oxidases/dehydrogenases (CKXs) have been deployed to investigate biological activities of cytokinin and to engineer root growth. We expressed chickpea cytokinin oxidase 6 (CaCKX6) under the control of a chickpea root-specific promoter of CaWRKY31 in Arabidopsis thaliana and chickpea having determinate and indeterminate growth patterns, respectively, to study the effect of cytokinin depletion on root growth and drought tolerance. Root-specific expression of CaCKX6 led to a significant increase in lateral root number and root biomass in Arabidopsis and chickpea without any penalty to vegetative and reproductive growth of shoot. Transgenic chickpea lines showed increased CKX activity in root. Soil-grown advanced chickpea transgenic lines exhibited higher root-to-shoot biomass ratio and enhanced long-term drought tolerance. These chickpea lines were not compromised in root nodulation and nitrogen fixation. The seed yield in some lines was up to 25% higher with no penalty in protein content. Transgenic chickpea seeds possessed higher levels of zinc, iron, potassium and copper. Our results demonstrated the potential of cytokinin level manipulation in increasing lateral root number and root biomass for agronomic trait improvement in an edible legume crop with indeterminate growth habit.

Molecular detection of important abortion-causing microorganisms in preputial swab of breeding bucks using PCR-based assays.

Infectious diseases and aetiological agents related to female reproductive systems were extensively covered compared to its male counterpart. There needs a proper study to bridge this gap, where microflora and infectious agents of both male and female reproductive are mutually intelligible. With this study, we aimed to evaluate the microbial contamination of the preputial cavity and also screened for abortion-causing agents which are zoonotic as well. In goats, such types of abortions are caused by Brucella melitensis, Chlamydophila, Campylobacter and Coxiella etc. One of the major sources of contamination of semen is the preputial cavity, which is exposed to the external environment leading to spread of infection into the female via semen straws or by natural service. In the current study, good quality bucks (n = 32, Barbari = 12, Jamunapari = 10, Jakhrana = 10) which were routinely used for semen collection were screened for their preputial swabs, for the presence of the above pathogens. For detection of Brucella melitensis, OMP31 based TaqMan® probe real-time PCR assay was used, and for Chlamydia, 16srRNA gene based SYBR® green real-time PCR assay was employed for detection of Chlamydophila abortus. While for Campylobacter spp. and Coxiella burnetii, 16srRNA gene based conventional PCR and Trans-PCR were used, respectively. In the current study, of the screened preputial swabs, none of them showed positive for Brucella and Coxiella, but of the screened 32 samples 17 showed positive for Chlamydia (53.13%) and two (6.25%) showed positive for Campylobacter spp. The current study emphasizes on the farms and laboratories which were regularly involved in screening of brucellosis also often overlook the other potential non-brucella pathogens, causing abortions eventually incurring severe economic losses to the goat keepers.

Genetic Dissection and Identification of Candidate Genes for Salinity Tolerance Using Axiom®CicerSNP Array in Chickpea.

Globally, chickpea production is severely affected by salinity stress. Understanding the genetic basis for salinity tolerance is important to develop salinity tolerant chickpeas. A recombinant inbred line (RIL) population developed using parental lines ICCV 10 (salt-tolerant) and DCP 92-3 (salt-sensitive) was screened under field conditions to collect information on agronomy, yield components, and stress tolerance indices. Genotyping data generated using Axiom®CicerSNP array was used to construct a linkage map comprising 1856 SNP markers spanning a distance of 1106.3 cM across eight chickpea chromosomes. Extensive analysis of the phenotyping and genotyping data identified 28 quantitative trait loci (QTLs) explaining up to 28.40% of the phenotypic variance in the population. We identified QTL clusters on CaLG03 and CaLG06, each harboring major QTLs for yield and yield component traits under salinity stress. The main-effect QTLs identified in these two clusters were associated with key genes such as calcium-dependent protein kinases, histidine kinases, cation proton antiporter, and WRKY and MYB transcription factors, which are known to impart salinity stress tolerance in crop plants. Molecular markers/genes associated with these major QTLs, after validation, will be useful to undertake marker-assisted breeding for developing better varieties with salinity tolerance.

Effect of zinc on growth performance and cellular metabolic stress of fish exposed to multiple stresses.

Global warming due to increasing temperature and contamination in aquatic environment has been found to be inducing cellular metabolic stress in fish. The present study focused on temperature and contamination in aquatic ecosystems and its alleviation/mitigation. Hence, this study was conducted to evaluate the role of zinc to improve growth performance, cellular metabolic stress, and digestive enzymes of the Pangasianodon hypophthalmus reared under lead (Pb) and high temperature. Two hundred and seventy-three fishes were distributed randomly into seven treatments, each with three replicates. Three isocaloric and isonitrogenous diets with graded levels of zinc at 0 mg/kg, 10 mg/kg, and 20 mg/kg were prepared. The Pb in treated water was maintained at the level of 1/21th of LC50 (4 ppm) and maintained at a temperature of 34 °C in exposure groups. The growth performance in terms of weight gain (%), protein efficiency ratio (PER), and specific growth rate (SGR) was found to be inhibited, and the feed conversion ratio (FCR) was enhanced in the Pb and high temperature-exposed group, whereas zinc supplementation has improved weight gain (%), FCR, PER, and SGR. The liver, gill, muscle, and kidney tissues of carbohydrate metabolic enzymes (LDH and MDH), protein metabolic enzymes (ALT and AST), and liver, gill, and muscle G6PDH and ATPase as well as intestinal digestives enzymes (proteases, amylase, and lipase) and intestinal ALP were significantly affected (p < 0.01) by Pb and high temperature exposure to P. hypophthalmus. We herein report the role of zinc in mitigating cellular metabolic stress in fish exposed to Pb and high temperature.

Effect of dietary selenium on immuno-biochemical plasticity and resistance against Aeromonas veronii biovar sobria in fish reared under multiple stressors.

The present investigation aims to study role of dietary selenium (Se) on growth performance, oxidative stress markers (catalase, superoxide dismutase and glutathione-s-transferase), stress biomarkers [blood glucose, cortisol and heat shock protein (HSP 70) and immunological status, Nitro blue tetrazolium (NBT), total protein, albumin, globulin, A/G ratio, total immunoglobulin and vitamin C] and survival of fish after Aeromonas veronii biovar sobria challenged. Pangasianodon hypophthalmus was treated with lead (Pb, 4 ppm), and high temperature (34 °C) for 60 days. The growth performance was reduced with declined in feed intake, growth rate and feed efficiency in case of group exposed with Pb alone and concurrent exposure to Pb high temperature (34 °C). The Se has immunomodulatory properties however, supplementation of the dietary Se @ 1 and 2 mg/kg diet has been realistically improved growth performance up to 240%, elevated antioxidative status in different tissues, and immunological status were also improved significantly in the P. hypophthalmus. The bacterial challenged with A. veronii biovar sobria in the P. hypophthalmus resulting in less cumulative mortality (%) and high relative (%) survival has been observed with supplementation of dietary Se @ 1 and 2 mg/kg diet. The bioaccumulation of Pb in muscle tissue has been also drastically reduced with supplementation of dietary Se in feed. Hence, overall results indicated that, dietary Se @ 1 and 2 mg/kg have ability to enhanced overall performance and alleviated multiple stresses in P hypophthalmus.

Oxidative and Cellular Metabolic Stress of Fish: An Appealing Tool for Biomonitoring of Metal Contamination in the Kolkata Wetland, a Ramsar Site.

The present study delineate the various biochemical and histopathological tool to evaluate as strong biomarker in the field condition for detection of the least and maximize level of pollution and contamination. We have collected Labeo rohita from 13 different sites from East Kolkata wetland to determine biochemical and histopathological status to analyse metal contamination in the significant biological hot spot EKW. The biochemical marker as antioxidative status, i.e., catalase, superoxide dismutase (SOD), and glutathione-S-transferase (GST) in liver and gill, were remarkably higher (p < 0.01) at some of the sampling sites, but catalase in brain, SOD in kidney, GST in brain and kidney, and neurotransmitter as acetylcholine esterase (AChE) in brain were not significant (p > 0.05) among the sampling sites. The glycolytic enzymes, such as lactate dehydrogenase (LDH) and malate dehydrogenase (MDH) in liver, gill, and muscle, and protein metabolic enzymes, such as alanine amino transferase (ALT) and aspartate amino transferase (AST) in liver, gill, muscle, and kidney, were noticeably higher (p < 0.01) at some of the sampling sites. The histopathology of the liver and gill were altered at different sampling sites, such as blood congestion, leucocyte infiltration with parenchymal vacuolisation, nucleus with blood vessels, hepatocytes granular degeneration, haemorrhage, karyorrhexis, shrink nucleus, and pyknotic nuclei in liver. In the gill, structural changes, such as complete destruction and shortening of secondary gill lamellae, blood vessel in gill arch, curling of secondary gill lamellae, aneurism in gill lamellae, and neoplasia, were observed. Most of the metals were found within the safe limit all along the 13 sampling sites, indicating that fishes are safe for the consumption. Based on our finding, we could recommend that a rational application of biochemical profiles, such as oxidative and metabolic stress parameters, including histopathology to be used as biomarkers for biomonitoring the metal contamination in the aquatic environment.

Synergistic effect of dietary selenium nanoparticles and riboflavin on the enhanced thermal efficiency of fish against multiple stress factors.

An experiment was designed to delineate the efficacy of a dietary mixture of selenium nanoparticles (Se-NPs) and riboflavin (RF) on the thermal efficiency/tolerance of Pangasianodon hypophthalmus reared under arsenic (2.8 mg/L) and high-temperature (34 °C) stress. A green synthesis method was employed for the synthesis of Se-NPs using fish gills, which are normally discarded as by-products. Four isocaloric and iso-nitrogenous experimental diets were used, namely, a control diet (Se-NPs and RF @ 0 mg/kg diet) and diets containing RF @ 5, 10 or 15 mg/kg diet and Se-NPs @ 0.5 mg/kg diet, and feeding was performed for 95 days. At the end of the feeding trial, the thermal tolerance was evaluated by determination of the following parameters: critical thermal minimum (CTMin), lethal thermal minimum (LTMin), critical thermal maximum (CTMax), and lethal thermal maximum (LTMax). The anti-oxidative status in the form of catalase (CAT), glutathione-s-transferase (GST) and glutathione peroxidase (GPx) activities was significantly (p < 0.01) enhanced upon concurrent exposure to arsenic and high temperature at LTMin and LTMax, whereas a non-significant (p > 0.05) change in superoxide dismutase (SOD) activity was observed in the brain at LTMin and brain, gill and kidney at LTMax. Supplementation with Se-NPs @ 0.5 mg/kg diet and RF @ 5, 10 or 15 mg/kg diet significantly (p < 0.01) improved the anti-oxidative status with or without stressors. AChE activity in the brain was significantly (p < 0.01) inhibited upon concurrent exposure to arsenic and high temperature and improved in the treatment group supplemented with Se-NPs and RF. The arsenic concentration in muscle and experimental water and Se concentration in muscle and experimental feed were analysed. Overall, the results indicated that supplementation with RF @ 5 mg/kg diet and Se-NPs @ 0.5 mg/kg diet could confer protection to the fish against arsenic and thermal stress and led to enhanced thermal efficiency/tolerance of P. hypophthalmus.

Immuno-protective role of biologically synthesized dietary selenium nanoparticles against multiple stressors in Pangasinodon hypophthalmus.

An environment friendly and sustainable approach is being emerged in the area of nanotechnology for accelerated growth and development of culturable aquatic animals hence green chemistry is gaining momentum in recent years. The present study has been carried out to delineate the effects of selenium nanoparticles (Se-NPs) on growth performance, antioxidative status and immunity of fish reared under lead (Pb) and high temperature (34 °C). Three hundred and fifteen fish were equally distributed in seven treatments in triplicates. Three isocaloric and isonitrogenous experimental diets viz. control (Se-NPs-0 mg/kg), Se-NPs at 1 mg/kg and Se-NPs at 2 mg/kg were formulated. The fish were reared under lead (Pb, 1/21st of LC50 (4 ppm)) and high temperature (34 °C) stress and fed with or without dietary Se-NPs. The effects of dietary Se-NPs were studied in terms of growth performance (Weight gain %, feed conversion ratio, protein efficiency ratio and specific growth rate), antioxidative status (catalase, superoxide dismutase, glutathione-S-transferase and glutathione peroxidase), neurotransmitter enzymes (AChE), stress biomarkers (heat shock protein 70, serum cortisol, blood glucose, vitamin C), immunological status (total protein, A/G ratio and respiratory burst activity) in Pangasinodon hypophthalmus post challenge with Aeromonas veronii biovar sobria. Results of the investigation demonstrated significant improvement of growth performance, antioxidative status, neurotransmitter enzyme activity, stress markers and more importantly enhanced immunity of the fish with dietary incorporation of Se-NPs at 1 mg/kg. In addition, post bacterial infection, the relative % survival increased and cumulative mortality % decreased in the group fed with Se-NPs at 1 mg/kg diet. Pb and high temperature treated and fed with control diet group showed devastating impact on the growth performance, antioxidative status, stress markers and immunity of the fish. Similarly, application of Se-NPs at 2 mg/kg showed poor growth performance and elevated level of oxidative stress and other stress biomarkers including other biochemical attributes. Inclusive results indicated that, Se-NPs at 1 mg/kg has capability to enhance overall performance and alleviate multiple stresses in P. hypophthalmus. Hence, Se-NPs at optimum level have ability to develop green chemistry in feed industry for better growth performance of the fish.

Dietary nano-silver: Does support or discourage thermal tolerance and biochemical status in air-breathing fish reared under multiple stressors?

Unexpected fluctuations in weather parameters due to global climate change have been observed in all ecosystems worldwide. The aquatic ecosystem shelters a great diversity of fishes in the upper region of the ecosystem which adversely get affected due to their poikilothermic nature. The present study was designed to elucidate the impact of critical temperature minima (CTMin), lethal temperature minima (LTMin), critical temperature maxima (CTMax), and lethal temperature maxima (LTMax) on Channa striatus. Biologically synthesized silver nanoparticles (Ag-NPs) were evaluated for their potential to enhance thermal tolerance and improve the activities of biochemical enzymes of C. striatus reared under lead (Pb) and high temperature (34 °C) for 50 days. Three iso-caloric and iso-nitrogenous diets which included a basal diet and two supplemented diets with Ag-NPs @ 0.5 mg/kg, and 1 mg/kg were used in the study. Results suggested that CTMin and LTMin were significantly (p < 0.01) reduced and CTMax and LTMax were enhanced in the group fed with 0.5 mg/kg Ag-NPs supplemented feed. Pre-exposure to high temperature led to enhanced CTMax and LTMax in C. striatus. The biochemical enzymes involved in protein metabolism, carbohydrate metabolism, acetylcholine esterase and antioxidant activities were found to be normal in fish fed with 0.5 mg/kg Ag-NPs supplemented diet. Bioaccumulation of silver and Pb was determined in different fish tissues and experimental water. Overall, the incorporation of Ag-NPs at 0.5 mg/kg in diet can confer protection to fish against Pb and thermal stress and enhance thermal tolerance of C. striatus.

Analysis of genetic variability and genotype × environment interactions for iron and zinc content among diverse genotypes of lentil.

Deficiencies of iron (Fe) and zinc (Zn) are major problems in developing countries especially for woman and preschool children. Biofortification of staple food crops is a sustainable approach to improve human mineral intake via daily diet. Objectives of this study were to (1) determine the genetic variability for Fe and Zn content in cultivated indigenous and exotic lentil genotypes, and (2) determine the effect of genetic (G) × environmental (E) interaction on Fe and Zn content in 96 lentil genotypes grown in India over the 2 years. Significant genetic variability was observed for Fe and Zn content in lentil genotypes. Content ranged from 71.3 to 126.2 mg/kg for Fe, and 40.1 to 63.6 mg/kg for Zn. For Fe, cultivars and parental lines (71.3-126.2 mg/kg) showed slightly higher content than the breeding lines (76.8-124.3 mg/kg). For Zn, content were similar for both cultivars and breeding lines. However, year and the genotype × year interaction were significant for both Fe and Zn. Broad sense heritability estimates were found to be 45.8, 45.4 and 40.1 for Fe; 30.0, 63.0 and 69.0 for Zn content in breeding lines, cultivars/parental lines, and exotic lines, respectively. These heritability estimates indicated the potential of these lentil genotypes towards genetic improvement for increased Fe and Zn content using hybridization and selection over several generations. Significant positive correlation of Fe content and seed weight suggested a selection strategy for developing large seeded lentil for accumulation of more Fe in the seeds. No correlation was observed between Fe and Zn content. Further, recombination of Fe and Zn content is possible by developing recombination breeding. Thus present study findings would be useful in future for mapping and tagging the genes/QTL controlling Fe and Zn content and developing the improved biofortified cultivars.

Role of abd-A and Abd-B in development of abdominal epithelia breaks posterior prevalence rule.

Hox genes that determine anteroposterior body axis formation in all bilaterians are often found to have partially overlapping expression pattern. Since posterior genes dominate over anterior Hox genes in the region of co-expression, the anterior Hox genes are thought to have no function in such regions. In this study we show that two Hox genes have distinct and essential functions in the same cell. In Drosophila, the three Hox genes of the bithorax complex, Ubx, abd-A and Abd-B, show coexpression during embryonic development. Here, we show that in early pupal abdominal epithelia, Ubx does not coexpress with abd-A and Abd-B, while abd-A and Abd-B continue to coexpress in the same nuclei. The abd-A and Abd-B are expressed in both histoblast nest cells and larval epithelial cells of early pupal abdominal epithelia. Further functional studies demonstrate that abd-A is required in histoblast nest cells for their proliferation and suppression of Ubx to prevent first abdominal segment like features in posterior segments while in larval epithelial cells it is required for their elimination. We also observed that these functions of abd-A are required in its exclusive as well as the coexpression domain with that of Abd-B. The expression of Abd-B is required in histoblast nest cells for their identity while it is dispensable in the larval epithelial cells. The higher level of Abd-B in the seventh abdominal segment, that down-regulates abd-A expression, leads this segment to be absent in males or of smaller size in females. We also show that abd-A in histoblast nest cells positively regulates expression of wingless for the formation of the abdominal epithelia. Our study reveals an exception to the rule of posterior prevalence and shows that two different Hox genes have distinct functions in the same cell, which is essential for the development of abdominal epithelia.

Zinc nanoparticles potentiates thermal tolerance and cellular stress protection of Pangasius hypophthalmus reared under multiple stressors.

A preliminary study was conducted to delineate the ameliorating effect of dietary zinc nanoparticles (Zn-NPs) against thermal stress in Pangasius hypophthalmus reared under concurrent exposure to lead (Pb) and elevated temperature (34°C). Three diets were formulated such as control (no Zn-NPs), Zn-NPs 10 and 20mg/kg diet. Two hundred and thirty four fish were randomly distributed in to six treatments groups in triplicates; such as control group (no Zn-NPs in diet and unexposed to Pb and temperature, Ctr/Ctr), control diet with concurrent exposure to Pb and temperature (Pb-T/Ctr), Zn-NPs 10 and 20mg/kg without stressors (Zn-NPs 10mg/kg, Zn-NPs 20mg/kg), Zn-NPs 10 and 20mg/kg diet with concurrent exposure to Pb and temperature (Pb-T/Zn-NPs 10mg/kg, Pb-T/Zn-NPs 20mg/kg). The Pb in treated water was maintained at the level of 1/21th of LC50 (4ppm) at 34 °C temperature in stressors groups. Post 60 days feeding trial, critical thermal minimum (CTmin), lethal thermal minimum (LTmin), and critical thermal maximum (CTmax), lethal thermal maximum (LTmax) and biochemical attributes on P. hypophthalmus were evaluated. The results indicated that, dietary supplementation of Zn-NPs increased the CTmin, LTmin and CTmax, LTmax in P. hypophthalmus. Positive correlations were observed between CTmin LTmin (Y = - 0.495 + 10.08x, R2, 0.896) and CTmax LTmax (Y = - 0.872 + 4.43x, R2, 0.940). At the end of the thermal tolerance study, oxidative stress and lipid peroxidation (LPO) were significantly reduced and neurotransmitter enzyme was significantly increased in the groups fed with Zn-NPs @ 10mg and 20mg/kg diet. Overall results indicated that dietary Zn-NPs can confer protection against thermal stress in P. hypophthalmus.

Untranslated regions (UTRs) orchestrate translation reprogramming in cellular stress responses.

Stress is the result of an organism's interaction with environmental challenges. Regulations of gene expression including translation modulations are critical for adaptation and survival under stress. Untranslated regions (UTRs) of the transcripts play significant roles in translation regulation and continue to raise many intriguing questions in our understanding of cellular stress physiology. IRES (Internal ribosome entry site) and uORF (upstream open reading frame) mediated alternative translation initiations are emerging as unique mechanisms. Recent studies have revealed novel means of mRNAs stabilization in stress granules and their reversible modifications. Differential regulation of select transcripts is possible by the interplay between the adenine/uridine-rich elements (AREs) in 3'UTR with their binding proteins (AUBP) and by microRNA-mediated effects. Coordination of these various mechanisms control translation and thereby enables appropriate responses to environmental stress. In this review, we focus on the role of sequence signatures both at 5' and 3'UTRs in translation reprogramming during cellular stress responses.