Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Results 1 - 20 de 243
Filter
1.
Nature ; 621(7978): 300-305, 2023 Sep.
Article in English | MEDLINE | ID: mdl-37704763

ABSTRACT

Crystal phase is a key factor determining the properties, and hence functions, of two-dimensional transition-metal dichalcogenides (TMDs)1,2. The TMD materials, explored for diverse applications3-8, commonly serve as templates for constructing nanomaterials3,9 and supported metal catalysts4,6-8. However, how the TMD crystal phase affects the growth of the secondary material is poorly understood, although relevant, particularly for catalyst development. In the case of Pt nanoparticles on two-dimensional MoS2 nanosheets used as electrocatalysts for the hydrogen evolution reaction7, only about two thirds of Pt nanoparticles were epitaxially grown on the MoS2 template composed of the metallic/semimetallic 1T/1T' phase but with thermodynamically stable and poorly conducting 2H phase mixed in. Here we report the production of MoS2 nanosheets with high phase purity and show that the 2H-phase templates facilitate the epitaxial growth of Pt nanoparticles, whereas the 1T' phase supports single-atomically dispersed Pt (s-Pt) atoms with Pt loading up to 10 wt%. We find that the Pt atoms in this s-Pt/1T'-MoS2 system occupy three distinct sites, with density functional theory calculations indicating for Pt atoms located atop of Mo atoms a hydrogen adsorption free energy of close to zero. This probably contributes to efficient electrocatalytic H2 evolution in acidic media, where we measure for s-Pt/1T'-MoS2 a mass activity of 85 ± 23 A [Formula: see text] at the overpotential of -50 mV and a mass-normalized exchange current density of 127 A [Formula: see text] and we see stable performance in an H-type cell and prototype proton exchange membrane electrolyser operated at room temperature. Although phase stability limitations prevent operation at high temperatures, we anticipate that 1T'-TMDs will also be effective supports for other catalysts targeting other important reactions.

2.
Proc Natl Acad Sci U S A ; 120(32): e2306461120, 2023 Aug 08.
Article in English | MEDLINE | ID: mdl-37523530

ABSTRACT

Electrochemical nitrate reduction reaction (NO3RR) to ammonia has been regarded as a promising strategy to balance the global nitrogen cycle. However, it still suffers from poor Faradaic efficiency (FE) and limited yield rate for ammonia production on heterogeneous electrocatalysts, especially in neutral solutions. Herein, we report one-pot synthesis of ultrathin nanosheet-assembled RuFe nanoflowers with low-coordinated Ru sites to enhance NO3RR performances in neutral electrolyte. Significantly, RuFe nanoflowers exhibit outstanding ammonia FE of 92.9% and yield rate of 38.68 mg h-1 mgcat-1 (64.47 mg h-1 mgRu-1) at -0.30 and -0.65 V (vs. reversible hydrogen electrode), respectively. Experimental studies and theoretical calculations reveal that RuFe nanoflowers with low-coordinated Ru sites are highly electroactive with an increased d-band center to guarantee efficient electron transfer, leading to low energy barriers of nitrate reduction. The demonstration of rechargeable zinc-nitrate batteries with large-specific capacity using RuFe nanoflowers indicates their great potential in next-generation electrochemical energy systems.

3.
Chem Rev ; 123(23): 13489-13692, 2023 Dec 13.
Article in English | MEDLINE | ID: mdl-37962496

ABSTRACT

As a key structural parameter, phase depicts the arrangement of atoms in materials. Normally, a nanomaterial exists in its thermodynamically stable crystal phase. With the development of nanotechnology, nanomaterials with unconventional crystal phases, which rarely exist in their bulk counterparts, or amorphous phase have been prepared using carefully controlled reaction conditions. Together these methods are beginning to enable phase engineering of nanomaterials (PEN), i.e., the synthesis of nanomaterials with unconventional phases and the transformation between different phases, to obtain desired properties and functions. This Review summarizes the research progress in the field of PEN. First, we present representative strategies for the direct synthesis of unconventional phases and modulation of phase transformation in diverse kinds of nanomaterials. We cover the synthesis of nanomaterials ranging from metal nanostructures such as Au, Ag, Cu, Pd, and Ru, and their alloys; metal oxides, borides, and carbides; to transition metal dichalcogenides (TMDs) and 2D layered materials. We review synthesis and growth methods ranging from wet-chemical reduction and seed-mediated epitaxial growth to chemical vapor deposition (CVD), high pressure phase transformation, and electron and ion-beam irradiation. After that, we summarize the significant influence of phase on the various properties of unconventional-phase nanomaterials. We also discuss the potential applications of the developed unconventional-phase nanomaterials in different areas including catalysis, electrochemical energy storage (batteries and supercapacitors), solar cells, optoelectronics, and sensing. Finally, we discuss existing challenges and future research directions in PEN.

4.
J Am Chem Soc ; 146(34): 24141-24149, 2024 Aug 28.
Article in English | MEDLINE | ID: mdl-39162360

ABSTRACT

Facet control and phase engineering of metal nanomaterials are both important strategies to regulate their physicochemical properties and improve their applications. However, it is still a challenge to tune the exposed facets of metal nanomaterials with unconventional crystal phases, hindering the exploration of the facet effects on their properties and functions. In this work, by using Pd nanoparticles with unconventional hexagonal close-packed (hcp, 2H type) phase, referred to as 2H-Pd, as seeds, a selective epitaxial growth method is developed to tune the predominant growth directions of secondary materials on 2H-Pd, forming Pd@NiRh nanoplates (NPLs) and nanorods (NRs) with 2H phase, referred to as 2H-Pd@2H-NiRh NPLs and NRs, respectively. The 2H-Pd@2H-NiRh NRs expose more (100)h and (101)h facets on the 2H-NiRh shells compared to the 2H-Pd@2H-NiRh NPLs. Impressively, when used as electrocatalysts toward hydrogen oxidation reaction (HOR), the 2H-Pd@2H-NiRh NRs show superior activity compared to the NiRh alloy with conventional face-centered cubic (fcc) phase (fcc-NiRh) and the 2H-Pd@2H-NiRh NPLs, revealing the crucial role of facet control in enhancing the catalytic performance of unconventional-phase metal nanomaterials. Density functional theory (DFT) calculations further unravel that the excellent HOR activity of 2H-Pd@2H-NiRh NRs can be attributed to the more exposed (100)h and (101)h facets on the 2H-NiRh shells, which possess high electron transfer efficiency, optimized H* binding energy, enhanced OH* binding energy, and a low energy barrier for the rate-determining step during the HOR process.

5.
Mol Pain ; 20: 17448069241226960, 2024.
Article in English | MEDLINE | ID: mdl-38172075

ABSTRACT

Repeated use of opioid analgesics may cause a paradoxically exacerbated pain known as opioid-induced hyperalgesia (OIH), which hinders effective clinical intervention for severe pain. Currently, little is known about the neural circuits underlying OIH modulation. Previous studies suggest that laterocapsular division of the central nucleus of amygdala (CeLC) is critically involved in the regulation of OIH. Our purpose is to clarify the role of the projections from infralimbic medial prefrontal cortex (IL) to CeLC in OIH. We first produced an OIH model by repeated fentanyl subcutaneous injection in male rats. Immunofluorescence staining revealed that c-Fos-positive neurons were significantly increased in the right CeLC in OIH rats than the saline controls. Then, we used calcium/calmodulin-dependent protein kinase IIα (CaMKIIα) labeling and the patch-clamp recordings with ex vivo optogenetics to detect the functional projections from glutamate pyramidal neurons in IL to the CeLC. The synaptic transmission from IL to CeLC, shown in the excitatory postsynaptic currents (eEPSCs), inhibitory postsynaptic currents (eIPSCs) and paired-pulse ratio (PPR), was observably enhanced after fentanyl administration. Moreover, optogenetic activation of this IL-CeLC pathway decreased c-Fos expression in CeLC and ameliorated mechanical and thermal pain in OIH. On the contrary, silencing this pathway by chemogenetics exacerbated OIH by activating the CeLC. Combined with the electrophysiology results, the enhanced synaptic transmission from IL to CeLC might be a cortical gain of IL to relieve OIH rather than a reason for OIH generation. Scaling up IL outputs to CeLC may be an effective neuromodulation strategy to treat OIH.


Subject(s)
Analgesics, Opioid , Hyperalgesia , Rats , Male , Animals , Hyperalgesia/metabolism , Analgesics, Opioid/metabolism , Rats, Sprague-Dawley , Amygdala/metabolism , Pain/metabolism , Fentanyl , Prefrontal Cortex/metabolism
6.
Cerebrovasc Dis ; 53(2): 176-183, 2024.
Article in English | MEDLINE | ID: mdl-37598670

ABSTRACT

INTRODUCTION: Whether time window affects the intravenous thrombolysis (IVT) effect before endovascular thrombectomy (EVT) is uncertain. We aimed to investigate the effect of different time windows (0-3 h and >3-4.5 h from stroke onset to randomization) on clinical outcomes of EVT with or without IVT in a subgroup analysis of DIRECT-MT. METHODS: The primary outcome was the 90-day modified Rankin Scale (mRS) according to time window. Logistic regression models were used to analyze the effect of different treatments (EVT with or without IVT) on outcomes within 0-3 h or >3-4.5 h. RESULTS: Among 656 patients who were included in the analysis, 282 (43.0%) were randomized within >3-4.5 h after stroke onset (125 without IVT and 157 with IVT), and 374 (57.0%) were randomized within 0-3 h (202 without IVT and 172 with IVT). We noted no significant difference in the thrombectomy-alone effect between the time window subgroups according to 90-day ordinal mRS (adjusted common odds ratio [acOR] in patients within 0-3 h: 1.06 [95% CI: 0.73-1.52], acOR in patients within >3-4.5 h: 1.19 [95% CI: 0.78-1.82]) and 90-day functional independence. Thrombectomy alone resulted in an increased proportion of patients with 90-day mRS 0-3 treated within >3-4.5 h (62.90 vs. 48.72%) but not within 0-3 h (65.84 vs. 63.95%). However, there was no interaction effect regarding all outcomes after the Bonferroni correction. CONCLUSIONS: Our results did not support thrombectomy-alone administration within 3-4.5 h in patients with acute ischemic stroke from large-vessel occlusion in the subgroup analysis of DIRECT-MT.


Subject(s)
Endovascular Procedures , Ischemic Stroke , Thrombectomy , Humans , Endovascular Procedures/methods , Ischemic Stroke/drug therapy , Ischemic Stroke/surgery , Thrombectomy/methods , Thrombolytic Therapy/methods , Treatment Outcome , Time Factors
7.
Inorg Chem ; 63(7): 3411-3417, 2024 Feb 19.
Article in English | MEDLINE | ID: mdl-38311915

ABSTRACT

In the past decade, metal halide materials have been favored by many researchers because of their excellent physical and chemical properties under thermal, electrical, and light stimuli, such as ferroelectricity, dielectric, nonlinearity, fluorescence, and semiconductors, greatly promoting their application in optoelectronic devices. In this study, we successfully constructed an unleaded organic-inorganic hybrid perovskite crystal: [Cl-C6H4-(CH2)2NH3]3SbBr6 (1), which underwent a high-temperature reversible phase transition near Tp = 368 K. The phase transition behavior of 1 was characterized by differential scanning calorimetry, accompanied by a thermal hysteresis of 6 K. In addition, variable-temperature Raman spectroscopy analysis and PXRD further verified the sensitivity of 1 to temperature and the phase transition from low symmetry to high symmetry. Temperature-dependent dielectric testing shows that 1 can be a sensitive switching dielectric constant switching material. Remarkably, 1 exhibits strong photoluminescence emission with a wavelength of 478 nm and a narrow band gap of 2.7 eV in semiconductors. As the temperature increases and decreases, fluorescence undergoes significant changes, especially near Tc, which further confirms the reversible phase transition of 1. All of these findings provide new avenues for designing and assembling new phase change materials with high Tp and photoluminescence properties.

8.
Environ Res ; 244: 117957, 2024 Mar 01.
Article in English | MEDLINE | ID: mdl-38128603

ABSTRACT

Coal mining can significantly impact vegetation evolution, yet the limited information on its patterns and driving factors hampers efforts to mitigate these effects and reclaim abandoned mines. This study aimed to 1) examine vegetation evolution in a semiarid steppe watershed in northeast China; and 2) characterize the driving factors behind this evolution. We analyzed the impact of twelve selected driving factors on fractional vegetation coverage (FVC) from 2000 to 2021 using a dimidiate pixel model, Sen's slope analysis, Mann-Kendall trend test, coefficient of variation analysis, and Geodetector model. At a significance level of α = 0.05, our findings revealed a south-to-north decline pattern in FVC, a significant decrease trend in proximity to coal mines, and a notable increase trend adjacent to river channels. Approximately 37% of the watershed exhibited low FVC, while the overall temporal trend across the watershed was deemed insignificant. Areas surrounding the mines experienced a substantial reduction in FVC due to coal mining activities, while FVC variations across the watershed were linked to precipitation, temperature, and soil type. FVC predictions improved notably when interactions between multiple two-way factors were considered. Each driving factors displayed an optimal range (e.g., precipitation = 63-71 mm) for maximizing FVC. Given the study watershed's status as a national energy base, understanding vegetation responses to coal mining and climate-environment changes is crucial for sustaining fragile terrestrial ecosystems and socioeconomic development. Achieving a long-time balance between coal extraction and ecological protection is essential. The study outcomes hold significant promise for advancing ecological conservation, vegetation restoration, and mitigation of environmental degradation in semiarid regions affected by extensive coal mining and climate fluctuations. These findings contribute to the strategic management of such areas, promoting sustainable practices amidst evolving environmental challenges.


Subject(s)
Coal Mining , Ecosystem , Grassland , Temperature , China , Coal
9.
BMC Nephrol ; 25(1): 252, 2024 Aug 07.
Article in English | MEDLINE | ID: mdl-39112935

ABSTRACT

MicroRNAs (miRNAs) are 18-25 nucleotides long, single-stranded, non-coding RNA molecules that regulate gene expression. They play a crucial role in maintaining normal cellular functions and homeostasis in organisms. Studies have shown that miR-124-3p is highly expressed in brain tissue and plays a significant role in nervous system development. It is also described as a tumor suppressor, regulating biological processes like cancer cell proliferation, apoptosis, migration, and invasion by controlling multiple downstream target genes. miR-124-3p has been found to be involved in the progression of various kidney diseases, including diabetic kidney disease, calcium oxalate kidney stones, acute kidney injury, lupus nephritis, and renal interstitial fibrosis. It mediates these processes through mechanisms like oxidative stress, inflammation, autophagy, and ferroptosis. To lay the foundation for future therapeutic strategies, this research group reviewed recent studies on the functional roles of miR-124-3p in renal diseases and the regulation of its downstream target genes. Additionally, the feasibility, limitations, and potential application of miR-124-3p as a diagnostic biomarker and therapeutic target were thoroughly investigated.


Subject(s)
Kidney Diseases , MicroRNAs , MicroRNAs/metabolism , MicroRNAs/genetics , Humans , Kidney Diseases/genetics , Kidney Diseases/metabolism , Diabetic Nephropathies/metabolism , Diabetic Nephropathies/genetics , Acute Kidney Injury/genetics , Acute Kidney Injury/metabolism , Animals , Oxidative Stress , Lupus Nephritis/genetics , Lupus Nephritis/metabolism , Kidney Calculi/genetics , Kidney Calculi/metabolism
10.
Palliat Support Care ; : 1-7, 2024 May 13.
Article in English | MEDLINE | ID: mdl-38736428

ABSTRACT

OBJECTIVES: In Chinese culture, family members are the main decision maker on end-of-life (EoL) issues for patients with advanced cancer. Yet little is known about Chinese families' confidence in making EoL decisions and its associated factors. This study aims to investigate the status and associated factors of Chinese family members' confidence in making EoL decisions for patients with advanced cancer. METHODS: This cross-sectional study used a convenience sample of 147 family members of patients with stage III or stage IV cancer from a tertiary cancer center in Guangzhou, China. The questionnaires included demographic information of patients and their family members, patients' EoL preferences, and the Chinese version of the Family Decision-Making Self-Efficacy (FDMSE) Scale. RESULTS: A total of145 family members (98.64%) completed the questionnaires. The average score of FDMSE was 3.92 ± 0.53. A multiple regression analysis showed that the factors associated with FDMSE included patients' duration of disease, health insurance, participation in EoL decision-making, the expression of unfilled wishes, and family members' employment status. SIGNIFICANCE OF RESULTS: Chinese family members were not confident enough in making EoL decisions for patients with advanced cancer. It is recommended to develop cultural-tailored advanced care planning models to clarify patient preferences and to enhance the family members' self-efficacy in making EoL decisions with or for patients with advanced cancer.

11.
Angew Chem Int Ed Engl ; 63(26): e202402841, 2024 Jun 21.
Article in English | MEDLINE | ID: mdl-38647519

ABSTRACT

The controlled synthesis of metal nanomaterials with unconventional phases is of significant importance to develop high-performance catalysts for various applications. However, it remains challenging to modulate the atomic arrangements of metal nanomaterials, especially the alloy nanostructures that involve different metals with distinct redox potentials. Here we report the general one-pot synthesis of IrNi, IrRhNi and IrFeNi alloy nanobranches with unconventional hexagonal close-packed (hcp) phase. Notably, the as-synthesized hcp IrNi nanobranches demonstrate excellent catalytic performance towards electrochemical nitrite reduction reaction (NO2RR), with superior NH3 Faradaic efficiency and yield rate of 98.2 % and 34.6 mg h-1 mgcat -1 (75.5 mg h-1 mgIr -1) at 0 and -0.1 V (vs reversible hydrogen electrode), respectively. Ex/in situ characterizations and theoretical calculations reveal that the Ir-Ni interactions within hcp IrNi alloy improve electron transfer to benefit both nitrite activation and active hydrogen generation, leading to a stronger reaction trend of NO2RR by greatly reducing energy barriers of rate-determining step.

12.
J Cell Physiol ; 238(7): 1605-1621, 2023 07.
Article in English | MEDLINE | ID: mdl-37269461

ABSTRACT

Cadmium (Cd) is a toxic metal pollutant that still exists in the environment. The microRNA (miRNA) is a type of noncoding RNA that plays an important role in gene posttranscriptional regulation and disease development. Although the toxic effects of Cd have been extensively studied, studies on the mechanism of Cd from the perspective of miRNA are still limited. So, we established a Cd-exposure pig model, which confirmed that Cd exposure would cause pig artery damage. The miR-210 with the most reduced expression and the nuclear factor kappa B (NF-κB) that had a targeting relationship with miR-210 were screened. The effect of miR-210/NF-κB on the artery damage induced by Cd exposure was investigated by acridine orange/ethidium bromide staining, reactive oxygen species (ROS) staining, quantitative PCR, and western blotting. The results showed that miR-210 inhibitor, pcDNA-NF-κB could induce ROS overproduction in pig hip artery endothelial cells, thus inducing Th1/Th2 imbalance and necroptosis, leading to increased inflammation, while small interfering RNA-NF-κB played a mitigating role. In conclusion, Cd can induce artery necroptosis and Th1/Th2 imbalance by regulating the miR-210/NF-κB axis, so as to lead to artery inflammatory damage. In this study, we explored the way in which Cd exposure causes artery damage in pig, providing a new perspective on the regulatory damage of miR-210/NF-κB axis.


Subject(s)
Arteritis , Cadmium , MicroRNAs , NF-kappa B , Animals , Arteries/metabolism , Cadmium/toxicity , Endothelial Cells/metabolism , MicroRNAs/metabolism , NF-kappa B/genetics , NF-kappa B/metabolism , Reactive Oxygen Species/metabolism , Swine , Arteritis/metabolism
13.
Fish Shellfish Immunol ; 141: 109000, 2023 Oct.
Article in English | MEDLINE | ID: mdl-37597642

ABSTRACT

3, 3', 4, 4', 5-pentachlorobiphenyl (PCB126) is extensively utilized in electronic products, lubricant, and insecticide due to its excellent chemical stability and insulation prosperity, resulting in its frequent detection in environment. In addition, atmospheric deposition, as well as industrial and urban wastewater discharge can also lead to PCB126 contamination in marine environment, triggering damages to the tissues of aquatic organisms through oxidative stress. Astilbin is a type of flavonoid compound found in plants that plays a crucial role in providing powerful antioxidant and anti-inflammatory properties. In this study, we aimed to investigate the specific mechanism of PCB126-induced damage and the potential protective effect of Astilbin. To achieve this, we treated grass carp hepatocytes (L8824) with 75 µM PCB126 and/or 0.5 mM Astilbin for 24 h and used experimental methods such as Flow cytometry, molecular docking, PPI analysis, detection of commercial kits (ATP concentration and ATPnase activity) and measurement of mitochondrial membrane potential (ΔΨm). Our findings revealed that PCB126 exposure resulted in a decrease in expression levels of Sirt1, factors related to mitochondrial fusion (Opa1, Mfn1, and Mfn2), antioxidant (CAT, SOD1, and SOD2), energy metabolism (PKM2, IDH, and SDH) and anti-apoptosis (Bcl-2), and an increase in expression levels of Nrf2 acetylation, mitochondrial fission (Drp1), factors that promote apoptosis (Cytc, Bax, Cas9, and Cas3) in L8824 cells. Furthermore, our findings revealed a decrease in ΔΨm, ATP concentration and ATPnase activity and apoptosis levels in L8824 cells. Noteworthy, treatment with Astilbin reversed these results. Molecular docking provides solid evidence for the interaction between Astilbin and Sirt1. In summary, our findings suggested that Astilbin promoted the deacetylation of Nrf2 by interacting with Sirt1, thereby alleviating PCB126-induced mitochondrial apoptosis mediated by mitochondrial dynamics imbalance and energy metabolism disorder through the inhibition of oxidative stress in L8824 cells. Our research has initially revealed the correlation between acetylation and apoptosis induced by PCB126, which provided a foundation for a better comprehension of PCB126 toxicity. Additionally, it expanded the potential application value of Astilbin.


Subject(s)
Antioxidants , Carps , Animals , Antioxidants/metabolism , NF-E2-Related Factor 2/genetics , NF-E2-Related Factor 2/metabolism , Sirtuin 1/genetics , Sirtuin 1/metabolism , Acetylation , Carps/metabolism , Molecular Docking Simulation , Oxidative Stress , Hepatocytes , Apoptosis , Adenosine Triphosphate/metabolism
14.
Int Arch Occup Environ Health ; 96(6): 857-868, 2023 Aug.
Article in English | MEDLINE | ID: mdl-37067574

ABSTRACT

BACKGROUND: As a chronic occupational disease, silicosis could cause irreversible and incurable impair to the lung. The current diagnosis of silicosis relies on imaging of X-ray or CT, but these methods cannot detect lung lesions in the early stage of silicosis. OBJECTIVE: To establish a regular screening and early diagnosis methods for silicosis, which could be helpful for the prevention and treatment of silicosis. METHODS: A total of 161 subjects were enrolled in the study, including 69 patients with silicosis (SILs) and 92 healthy controls. The exhaled breath samples of the subjects were collected with breath sampler and Tedlar bag. The analysis of volatile organic compounds (VOCs) in exhaled breath was performed by solid-phase microextraction (SPME) combined with gas chromatography mass spectrometry (GC-MS). RESULTS: After excluding the pollutants from sampling bags and instruments, 86 VOCs have been identified in the exhaled breath. The orthogonal partial least squares-discriminant analysis (OPLS-DA) was employed for the screening of potential biomarkers of silicosis. Those components that related to smoking were also excluded from the biomarkers. Finally, nine possible biomarkers for silicosis were screened out, including 2,3-butanedione, ethyl acetate, chlorobenzene, o-cymene, 4-ethylhex-2-ynal, 3,5-dimethyl-3-heptanol, hydroquinone, phthalic anhydride and 5-(2-methylpropyl)nonane. Based on these biomarkers screened, a predicted model for silicosis was generated with the accuracy of 89.61%. CONCLUSION: The nine biomarkers in exhaled breath were preliminarily screened out for the early diagnosis of silicosis, which can be helpful to the establishment of a noninvasive screening method for silicosis. Follow-up studies should be conducted to further verify these markers.


Subject(s)
Silicosis , Volatile Organic Compounds , Humans , Gas Chromatography-Mass Spectrometry/methods , Solid Phase Microextraction , Breath Tests/methods , Biomarkers/analysis , Silicosis/diagnosis , Volatile Organic Compounds/analysis
15.
J Appl Toxicol ; 43(2): 287-297, 2023 02.
Article in English | MEDLINE | ID: mdl-35982029

ABSTRACT

As one of the most popular beverages, green tea has attracted much interest for its beneficial effects on human health. However, the toxicity of green tea and its underlying mechanism are still poorly understood. Here, we evaluated the effect of green tea and its constituents on development by exposing zebrafish embryos to them. Morphologic results demonstrated that 0.1% and 0.2% green tea increased mortality, delayed epiboly of gastrulation, and shortened body length. Green tea altered the expression pattern of dlx3, cstlb, myod, and papc and decreased the expression levels of wnt5 and wnt11, suggesting that green tea disturbed convergence and extension movement through the downregulation of wnt5 and wnt11. The increased expression of the dorsal gene chordin and reduced expression of wnt8 and its target genes vox and vent in embryos exposed to 0.1% and 0.2% green tea indicated that green tea could affect dorsoventral differentiation by inhibiting the wnt8 signaling pathway. Additionally, green tea could inhibit epiboly progression by disrupting F-actin organization or removing F-actin in vegetal yolks during gastrulation. However, no malformation was caused by exposure to the five catechins and gallic acid individually. The mixture of constituents showed a similar effect to green tea solution on the embryos, such as smaller eyes and head, shorter body length, and slower heart rate, which indicated that the effect of green tea solution on embryo development was mainly due to the comprehensive effect of multiple components in the green tea solution.


Subject(s)
Zebrafish Proteins , Zebrafish , Animals , Humans , Zebrafish/genetics , Zebrafish Proteins/genetics , Zebrafish Proteins/metabolism , Actins/metabolism , Tea/metabolism , Embryonic Development
16.
Environ Toxicol ; 38(12): 2993-3005, 2023 Dec.
Article in English | MEDLINE | ID: mdl-37598416

ABSTRACT

3,3',4,4',5-pentachlorobiphenyl (PCB126) is widely distributed, non-degradable and bioaccumulative, which can affect the function of tissues and organs of the living organisms. Melatonin (MT) is a sort of indole neurohormone that is mainly secreted by the pineal gland. Numerous studies have shown that MT can alleviate intestinal injury through various mechanisms such as antioxidant, anti-inflammatory, and anti-apoptosis. For the above reasons, the aim of this study is to explore the mechanism of intestinal injury in mice after exposure to PCB126 as well as the antagonistic effect of MT. Mice were respectively fed PCB126 (0.326 mg/kg) and/or MT (10 mg/kg) in vivo. In vitro, colonic epithelial cells (MCEC) were treated with PCB126 (150 µM) and/or MT (2 mM). We found that the microscopic structure of colon tissue was impaired after exposure to PCB126. The levels of oxidative stress, the protein and mRNA levels of expression of inflammatory related factors were significantly increased and the expression levels of intestinal tight junction protein were decreased. Notably, MT can promote Nrf2/HO-1 expression level and reduce the colonic injury caused by PCB126. Further in vitro treatment with reactive oxygen species inhibitors (NAC) showed that it significantly alleviated PCB126-induced in MCEC cell damage. In summary, the above results suggested that MT alleviates PCB126-induced colon inflammation by inhibiting the overproduction of reactive oxygen species (ROS) and up-regulating the expression level of intestinal tight junction protein. Our results contribute to the further comprehension of the intestinal toxicity effects of PCB126 and the significant role of MT in preserving the mechanisms of intestinal injury.


Subject(s)
Melatonin , Mice , Animals , Melatonin/pharmacology , Reactive Oxygen Species/metabolism , Oxidative Stress , Colon/metabolism , Tight Junction Proteins
17.
Plant Dis ; 2023 Mar 27.
Article in English | MEDLINE | ID: mdl-36973903

ABSTRACT

Radish (Raphanus sativus L.) is a widely consumed vegetable in China. However, radish is susceptible to diseases, which limits its yield and development in Harbin, China. In September 2021, rotten white radish tubers were observed in the field. The incidence of this disease reached 70% in October 2021, which led to huge economic losses (i.e., 30%-40%). Water-soaked lesions appeared on the radish tubers and appeared brown-yellow, which looked similar to ginger tuber rot caused by Enterobacter asburiae (Zhang et al. 2020). The interior was rotten with no considerable smell. Over time, the lesions gradually spread into all tubers of radish. Small square pieces of radish (0.5 cm × 0.5 cm) were excised from the junction of diseased and healthy tuber, disinfected with 75% alcohol, and washed three times with distilled water then ground to prepare tissue suspensions for plating. Under 28 ℃ for 16h, single colonies were isolated from the beef extract culture medium. Single colonies appeared oval, white, and smooth, with bright and slightly raised surfaces, and with moist neat edges. Gram-negative bacterial strain CCGL 988 was obtained, with an average size of 1-2 µm × 0.5-1 µm, and 3-4 flagella. Physiological and biological test results showed that strain CCGL 988 produced acid utilizing sucrose, glucose, maltobiose, D-Sorbitol, and mannitol; negative for Voges-Proskauer, methyl red, malanate, ornithine decarboxylase, arginine decarboxylase, and lysine decarboxylase. According to the results, strain CCGL 988 was identified as Enterobacter asburiae (Hoffmann et al. 2005). The 16S rDNA region of the strain was amplified using PCR with 27F/1492R primers (López et al. 2019), and partial gyrB, atpD, rpoB genes were amplified according to Zhang et al. (2020), infB gene was amplified with primers (F:TCAATGCGTGCTCGTGGTGCTC; R: TCGATACAGTGCCACTTCACG). The 16S rDNA, gyrB, atpD, rpoB and infB sequences were deposited in GenBank under accession numbers: ON999069, OP006448, OP006449, OP006450, and OP542231, respectively. These five sequences shared 99.80%, 100%, 100%, 100% and 100% of identity with E. asburiae (GenBank Accession: NO. CP011863). Maximum-likelihood phylogenetic tree clustered CCGL 988 with E. asburiae (MEGA7, bootstrap n = 1,000). Strain CCGL 988 was able to produce pectate lyases, polygalacturonases, cellulases, proteases, and extracellular polysaccharide using the methods described by Hugouviex-Cotte-Pattat et al. (2014), and Condemine et al. (1999). Koch's postulates were conducted by inoculating 20 µl of the bacterial suspension (108 CFU/ml) on the needle wound on the surface of six healthy radish tubers; six radish tubers incubated with sterile water were negative controls. Radish tubers were incubated at 28 ℃ with 80% humidity. The inoculated radish was slightly rotten after 7 days. Water-soaked lesions with light yellow were initially observed; after 12 days, the lesions expanded gradually and appeared deep yellow. No symptoms were found in the control radish. This experiment was carried out three times, each time with three replications. The bacterium was reisolated from infected radish tuber and was confirmed to be E. asburiae by the same molecular and morphological characterization as described above. This study is the first report of E. asburiae causing radish tuber rot in China. It serves as a basis for future studies to develop management strategies for the disease to prevent radish yield loss.

18.
Zhongguo Zhong Yao Za Zhi ; 48(13): 3633-3649, 2023 Jul.
Article in Zh | MEDLINE | ID: mdl-37474996

ABSTRACT

This study aimed to evaluate the efficacy and safety of various Chinese patent medicines in the treatment of inflammatory response in diabetic nephropathy(DN) based on network Meta-analysis. Randomized controlled trial(RCT) of oral Chinese patent medicines for improving inflammatory response in patients with DN was retrieved from CNKI, Wanfang, VIP, SinoMed, PubMed, Cochrane Library, EMbase, Web of Science, and other databases from database inception to October 2022. All investigators independently screened the literature, extracted data, and evaluated the quality. Stata 16.0 software and RevMan 5.4.1 were used to analyze the data of the literature that met the quality standards. Finally, 53 RCTs were included, involving 6 Chinese patent medicines. The total sample size was 4 891 cases, including 2 449 cases in the test group and 2 442 cases in the control group. The network Meta-analysis showed that(1) in terms of reducing TNF-α, the top 3 optimal interventions according to the surface under the cumulative ranking curve(SUCRA) were Shenshuaining Capsules/Granules/Tablets + conventional western medicine, Jinshuibao Capsules + conventional western medicine, and Niaoduqing Granules + conventional western medicine.(2) In terms of reducing hs-CRP, the top 3 optimal interventions according to SUCRA were Bailing Capsules + conventional western medicine, Tripterygium Glycosides Tablets + conventional western medicine, and Shenshuaining Capsules/Granules/Tablets + conventional western medicine.(3) In terms of reducing IL-6, the top 3 optimal interventions according to SUCRA were Bailing Capsules + conventional western medicine, Tripterygium Glycosides Tablets + conventional western medicine, and Jinshuibao Capsules + conventional western medicine.(4) In terms of reducing UAER, the top 3 optimal interventions according to SUCRA were Shenshuaining Capsules/Granules/Tablets + conventional western medicine, Huangkui Capsules + conventional western medicine, and Jinshuibao Capsules + conventional western medicine.(5) In terms of reducing Scr, the top 3 optimal interventions according to SUCRA were Jinshuibao Capsules + conventional western medicine, Niaoduqing Granules + conventional wes-tern medicine, and Tripterygium Glycosides Tablets + conventional western medicine.(6) In terms of reducing BUN, the first 3 optimal interventions according to SUCRA were Niaoduqing Granules + conventional western medicine, Tripterygium Glycosides Tablets + conventional western medicine, and Huangkui Capsules + conventional western medicine.(7) In terms of improving the clinical total effective rate, the first 3 optimal interventions according to SUCRA were Jinshuibao Capsules + conventional western medicine, Niaoduqing Granu-les + conventional western medicine, and Huangkui Capsules + conventional western medicine. The results showed that the combination of western medicine and Chinese patent medicine could reduce the expression of serum inflammatory factors TNF-α, hs-CRP, and IL-6 and inhibit the inflammatory response. The combination of western medicine and Chinese patent medicine was superior to western medicine alone in reducing Scr, BUN, and UAER, and improving the total effective rate of treatment. Due to the limitation of the quantity and quality of literature included, the above conclusions need to be validated by more high-quality studies.


Subject(s)
Diabetes Mellitus , Diabetic Nephropathies , Drugs, Chinese Herbal , Humans , Tumor Necrosis Factor-alpha , Network Meta-Analysis , Nonprescription Drugs , Diabetic Nephropathies/drug therapy , C-Reactive Protein , Capsules , Interleukin-6 , Drugs, Chinese Herbal/therapeutic use , Glycosides , Tablets , Diabetes Mellitus/drug therapy
19.
Zhongguo Zhong Yao Za Zhi ; 48(22): 6200-6215, 2023 Nov.
Article in Zh | MEDLINE | ID: mdl-38114227

ABSTRACT

This study aimed to evaluate the efficacy and safety of various Chinese patent medicines in the treatment of inflammatory response in chronic glomerulonephritis(CGN) based on network Meta-analysis. Randomized controlled trial(RCT) of oral Chinese patent medicines for improving inflammatory response in patients with CGN was retrieved from databases such as CNKI, Wanfang, VIP, SinoMed, PubMed, Cochrane Library, EMbase, and Web of Science from database inception to March 2023. All investigators independently screened the literature, extracted data, and evaluated the quality. Stata 16.0 and RevMan 5.4.1 software were used to analyze the data of the literature that met the quality standards. Finally, 71 RCTs were included, involving 7 Chinese patent medicines. The total sample size was 6 880 cases, including 3 441 cases in the test group and 3 439 cases in the control group. The network Meta-analysis showed that(1) in terms of reducing TNF-α, the top 3 optimal interventions according to the surface under the cumulative ranking curve(SUCRA) were Shenyanshu Capsules/Granules/Tablets+conventional western medicine, Huangkui Capsules+conventional western medicine, and Bailing Capsules+conventional western medicine.(2) In terms of reducing hs-CRP, the top 3 optimal interventions according to SUCRA were Yishen Huashi Granules+conventional western medicine, Huangkui Capsules+conventional wes-tern medicine, and Bailing Capsules+conventional western medicine.(3) In terms of reducing IL-6, the top 3 optimal interventions according to SUCRA were Yishen Huashi Granules+conventional western medicine, Bailing Capsules+conventional western medicine, and Shenyan Kangfu Tablets+conventional western medicine.(4) In terms of reducing 24hUTP, the top 3 optimal interventions according to SUCRA were Shenyan Kangfu Tablets+conventional western medicine, Bailing Capsules+conventional western medicine, and Huangkui Capsules+conventional western medicine.(5) In terms of reducing Scr, the top 3 optimal interventions according to SUCRA were Bailing Capsules+conventional western medicine, Shenyanshu Capsules/Granules/Tablets+conventional western medicine, and Yishen Huashi Granules+conventional western medicine.(6) In terms of reducing BUN, the top 3 optimal interventions according to SUCRA were Yishen Huashi Granules+conventional western medicine, Shenyanshu Capsules/Granules/Tablets+conventional western medicine, and Bailing Capsules+conventional western medicine.(7) In terms of improving the clinical total effective rate, the top 3 optimal interventions according to SUCRA were Huangkui Capsules+conventional western medicine, Kunxian Capsules+conventional western medicine, and Yishen Huashi Granules+conventional western medicine. The results showed that the combination of conventional western medicine and Chinese patent medicine could reduce the expression of serum inflammatory factors TNF-α, hs-CRP, and IL-6 and inhibit the inflammatory response. The combination of conventional western medicine and Chinese patent medicine was superior to conventional western medicine alone in reducing Scr, BUN, and 24hUTP, and improving the clinical total effective rate of treatment. Due to the limitation of the quantity and quality of literature included, the above conclusions need to be validated by more high-quality studies.


Subject(s)
Drugs, Chinese Herbal , Glomerulonephritis , Humans , Tumor Necrosis Factor-alpha , Network Meta-Analysis , Nonprescription Drugs , C-Reactive Protein , Interleukin-6 , Drugs, Chinese Herbal/therapeutic use , Glomerulonephritis/drug therapy
20.
J Am Chem Soc ; 144(1): 547-555, 2022 Jan 12.
Article in English | MEDLINE | ID: mdl-34932339

ABSTRACT

Controlled construction of bimetallic nanostructures with a well-defined heterophase is of great significance for developing highly efficient nanocatalysts and investigating the structure-dependent catalytic performance. Here, a wet-chemical synthesis method is used to prepare Au@Pd core-shell nanorods with a unique fcc-2H-fcc heterophase (fcc: face-centered cubic; 2H: hexagonal close-packed with a stacking sequence of "AB"). The obtained fcc-2H-fcc heterophase Au@Pd core-shell nanorods exhibit superior electrocatalytic ethanol oxidation performance with a mass activity as high as 6.82 A mgPd-1, which is 2.44, 6.96, and 6.43 times those of 2H-Pd nanoparticles, fcc-Pd nanoparticles, and commercial Pd/C, respectively. The operando infrared reflection absorption spectroscopy reveals a C2 pathway with fast reaction kinetics for the ethanol oxidation on the prepared heterophase Au@Pd nanorods. Our experimental results together with density functional theory calculations indicate that the enhanced performance of heterophase Au@Pd nanorods can be attributed to the unconventional 2H phase, the 2H/fcc phase boundary, and the lattice expansion of the Pd shell. Moreover, the heterophase Au@Pd nanorods can also serve as an efficient catalyst for the electrochemical oxidation of methanol, ethylene glycol, and glycerol. Our work in the area of phase engineering of nanomaterials (PENs) opens the way for developing high-performance electrocatalysts toward future practical applications.

SELECTION OF CITATIONS
SEARCH DETAIL