ABSTRACT
Sugar beet (Beta vulgaris) is grown in temperate regions around the world as a source of sucrose used for natural sweetening. Sugar beet is susceptible to a number of viral diseases, but identification of the causal agent(s) under field conditions is often difficult due to mixtures of viruses that may be responsible for disease symptoms. In this study, the application of RNAseq to RNA extracted from diseased sugar beet roots obtained from the field and from greenhouse-reared plants grown in soil infested with the virus disease rhizomania (causal agent beet necrotic yellow vein virus; BNYVV) yielded genome-length sequences from BNYVV, as well as beet soil-borne virus (BSBV). The nucleotide identities of the derived consensus sequence of BSBV RNAs ranged from 99.4 to 96.7% (RNA1), 99.3 to 95.3% (RNA2), and 98.3 to 95.9% (RNA3) compared with published BSBV sequences. Based on the BSBV genome consensus sequence, clones of the genomic RNAs 1, 2, and 3 were obtained to produce RNA copies of the genome through in vitro transcription. Capped RNA produced from the clones was infectious when inoculated into leaves of Chenopodium quinoa and B. vulgaris, and extracts from transcript-infected C. quinoa leaves could infect sugar beet seedling roots through a vortex inoculation method. Subsequent exposure of these infected sugar beet seedling roots to aviruliferous Polymyxa betae, the protist vector of both BNYVV and BSBV, confirmed that BSBV derived from the infectious clones could be transmitted by the vector. Co-inoculation of BSBV synthetic transcripts with transcripts of a cloned putative satellite virus designated Beta vulgaris satellite virus 1A (BvSat1A) resulted in the production of lesions on leaves of C. quinoa similar to those produced by inoculation with BSBV alone. Nevertheless, accumulation of genomic RNA and the encoded protein of the satellite virus in co-inoculated leaves was readily detected on Northern and Western blots, respectively, whereas no accumulation of satellite virus products occurred when satellite virus RNA was inoculated alone. The predicted sequence of the detected protein encoded by BvSat1A bears hallmarks of coat proteins of other satellite viruses, and virions of a size consistent with a satellite virus were observed in samples testing positive for the virus. The results demonstrate that BSBV is a helper virus for the novel satellite virus BvSat1A.
Subject(s)
Beta vulgaris , Plant Diseases , Plant Viruses , Satellite Viruses , Beta vulgaris/virology , Plant Diseases/virology , Satellite Viruses/genetics , Satellite Viruses/physiology , Plant Viruses/genetics , Plant Viruses/physiology , Helper Viruses/genetics , Helper Viruses/physiology , RNA, Viral/genetics , Plant Roots/virology , Genome, Viral/genetics , Soil MicrobiologyABSTRACT
The increasing prevalence of whitefly-transmitted viruses affecting cucurbit crops has emerged as a significant concern for global cucurbit production. Two of the most widely prevalent threats in the Americas are cucurbit yellow stunting disorder virus (CYSDV) and cucurbit chlorotic yellows virus (CCYV) (Crinivirus, Closteroviridae). These viruses induce similar foliar symptoms on cucurbit crops (Mondal et al., 2023) leading to loss of photosynthetic capability and decreased yields. Cantaloupe (Cucumis melo), watermelon (Citrullus lanatus), and cucumber (Cucumis sativus) are major cucurbit crops in St. Elizabeth, Jamaica, which is the principal fruit and vegetable producing region of the country. In August 2018, foliar symptoms were observed on cantaloupe, watermelon, and cucumber plants in several commercial farms in St. Elizabeth. These symptoms, mainly on the older leaves, consisted of severe yellowing or interveinal mottle and they appeared more pronounced on cantaloupe and cucumber plants compared to watermelon. Growers noticed the production of smaller than normal fruit. Disease incidence ranged from 10 to 100% and whiteflies (Bemisia tabaci Gennadius) were observed in the fields. To identify virus(es) associated with the disease, six plants (cantaloupe [n = 3], cucumber [n = 1] and watermelon [n = 2) exhibiting symptoms were sampled from four fields for preliminary screening. Total RNA was extracted from leaf tissues as described in Tamang et al. (2021) and samples tested by a multiplex reverse transcription RT-PCR method that targeted the RNA-dependent RNA polymerase (RdRp) of the whitefly transmitted viruses, CYSDV, CCYV, squash vein yellowing virus (SqVYV), and the aphid- transmitted cucurbit aphid-borne yellows virus (CABYV) (Mondal et al. 2023). RT-PCR amplified the expected 494-bp fragment of the CYSDV RdRp gene (Mondal et al., 2023) from two symptomatic plants; one cantaloupe, one cucumber, as well as from CYSDV-infected control plants but not from healthy controls. Further testing was conducted during the June-August 2020 growing season after similar symptoms were observed on additional farms in St. Elizabeth and two regions, Manchester and Clarendon, located to the east of St. Elizabeth. Twenty-one cucurbit leaf samples (11 cantaloupe, seven watermelon and two cucumber from St. Elizabeth and one cantaloupe from Clarendon) exhibiting foliar yellowing progressing from the crown outward, and mottling were collected. Whiteflies (5) from these fields in St. Elizabeth and 20 asymptomatic weed samples were also collected and sent to the USDA-ARS laboratory at Salinas, CA. Total RNA from leaf samples was extracted as described above and tested for CYSDV, CCYV, and CABYV. Total leaf DNA was also extracted (Mondal et al. 2016) and assayed with PCR (Gilbertson 2001) to detect the presence of the whitefly-transmitted cucurbit leaf crumple virus (CuLCrV), a begomovirus, commonly found in the southeastern United States (Gadhave et al., 2018; Keinath et al., 2018). Nineteen of the 21 cucurbit samples tested positive for the presence of CYSDV by RT-PCR (Mondal et al. 2023). Of the 19 CYSDV-positive samples, 13 cantaloupe, one cucumber, and five watermelon samples were singly infected with CYSDV, and one cantaloupe sample was infected with both CYSDV and CABYV. Amplicons of the Jamaica isolate from cantaloupe were sequenced (OR399555) and a 494 nt section of the RdRp gene was found to share 100% sequence identity to the Arizona 1 isolate (EF547827.1). The presence of CYSDV, was further confirmed using a second set of primers that amplified a 394-nt portion of the CYSDV coat protein gene (Polston et al., 2008). Among the weed samples, CABYV was detected in one sample from a Leonotis nepetifolia plant (Lamiaceae) and two Cleome sp. (Capparaceae) collected from St. Elizabeth. None of the crop and weed samples tested positive for CCYV or CuLCrV. DNA from whiteflies was extracted and assayed with PCR using species specific primers (Chen et al. 2016). All whiteflies were identified as B. tabaci cryptic species MEAM1, which is widely known an efficient vector of CYSDV (Berdiales, et al. 1999). This is the first report of CYSDV in Jamaica and its first known occurrence in these hosts within the country. Further monitoring of cucurbit crops and the whitefly vector is warranted to better understand the epidemiology.
ABSTRACT
BACKGROUND: We have recently identified a novel virus detected in alfalfa seed material. The virus was tentatively named alfalfa-associated potyvirus 1, as its genomic fragments bore similarities with potyvirids. In this study, we continued investigating this novel species, expanding information on its genomic features and biological characteristics. METHODS: This research used a wide range of methodology to achieve end results: high throughput sequencing, bioinformatics tools, reverse transcription-polymerase chain reactions, differential diagnostics using indicator plants, virus purification, transmission electron microscopy, and others. RESULTS: In this study, we obtained a complete genome sequence of the virus and classified it as a tentative species in the new genus, most closely related to the members of the genus Ipomovirus in the family Potyviridae. This assumption is based on the genome sequence and structure, phylogenetic relationships, and transmission electron microscopy investigations. We also demonstrated its mechanical transmission to the indicator plant Nicotiana benthamiana and to the natural host Medicago sativa, both of which developed characteristic symptoms therefore suggesting a pathogenic nature of the disease. CONCLUSIONS: Consistent with symptomatology, the virus was renamed to alfalfa vein mottling virus. A name Alvemovirus was proposed for the new genus in the family Potyviridae, of which alfalfa vein mottling virus is a tentative member.
Subject(s)
Potyviridae , Potyvirus , Medicago sativa , Genome, Viral , Phylogeny , Potyviridae/genetics , Potyvirus/geneticsABSTRACT
Plant viruses are an ever-present threat to agricultural production and provide a wide array of symptoms resulting in economic losses throughout the world. Diseases can be transmitted by insect vectors, as well as through pollen, seed, and other means. With the increased globalization of agriculture, the introduction of new viruses from exotic locations and their establishment in new production regions and even new crops is a growing concern. Advancing knowledge of the epidemiology of plant viruses including development of new diagnostic methods, virus surveillance, and modeling, virus ecology and evolution, virus interactions with insect vectors, and other factors are important toward reducing the spread of plant viruses and managing virus diseases.
Subject(s)
Plant Diseases , Plant Viruses , Crops, Agricultural , Climate , Climate ChangeABSTRACT
Viruses transmitted by the whitefly (Bemisia tabaci) are an increasing threat to cucurbit production in the southwestern United States and many other cucurbit production regions of the world. The crinivirus cucurbit yellow stunting disorder virus (CYSDV) has severely impacted melon production in California and Arizona since its 2006 introduction to the region. Within the past few years, another crinivirus, cucurbit chlorotic yellows virus (CCYV), and the whitefly-transmitted ipomovirus squash vein yellowing virus (SqVYV) were found infecting melon plants in California's Imperial Valley. CYSDV, CCYV, and an aphid-transmitted polerovirus, cucurbit aphid-borne yellows virus (CABYV), occur together in the region and produce identical yellowing symptoms on cucurbit plants. Mixed infections of these four viruses in the Sonoran Desert and other regions pose challenges for disease management and efforts to develop resistant varieties. A multiplex single-step RT-PCR method was developed that differentiates among these viruses, and this was used to determine the prevalence and distribution of the viruses in melon samples from fields in the Sonoran Desert melon production region of California and Arizona during the spring and fall melon seasons from 2019 through 2021. TaqMan probes were developed, optimized, and applied in a single-step multiplex RT-qPCR to quantify titers of these four viruses in plant samples, which frequently carry mixed infections. Results of the multiplex RT-PCR analysis demonstrated that CYSDV is the predominant virus during the fall, whereas CCYV was by far the most prevalent virus during the spring each year. Multiplex RT-qPCR was used to evaluate differential accumulation and spatiotemporal distribution of viruses within plants and suggested differences in competitive accumulation of CCYV and CYSDV within melon. This study provides the first official report of SqVYV in Arizona and offers an efficient method for virus detection and quantification for breeding and disease management in areas impacted by cucurbit yellowing viruses.
Subject(s)
Coinfection , Cucurbitaceae , Potyviridae , Viruses , Seasons , Arizona , Reverse Transcriptase Polymerase Chain Reaction , Prevalence , Plant Breeding , Crops, Agricultural , Potyviridae/genetics , CaliforniaABSTRACT
The United States potato industry has recently experienced a strain shift; recombinant potato virus Y (PVY) strains (e.g., PVYNTN) have emerged as the predominant strains over the long dominant ordinary strain (PVYO), yet both are often found as single infections within the same field and as mixed infections within individual plants. To understand mixed infection dynamics in potato plants and in daughter tubers, three potato varieties varying for PVY resistance, 'Red Maria', 'CalWhite', and 'Pike', were mechanically inoculated either at the pre- or postflowering stage with all possible heterologous isolate combinations of two PVYO and two PVYNTN isolates. Virus titer was determined from leaves collected at different positions on the plant at different times, and tuber-borne infection was determined for two successive generations. PVYNTN accumulated to higher levels than PVYO at nearly all sampling time points in 'Pike' potato. However, both virus strains accumulated to similar amounts in 'Red Maria' and 'CalWhite' potato early in the infection when inoculated preflowering; however, PVYNTN dominated at later stages and in plants inoculated postflowering. Regardless of inoculation time, both virus strains were transmitted to daughter plants raised from the tubers for most isolate combinations. The relative titer of PVYNTN and PVYO isolates at the later stages of mother plant development was indicative of what was found in the daughter plants. Although virus titer differed among cultivars depending on their genetics and virus isolates, it did not change the strain outcome in tuber-borne infection in subsequent generations. Differential virus accumulation in these cultivars suggests isolate-specific resistance to PVY accumulation.
Subject(s)
Potyvirus , Solanum tuberosum , United States , Potyvirus/genetics , Plant DiseasesABSTRACT
Impatiens necrotic spot virus (INSV; family Tospoviridae, genus Orthotospovirus) is a thrips-borne pathogen that infects a wide range of ornamental and vegetable crops. INSV was first reported in lettuce (Lactuca sativa) in the Salinas Valley of CA (Monterey County) in 2006 (Koike et al. 2008). Since then, the pathogen has continued to impact lettuce production in the region, causing severe economic losses with increasing incidence and severity in recent years. Tomato spotted wilt virus (TSWV), another tospovirus, also infects lettuce, but its occurrence is much less frequent than INSV (Kuo et al. 2014). While INSV has not been reported in the desert areas of CA and AZ, there are concerns that the virus could become established in this region. In early March 2021, symptoms resembling those caused by orthotospovirus infection were observed in several romaine and iceberg lettuce fields in the Yuma and Tacna regions of Yuma County, AZ. Symptoms included leaves that exhibited tan to dark brown necrotic spots, distorted leaf shapes, and stunted plant growth. Similar symptoms were also reported in romaine fields and one green leaf and iceberg lettuce field in the neighboring Imperial and Riverside Counties of CA. A total of 14 samples (5 from Tacna, 4 from Yuma, 4 from Imperial, 1 from Riverside) were tested using ImmunoStrips (Agdia, Elkhart, IN) for INSV and TSWV. Results confirmed the presence of INSV in 13 out of 14 samples, and the absence of INSV in one sample originating from Yuma. All 14 samples tested negative for TSWV. The 13 INSV positive samples were processed for RT-PCR validation. Total RNA was extracted from each sample using the RNeasy Plant Mini Kit (Qiagen, Valencia, CA). RT-PCR was performed with OneStep Ahead RT-PCR Kit (Qiagen) with primers to the N gene of INSV S RNA (Accession KF745140.1; INSV F = CCAAATACTACTTTAACCGCAAGT; INSV R = ACACCCAAGACACAGGATTT). All reactions generated a single amplicon at the correct size of 524 bp. One sample each from Yuma, Tacna, and Brawley (Imperial County), as well as a romaine lettuce sample collected from the Salinas Valley in March 2021, were sent for Sanger bi-directional sequencing (Eton Biosciences, San Diego, CA). Sequence analysis revealed that all three desert samples (Yuma, Tacna, and Brawley with Accessions OK340696, OK340697, OK340698, respectively) shared 100% sequence identity and 99.43% identity to the Salinas Valley 2021 sample (SV-L2, Accession OK340699). Additionally, all desert samples shared 99.24% sequence identity to the Salinas Valley lettuce isolate previously described in 2014 (SV-L1, Accession KF745140.1; Kuo et al. 2014), while the SV-L2 and SV-L1 sequences shared 99.43% identity. By the end of the season (April 2021) a total of 43 lettuce fields in Yuma County, AZ, and 9 fields in Imperial and Riverside Counties, CA were confirmed to have INSV infection using ImmunoStrips. Impacted fields included romaine, green leaf, red leaf, and head lettuce varieties, and both direct-seeded and transplanted lettuce, under conventional and organic management regimes. In AZ, INSV incidence in fields ranged between 0.2% and 33%, while in Imperial and Riverside Counties, CA, field incidence remained low at less than 0.1%. It is possible that INSV was introduced from the Salinas Valley of CA through the movement of infected lettuce transplants and/or thrips vectors. To our knowledge, this is the first report of INSV infecting lettuce in Arizona and the southern desert region of California.
ABSTRACT
In recent years, several recombinant strains of potato virus Y, notably PVYNTN and PVYN:O have displaced the ordinary strain, PVYO, and emerged as the predominant strains affecting the USA potato crop. Previously we reported that recombinant strains were transmitted more efficiently than PVYO when they were acquired sequentially, regardless of acquisition order. In another recent study, we showed that PVYNTN binds preferentially to the aphid stylet over PVYO when aphids feed on a mixture of PVYO and PVYNTN. To understand the mechanism of this transmission bias as well as preferential virus binding, we separated virus and active helper component proteins (HC), mixed them in homologous and heterologous combinations, and then fed them to aphids using Parafilm sachets. Mixtures of PVYO HC with either PVYN:O or PVYNTN resulted in efficient transmission. PVYN:O HC also facilitated the transmission of PVYO and PVYNTN, albeit with reduced efficiency. PVYNTN HC failed to facilitate transmission of either PVYO or PVYN:O. When PVYO HC or PVYN:O HC was mixed with equal amounts of the two viruses, both viruses in all combinations were transmitted at high efficiencies. In contrast, no transmission occurred when combinations of viruses were mixed with PVYNTN HC. Further study evaluated transmission using serial dilutions of purified virus mixed with HCs. While PVYNTN HC only facilitated the transmission of the homologous virus, the HCs of PVYO and PVYN:O facilitated the transmission of all strains tested. This phenomenon has likely contributed to the increase in the recombinant strains affecting the USA potato crop.
Subject(s)
Aphids/virology , Cysteine Endopeptidases/metabolism , Plant Diseases/virology , Potyvirus/genetics , Potyvirus/physiology , Solanum tuberosum/virology , Viral Proteins/metabolism , Amino Acid Motifs , Animals , Cysteine Endopeptidases/chemistry , Cysteine Endopeptidases/genetics , Recombination, Genetic , Nicotiana/virology , Viral Proteins/chemistry , Viral Proteins/geneticsABSTRACT
Tomato chlorosis virus (ToCV; genus Crinivirus, family Closteroviridae) was identified in tomato crops in São Paulo State, Brazil, in 2006. Management strategies to control external sources of inoculum are necessary, because chemical control of the whitefly vector Bemisia tabaci Middle East-Asia Minor 1 (MEAM1) has not efficiently prevented virus infections and no commercial tomato varieties or hybrids are resistant to this crinivirus. We first evaluated the natural infection rate of some known wild and cultivated ToCV-susceptible hosts and their attractiveness for B. tabaci MEAM1 oviposition. Physalis angulata was the most susceptible to natural infection in all six exposures in 2018 and 2019. No plants of Capsicum annuum 'Dahra' or Chenopodium album became infected. Solanum melongena 'Napoli' had only two infected plants of 60 exposed. Capsicum annuum and Chenopodium album were the least preferred, and Nicotiana tabacum and S. melongena were the most preferred for whitefly oviposition. In addition, from 2016 to 2019, we surveyed different tomato crops and the surrounding vegetation to identify ToCV in weeds and cultivated plants in the region of Sumaré, São Paulo State. Only S. americanum, vila vila (S. sisymbriifolium), and Chenopodium album were found naturally infected, with incidences of 18, 20, and 1.4%, respectively. Finally, we estimated the ToCV titer (U.S. and Brazilian isolates ToCV-FL and ToCV-SP, respectively) by quantitative reverse transcription PCR in different ToCV-susceptible host plants and evaluated the relationship between virus acquisition and transmission by B. tabaci MEAM1. The results clearly showed significant differences in ToCV concentrations in the tissues of ToCV-susceptible host plants, which appeared to be influenced by the virus isolate. The concentration of the virus in plant tissues, in turn, directly influenced the ToCV-B. tabaci MEAM1 relationship and subsequent transmission to tomato plants. To minimize or prevent damage from tomato yellowing disease through management of external sources of ToCV, it is necessary to correctly identify potentially important ToCV-susceptible hosts in the vicinity of new plantings.
Subject(s)
Crinivirus , Hemiptera , Solanum lycopersicum , Animals , Crinivirus/genetics , Plant DiseasesABSTRACT
Viruses transmitted by whiteflies (Bemisia tabaci) cause severe damage to cucurbits in the southern United States. In the fall of 2020, samples of squash plants (Cucurbita pepo) exhibiting symptoms of yellow mottle, interveinal yellowing, and leaf crumple were collected from an insecticide trial in Tifton, Georgia. Total nucleic acid was isolated using the MagMAX 96 Viral RNA Isolation Kit (ThermoFisher Scientific) following the manufacturer's instructions but without DNase treatment. Polymerase chain reaction (PCR) and reverse transcription (RT)-PCR were carried out to determine the presence of whitefly-transmitted viruses. We identified infection by cucurbit chlorotic yellows virus (CCYV) using primers targeting a 953 nt segment of CCYV RNA1 encoding the RNA dependent RNA polymerase gene (RdRp) (CCYV-RDRP-1515F-5'CTCCGAGTAGATCATCCCAAATC3' and CCYV-RDRP-1515R-5'TCACCAGAAACTCCACAATCTC 3') along with other whitefly-transmitted viruses previously reported in Georgia. CCYV was detected from 27 of the 28 samples tested, while cucurbit yellow stunting disorder virus (CYSDV; Polston et al., 2008) and cucurbit leaf crumple virus (CuLCrV; Gadhave et al., 2020) were detected from 23 and 28 squash samples, respectively, with all three viruses regularly occurring as mixed infections. The presence of CCYV was further confirmed by amplification of portions of two different genomic segments from RNA2, including a section of the heat-shock protein (HSP) homolog gene (Bananej et al. 2013) as well as a portion of the coat protein (CP) gene which was amplified using primers CCYV_CPF-5'TCCCGGTGCCAACT GAGACA3' and CCYV_CPR- 5' TACGCGCGGCAGAGGAATTT 3'. The respective 462 bp HSP and 375 bp CP amplicons were cloned and sequenced. The partial coat protein gene sequence (MW251342) was 97.86% identical to a CCYV isolate from Shanghai (KY400633). The partial HSP sequence (MW251341) shared 99.73% identity with the recently identified CCYV isolate from California (MH806868). Criniviruses are an emerging group of whitefly-transmitted viruses responsible for worldwide losses of billions of dollars annually (Tzanetakis et al., 2013). CCYV, a member of the genus Crinivirus, was believed to be restricted to Asia, Africa, and the Mediterranean regions of Europe (Bananej et al., 2013; Orfanidou et al., 2014) until it was recently identified in the Imperial Valley of California (Wintermantel et al., 2019). Southern Georgia has been experiencing high whitefly populations, resulting in the emergence of CuLCrV and CYSDV on vegetables in recent years. Because CCYV can produce symptoms virtually identical to those of CYSDV and occurs in mixed infections in cucurbits with other whitefly-transmitted viruses, its epidemiology, role in disease incidence, severity, and impact on economically important crops in the southeastern United States will require further investigation.
ABSTRACT
In California, the whitefly-transmitted yellowing viruses, cucurbit yellow stunting disorder virus (CYSDV) and cucurbit chlorotic yellows virus (CCYV), both genus Crinivirus, fam. Closteroviridae, have been limited to the Sonoran Desert production regions of Imperial and Riverside counties since their emergence in 2006 and 2014, respectively (Kuo et al., 2007; Wintermantel et al., 2009, 2019) where losses to these viruses have nearly eliminated fall melon production. CYSDV and CCYV have never been identified in the Central Valley, but the aphid-transmitted cucurbit aphid-borne yellows virus (CABYV; genus Polerovirus, fam. Luteoviridae) which produces symptoms nearly identical to those induced by CYSDV and CCYV (Lemaire et al. 1993) is common. As part of a larger study to monitor for whitefly-transmitted yellowing viruses in the southwestern United States, melon leaves exhibiting foliar mottling and interveinal chlorosis beginning near the crown and spreading outward along vines (e-Xtra 1), typical of symptoms caused by yellowing viruses, were collected from 106 melon plants in four commercial fields and a research plot in Fresno County, California, during October 2020. Whiteflies (B. tabaci) were present in all fields and confirmed as MEAM1 (biotype B) by PCR. Total RNA and DNA were extracted separately from the same leaf from each plant to determine the presence of RNA and DNA viruses. Total RNA was extracted as described in Tamang et al. (2021), and was used in RT-PCR with primer sets designed to amplify a 277 nt portion of the CABYV RNA dependent RNA polymerase (RdRp) gene (CABYV RdRp-F - 5' AAGAGCGGCAGCTACAATAC 3', CABYV RdRp-R - 5' TGCCACATTCCGGTTCATAG 3'), and portions of the CCYV and CYSDV RdRp genes encoded on RNA1 of the latter two viruses (Kavalappara et al., 2021). In addition, each CYSDV and CCYV infection was confirmed using a second set of primers that amplified 394 and 372 nt portions of the coat protein gene of each virus, respectively, encoded on RNA2 (Wintermantel et al., 2009; 2019). The 953 nt CCYV RdRp and 394 nt CYSDV CP amplicons were sequenced and found to share greater than 98% sequence identity to CCYV RNA1 (Accession No. MH477611.1) and CYSDV RNA2 (Accession No. LT992901.1), respectively. The CABYV infections were secondarily confirmed using a second set of primers designed to the CP gene (Kassem et al. 2007). Furthermore, four RNA samples from two separate fields that previously tested positive for CYSDV and CABYV and the only CCYV infection were confirmed using a recently developed multiplex RT-qPCR method (Mondal et al. 2021, submitted). Total DNA was extracted using methods described in Mondal et al. (2016) and was used in PCR to test for the presence of the whitefly-transmitted begomovirus, cucurbit leaf crumple virus (CuLCrV) which also occurs in the Sonoran Desert melon production region (Hagen et al, 2008), and is capable of inducing yellowing and leaf curl symptoms in melon. CABYV was by far the most prevalent virus, infecting 34/106 plants tested (32%) among the five fields. Four plants from three fields were infected singly with CYSDV (4%), and three more CYSDV infected plants from two fields were co-infected with CABYV (3%). Only one plant was found to be infected with CCYV as a single virus infection (1%). No triple infections nor any CuLCrV were detected in any of the plants sampled. This is the first report of CYSDV and CCYV in the Central Valley of California. In this survey, although CABYV was the predominant yellowing virus infecting melons in the Central Valley (32%), detection of CYSDV in fields distant from one another and the presence of CCYV even in a single field warrant more extensive monitoring of cucurbit crops and known alternate hosts of these viruses in the Central Valley.
ABSTRACT
In October 2018, cucumber plants showing yellowing and chlorotic mottle symptoms were observed in a greenhouse in Chungbuk, South Korea. The observed symptoms were similar to those caused by cucurbit aphid-borne yellows virus (CABYV), which has been detected on cucumber plants in the region since it was reported on melon in Korea in 2015 (Lee et al 2015). To identify the potential agents causing these symptoms, 28 samples from symptomatic leaves and fruit of cucumber plants were subjected to total RNA extraction using the Plant RNA Prep Kit (Biocubesystem, Korea). Reverse transcription polymerase chain (RT-PCR) was performed on total RNA using CABYV specific primers and protocols (Kwak et al. 2018). CABYV was detected in 17 of the 28 samples, while 11 symptomatic samples tested negative. In order to identify the cause of the symptoms, RT-PCR was performed using cucurbit chlorotic yellows virus (CCYV) and cucurbit yellow stunting disorder virus (CYSDV) specific primers (Wintermantel et al. 2019). Eight of the 28 samples were positive using the CCYV specific primers while seven samples were infected with only CCYV and one contained a mixed infection of CABYV with CCYV. None of the samples tested positive for CYSDV. The expected 373 nt amplicons of CCYV were bi-directionally sequenced, and BLASTn analysis showed that the nucleotide sequences shared 98 to 100% identity with CCYV isolates from East Asia, including NC0180174 from Japan. Two pairs of primers for amplification of the complete coat protein and RNA-dependent RNA polymerase (RdRp) genes (Wintermantel et al., 2019) were used to amplify the 753bp coat protein and 1517bp RdRp genes, respectively. Amplicons of the expected sizes were obtained from a CCYV single infection and ligated into the pGEM T- Easy vector (Promega, WI, USA). Three clones from each amplicon were sequenced and aligned using Geneious Prime and found to have identical sequences (Genbank accession nos. MW033300, MW033301). The CP and RdRp sequences demonstrated 99% nucleotide and 100% amino acid identity with the respective genes and proteins of the CCYV isolates from Japan. This study documents the first report of CCYV in Korea. Since CCYV was first detected on melon in Japan, it has been reported in many other countries including those in East Asia, the Middle East, Southern Europe, North Africa, and recently in North America. CCYV has the potential to become a serious threat to production of cucurbit crops in Korea, particularly due to the increasing prevalence of the whitefly, Bemisia tabaci, in greenhouse production systems. It will be important to continue monitoring for CCYV and determine potential alternate hosts in the region to manage and prevent further spread of CCYV in Korea.
ABSTRACT
BACKGROUND: Cucurbit yellow stunting disorder virus (CYSDV; genus Crinivirus, Closteroviridae) is transmitted in a semipersistent manner by the whitefly, Bemisia tabaci, and is efficiently transmitted by the widely prevalent B. tabaci cryptic species, MEAM1. In this study, we compared transcriptome profiles of B. tabaci MEAM1, after 24 h, 72 h and 7 days of acquisition feeding on melon plants infected with CYSDV (CYSDV-whiteflies) with those fed on virus-free melon, using RNA-Seq technology. We also compared transcriptome profiles with whiteflies fed on tomato plants separately infected with Tomato chlorosis virus (ToCV), a crinivirus closely related to CYSDV, and Tomato yellow leaf curl virus (TYLCV), a member of the genus Begomovirus, which has a distinctly different mode of transmission and their respective virus-free controls, to find common gene expression changes among viruliferous whiteflies feeding on different host plants infected with distinct (TYLCV) and related (CYSDV and ToCV) viruses. RESULTS: A total of 275 differentially expressed genes (DEGs) were identified in CYSDV-whiteflies, with 3 DEGs at 24 h, 221 DEGs at 72 h, and 51 DEGs at 7 days of virus acquisition. Changes in genes encoding orphan genes (54 genes), phosphatidylethanolamine-binding proteins (PEBP) (20 genes), and AAA-ATPase domain containing proteins (10 genes) were associated with the 72 h time point. Several more orphan genes (20 genes) were differentially expressed at 7 days. A total of 59 common DEGs were found between CYSDV-whiteflies and ToCV-whiteflies, which included 20 orphan genes and 6 lysosomal genes. A comparison of DEGs across the three different virus-host systems revealed 14 common DEGs, among which, eight showed similar and significant up-regulation in CYSDV-whiteflies at 72 h and TYLCV-whiteflies at 24 h, while down-regulation of the same genes was observed in ToCV-whiteflies at 72 h. CONCLUSIONS: Dynamic gene expression changes occurred in CYSDV-whiteflies after 72 h feeding, with decreased gene expression changes associated with 7 days of CYSDV acquisition. Similarities in gene expression changes among CYSDV-whiteflies, ToCV-whiteflies and TYLCV-whiteflies suggest the possible involvement of common genes or pathways for virus acquisition and transmission by whiteflies, even for viruses with distinctly different modes of transmission.
Subject(s)
Crinivirus/physiology , Cucurbitaceae/virology , Hemiptera/metabolism , Plant Diseases/virology , Animals , Begomovirus/physiology , Gene Expression Regulation , Hemiptera/genetics , Hemiptera/virology , Solanum lycopersicum/virology , RNA-Seq , Time Factors , TranscriptomeABSTRACT
The crinivirus Tomato chlorosis virus (ToCV) is often found infecting tomato crops in Brazil, with variable incidence, but associated with prevalence of its primary vector, Bemisia tabaci MEAM1. ToCV control is difficult because there are no resistant commercial tomato varieties or hybrids available and chemical spray for control of the whitefly vector has not been effective. The present study evaluated the partial host range of a Brazilian isolate of ToCV and the preference of B. tabaci MEAM1 for oviposition on those species identified as susceptible to the virus. Subsequently, transmission tests were performed using plants of each ToCV host species as sources of inoculum to elucidate the epidemiological importance of nontomato sources of inoculum for infection of tomato. Among 80 species experimentally inoculated, 25 were susceptible, including 6 previously not known to be hosts (Jaltomata procumbens, Physalis pruinosa, Solanum aculeatissimum, S. viarum, Beta vulgaris var. cicla, and Chenopodium quinoa). Preference of whitefly for oviposition and infection by ToCV under free-choice transmission tests varied among the susceptible species. When ToCV-infected tomato, eggplant, and C. quinoa were used separately as sources of inoculum for virus transmission to tomato plants, mean percentages of infected plants were 76.6, 3, and 0%, respectively. Average oviposition of Bemisia tabaci on these three hosts were 2.7, 10.6, and 0.0 eggs/cm2, respectively. Additional studies will be necessary to evaluate the importance of ToCV host plants under field conditions and their efficiency as sources of inoculum for virus acquisition and transmission to tomato crops.
Subject(s)
Crinivirus , Hemiptera , Host Specificity , Plants , Animals , Brazil , Crinivirus/physiology , Hemiptera/physiology , Plant Diseases/parasitology , Plant Diseases/virology , Plants/parasitology , Plants/virologyABSTRACT
Lettuce (Lactuca sativa L.) production in coastal California, one of the major lettuce-producing areas of the United States, is regularly affected by outbreaks of Impatiens necrotic spot virus (INSV), a member of the genus Orthotospovirus. Transmission of INSV among lettuce crops in this growing region has been attributed predominantly to the western flower thrips (Frankliniella occidentalis). INSV is acquired by first- or second-instar thrips nymphs feeding on infected host plants (not necessarily lettuce). The virus replicates within the insect vector, and is transmitted to new plants by adult thrips as they feed on epidermal and mesophyll cells of susceptible host plants. All currently grown cultivars of lettuce are susceptible to the disease. Screening lettuce for resistance to INSV under field conditions is problematic because natural infections appear sporadically and the virus is not evenly distributed across infected fields. We have developed a greenhouse-based assay that uses viruliferous thrips in combination with mechanical inoculation that allows dependable, year-round screening for resistance. In all, 89 cultivars, breeding lines, and plant introductions of cultivated lettuce, together with 53 accessions from 11 other Lactuca spp., 4 accessions from two dandelion (Taraxacum) species, and 4 tomato (Solanum lycopersicum L.) lines were evaluated for resistance to INSV. All tested material was susceptible to INSV to varying degrees, with the exception of two tomato lines that carry the Sw-5 gene that confers resistance to Tomato spotted wilt virus, a virus closely related to INSV. In cultivated lettuce, a partial resistance to INSV was observed in cultivars Amazona, Ancora, Antigua, Commodore, Eruption, Iceberg, La Brillante, Merlot, Telluride, and Tinto. Limited comparison of the greenhouse-based screening results with the data from opportunistic evaluations of resistance on 775 lettuce accessions from six field trials indicates consistency of results from both greenhouse and field environments. The most resistant lettuce accessions are being incorporated into our breeding program for introgression of resistance into lettuce breeding lines.
Subject(s)
Crop Production/methods , Disease Resistance , Lactuca/virology , Plant Diseases/virology , Tospovirus/physiology , Plant Breeding , Species SpecificityABSTRACT
BACKGROUND: Whiteflies threaten agricultural crop production worldwide, are polyphagous in nature, and transmit hundreds of plant viruses. Little is known how whitefly gene expression is altered due to feeding on plants infected with a semipersistently transmitted virus. Tomato chlorosis virus (ToCV; genus Crinivirus, family Closteroviridae) is transmitted by the whitefly (Bemisia tabaci) in a semipersistent manner and infects several globally important agricultural and ornamental crops, including tomato. RESULTS: To determine changes in global gene regulation in whiteflies after feeding on tomato plants infected with a crinivirus (ToCV), comparative transcriptomic analysis was performed using RNA-Seq on whitefly (Bemisia tabaci MEAM1) populations after 24, 48, and 72 h acquisition access periods on either ToCV-infected or uninfected tomatoes. Significant differences in gene expression were detected between whiteflies fed on ToCV-infected tomato and those fed on uninfected tomato among the three feeding time periods: 447 up-regulated and 542 down-regulated at 24 h, 4 up-regulated and 7 down-regulated at 48 h, and 50 up-regulated and 160 down-regulated at 72 h. Analysis revealed differential regulation of genes associated with metabolic pathways, signal transduction, transport and catabolism, receptors, glucose transporters, α-glucosidases, and the uric acid pathway in whiteflies fed on ToCV-infected tomatoes, as well as an abundance of differentially regulated novel orphan genes. Results demonstrate for the first time, a specific and temporally regulated response by the whitefly to feeding on a host plant infected with a semipersistently transmitted virus, and advance the understanding of the whitefly vector-virus interactions that facilitate virus transmission. CONCLUSION: Whitefly transmission of semipersistent viruses is believed to require specific interactions between the virus and its vector that allow binding of virus particles to factors within whitefly mouthparts. Results provide a broader understanding of the potential mechanism of crinivirus transmission by whitefly, aid in discerning genes or loci in whitefly that influence virus interactions or transmission, and subsequently facilitate development of novel, genetics-based control methods against whitefly and whitefly-transmitted viruses.
Subject(s)
Animal Feed/virology , Crinivirus/physiology , Gene Expression Profiling , Hemiptera/genetics , Solanum lycopersicum/virology , Animals , Genes, Insect/genetics , Time FactorsABSTRACT
BACKGROUND: The whitefly Bemisia tabaci (Hemiptera: Aleyrodidae) is among the 100 worst invasive species in the world. As one of the most important crop pests and virus vectors, B. tabaci causes substantial crop losses and poses a serious threat to global food security. RESULTS: We report the 615-Mb high-quality genome sequence of B. tabaci Middle East-Asia Minor 1 (MEAM1), the first genome sequence in the Aleyrodidae family, which contains 15,664 protein-coding genes. The B. tabaci genome is highly divergent from other sequenced hemipteran genomes, sharing no detectable synteny. A number of known detoxification gene families, including cytochrome P450s and UDP-glucuronosyltransferases, are significantly expanded in B. tabaci. Other expanded gene families, including cathepsins, large clusters of tandemly duplicated B. tabaci-specific genes, and phosphatidylethanolamine-binding proteins (PEBPs), were found to be associated with virus acquisition and transmission and/or insecticide resistance, likely contributing to the global invasiveness and efficient virus transmission capacity of B. tabaci. The presence of 142 horizontally transferred genes from bacteria or fungi in the B. tabaci genome, including genes encoding hopanoid/sterol synthesis and xenobiotic detoxification enzymes that are not present in other insects, offers novel insights into the unique biological adaptations of this insect such as polyphagy and insecticide resistance. Interestingly, two adjacent bacterial pantothenate biosynthesis genes, panB and panC, have been co-transferred into B. tabaci and fused into a single gene that has acquired introns during its evolution. CONCLUSIONS: The B. tabaci genome contains numerous genetic novelties, including expansions in gene families associated with insecticide resistance, detoxification and virus transmission, as well as numerous horizontally transferred genes from bacteria and fungi. We believe these novelties likely have shaped B. tabaci as a highly invasive polyphagous crop pest and efficient vector of plant viruses. The genome serves as a reference for resolving the B. tabaci cryptic species complex, understanding fundamental biological novelties, and providing valuable genetic information to assist the development of novel strategies for controlling whiteflies and the viruses they transmit.
Subject(s)
Genome, Insect/genetics , Hemiptera/genetics , Animals , Hemiptera/drug effects , Insect Proteins/genetics , Insect Proteins/metabolism , Insecticide Resistance/genetics , Insecticide Resistance/physiology , Plant Viruses/pathogenicityABSTRACT
Curly top of sugar beet is a serious, yield-limiting disease in semiarid production areas caused by Beet curly top virus (BCTV) and transmitted by the beet leafhopper. One of the primary means of control for BCTV in sugar beet is host resistance but effectiveness of resistance can vary among BCTV strains. Strain prevalence among BCTV populations was last investigated in Idaho and Oregon during a 2006-to-2007 collection but changes in disease severity suggested a need for reevaluation. Therefore, 406 leaf samples symptomatic for curly top were collected from sugar beet plants in commercial sugar beet fields in Idaho and Oregon from 2012 to 2015. DNA was isolated and BCTV strain composition was investigated based on polymerase chain reaction assays with strain-specific primers for the Severe (Svr) and California/Logan (CA/Logan) strains and primers that amplified a group of Worland (Wor)-like strains. The BCTV strain distribution averaged 2% Svr, 30% CA/Logan, and 87% Wor-like (16% had mixed infections), which differed from the previously published 2006-to-2007 collection (87% Svr, 7% CA/Logan, and 60% Wor-like; 59% mixed infections) based on a contingency test (P < 0.0001). Whole-genome sequencing (GenBank accessions KT276895 to KT276920 and KX867015 to KX867057) with overlapping primers found that the Wor-like strains included Wor, Colorado and a previously undescribed strain designated Kimberly1. Results confirm a shift from Svr being one of the dominant BCTV strains in commercial sugar beet fields in 2006 to 2007 to becoming undetectable at times during recent years.
Subject(s)
Beta vulgaris , Geminiviridae , Beta vulgaris/virology , California , Colorado , Geminiviridae/genetics , Genome, Viral/genetics , Idaho , Oregon , SugarsABSTRACT
The relationships between plant viruses and their vectors have evolved over the millennia, and yet, studies on viruses began <150 years ago and investigations into the virus and vector interactions even more recently. The advent of next generation sequencing, including rapid genome and transcriptome analysis, methods for evaluation of small RNAs, and the related disciplines of proteomics and metabolomics offer a significant shift in the ability to elucidate molecular mechanisms involved in virus infection and transmission by insect vectors. Genomic technologies offer an unprecedented opportunity to examine the response of insect vectors to the presence of ingested viruses through gene expression changes and altered biochemical pathways. This review focuses on the interactions between viruses and their whitefly or thrips vectors and on potential applications of genomics-driven control of the insect vectors. Recent studies have evaluated gene expression in vectors during feeding on plants infected with begomoviruses, criniviruses, and tospoviruses, which exhibit very different types of virus-vector interactions. These studies demonstrate the advantages of genomics and the potential complementary studies that rapidly advance our understanding of the biology of virus transmission by insect vectors and offer additional opportunities to design novel genetic strategies to manage insect vectors and the viruses they transmit.
Subject(s)
Genomics , Hemiptera/virology , Insect Vectors/virology , Plant Diseases/prevention & control , Plant Viruses/physiology , Thysanoptera/virology , Animals , High-Throughput Nucleotide Sequencing , Insect Control , Plant Diseases/virology , Plants/parasitology , Plants/virology , Sequence Analysis, DNAABSTRACT
Cucurbit yellow stunting disorder virus (CYSDV; genus Crinivirus, family Closteroviridae) was identified in the melon (Cucumis melo) production regions of the desert southwestern United States in fall 2006. It is now well established in the region, where it is transmitted efficiently by the sweet potato whitefly, Bemisia tabaci biotype B (MEAM1). In order to evaluate the spread and establishment of the virus, nearly all spring and fall cucurbit fields planted in the Imperial Valley of California from 2007 to 2009 were surveyed and representative plants were tested for CYSDV infection. Incidence of CYSDV in spring melon fields was initially low and limited to a small number of fields in 2007 but increased to 63% of fields by spring 2009. Virus incidence in fall melon fields was 100% in each year. These results suggested that the virus had become established in native vegetation, weeds, and other crop species, and represented an increasing threat to melon production in the southwestern United States. Therefore, a select set of weed and crop species which grow or are cultivated in the Imperial Valley were evaluated as CYSDV reservoir hosts. For each species, we determined the capacity of CYSDV to accumulate, the relationship between virus titer in these source plants and transmission by whiteflies, as well as subsequent accumulation in inoculated cucurbit plants. Among these hosts, there was considerable variation in virus accumulation and transmission rates. Cucurbit hosts had the highest CYSDV titers, were efficient sources for virus acquisition, and showed a positive correlation between titer in source plants and transmission. Noncucurbit hosts had significantly lower CYSDV titers and varied in their capacity to serve as sources for transmission. CYSDV titers in some noncucurbit source plants, specifically common bean (Phaseolus vulgaris) and shepherd's purse (Capsella bursa-pastoris), were not positively correlated with transmission, demonstrating that additional environmental, physical, or biochemical factors were involved. These results demonstrate that multiple factors influence the efficiency with which a host plant species will be a reservoir for vector transmission of virus to crops.