RESUMEN
AIM: To analyze the effectiveness of allogeneic hematopoietic stem cell transplantation (allo-HSCT) from a related HLA-identical donor in patients with multiple myeloma (MM). MATERIALS AND METHODS: From 2013 to 2018, the study included 8 patients (6 men, 2 women) aged from 27 to 55 years (median 39 years) with MM who underwent allo-HSCT from a related HLA-identical donor (7 patients after auto-HSCT, in 1 case without previous auto-transplantation). All patients required 2 or more lines of induction therapy, while the achieved antitumor effect was unstable. Before allo-HSCT, complete and very good partial remission was determined in isolated cases, in 4 patients the response was regarded as partial remission, stabilization in 1 observation, progression in 1 patient. All patients underwent reduced intensity conditioning (fludarabine 30 mg/m2 6 days + busulfan 4 mg/kg 2 days). Immunosuppressive therapy included the administration of antithymocyte globulin and post-transplant cyclophosphamide. RESULTS: Severe acute GVHD (grade 34) was observed in 3 (37.5%) cases, which resulted in death in 1 case. A stable antitumor response was achieved in 5 (62.5%) patients, complete remission lasts for 2986 months after allo-HSCT. Specific therapy for these patients is not carried out. The 7-year progression-free survival rate was 75%, the 7-year overall survival rate was 84%, with a median follow-up of 65 months. The transplant-related mortality was 12.5%. CONCLUSION: Allo-HSCT is considered as an alternative method of therapy for young patients with aggressive MM. Allo-HSCT in MM in some cases leads to long-term immunological control of the tumor.
Asunto(s)
Enfermedad Injerto contra Huésped , Trasplante de Células Madre Hematopoyéticas , Mieloma Múltiple , Femenino , Humanos , Masculino , Suero Antilinfocítico , Busulfano , Ciclofosfamida , Enfermedad Injerto contra Huésped/epidemiología , Enfermedad Injerto contra Huésped/etiología , Trasplante de Células Madre Hematopoyéticas/efectos adversos , Trasplante de Células Madre Hematopoyéticas/métodos , Mieloma Múltiple/diagnóstico , Mieloma Múltiple/terapia , Recurrencia Local de Neoplasia/etiología , Estudios Retrospectivos , Acondicionamiento Pretrasplante/métodos , Adulto , Persona de Mediana EdadRESUMEN
We have studied the excision efficiency of human apurinic/apyrimidinic endonuclease 1 (APE1) and tyrosyl-DNA phosphodiesterase 1 (TDP1) on matched or mismatched bases located at the 3' end of DNA primers. We have used model DNA duplexes, which mimic DNA structures that occur during either replication (DNA with a 3' recessed end) or repair (DNA with a single-strand break). Both APE1 and TDP1 are more efficient in removing ribose-modified dNMP residues from mismatched pairs rather than canonical pairs. Thus, both of these enzymes may act as proofreading factors during the repair synthesis catalyzed by DNA polymerases including DNA polymerase ß (Polß). The design of new DNA polymerase inhibitors, which act as DNA or RNA chain terminators, is one of the main strategies in the development of antiviral agents. The excision efficacy of APE1 and TDP1 has also been studied for 3'-modified DNA duplexes that contain ddNMP or phosphorylated morpholino nucleosides (MorB) commonly used as terminators in the DNA synthesis. We have also investigated the insertion of ddNTP and morpholino nucleotides catalyzed by Polß and human immunodeficiency virus reverse transcriptase. This experiment has pointed to MorCyt, cytosine-containing morpholino nucleoside, as a potential antiviral agent.
Asunto(s)
Reparación del ADN , ADN-(Sitio Apurínico o Apirimidínico) Liasa/química , ADN/química , Hidrolasas Diéster Fosfóricas/química , Carbohidratos/química , HumanosRESUMEN
AIM: To determine the prevalence of amp1q21 and its relationship to the clinical manifestations of multiple myeloma (MM). SUBJECTS AND METHODS: In December 2009 to March 2016, a total 134 patients aged 30 to 81 years (median 57 years) underwent a pretreatment FISH-study of bone marrow (BM) with centromeric and locus-specific DNA probes to identify amp1q21, t(11;14), t(4;14), t(14;16), t(14;20), t(6;14), trisomies of chromosomes 5, 9, 15, del13q14, del17p13/TP53, and t(8q24)/cMYC. Induction therapy with bortezomib-containing cycles was performed. Autologous stem cell transplantation was carried out in 48 patients. The median follow-up of patients was 19.3 months (3.2-77.4 months). Disease progression was diagnosed in 69 (51.5%) patients; 12 patients also underwent FISH study during disease progression. RESULTS: At the onset of MM, amp1q21 was detected in 53 (39.6%) patients. The overall 5-year survival rate in patients with amp1q21 was almost 2 times lower than that in those without amp1q21 (43.5 and 79.4%, respectively; p=0.07). The overall 5-year survival rate in patients with one extra copy of 1q21 (only 3 copies) was 67.3%, that in those with 2 or more extra copies of 1q21 (only 4-7 copies) was 20.9% (p=0.0016). Nine (75%) of the 12 patients examined during disease progression were found to have amp1q21: 2 cases were detected in the period of progression to have amp1q21 in its absence at disease onset; 7 cases had amp1q21 both at MM onset and progression; however, the number of copies of 1q21 was unchanged. CONCLUSION: Ðmp1q21 is one of the most common chromosomal abnormalities in patients with new-onset MM and may appear in the course of disease progression. The presence of аmp1q21 is an important prognostic factor and must have to be included in the diagnostic study both at disease onset and progression.
Asunto(s)
Bortezomib/uso terapéutico , Aberraciones Cromosómicas , Mieloma Múltiple , Antineoplásicos/uso terapéutico , Quinasas CDC2-CDC28/genética , Cromosomas Humanos Par 1/genética , Variaciones en el Número de Copia de ADN/fisiología , Femenino , Trasplante de Células Madre Hematopoyéticas/métodos , Trasplante de Células Madre Hematopoyéticas/estadística & datos numéricos , Humanos , Masculino , Persona de Mediana Edad , Mieloma Múltiple/diagnóstico , Mieloma Múltiple/genética , Mieloma Múltiple/mortalidad , Mieloma Múltiple/cirugía , Valor Predictivo de las Pruebas , Pronóstico , Inducción de Remisión/métodos , Estadística como Asunto , Tasa de Supervivencia , Resultado del TratamientoRESUMEN
Bullous dermatoses affecting oral mucosa are autoimmune diseases in the majority of cases. The most common diseases in this group are pemphigus vulgaris, bullous pemphigoid, lichen planus. In the early stages of bullous dermatoses, especially for isolated lesions of the oral mucosa, prompt diagnosis is not always possible requiring an interdisciplinary approach to the differential diagnosis.
RESUMEN
Uracyl and adenine containing oligocarboxamide mimetics of nucleic acids based on morpholine nucleosides (MorGly) are synthesized using peptide chemistry methods. Conditions for an analysis of homogeneity of protonated at physiological pH oligomers using a capillary electrophoresis are proposed. Studies of thermostability of complementary complexes formed by MorGly oligomers revealed that melting temperature dramatically depends on heterocyclic base composition (uracyl or adenine). Cooperative interactions realized at junctions in tandem complexes give more contribution to the thermostability in the case of complexes formed by modified oligomers than native oligodeoxyriboadenilates. Adenine containing MorGly oligomers form more stable complexes with poly(U) than native oligodeoxyriboadenilate of the same length. Complexes formed by modified oligomers with polyribonucleotides are more stable in compare with polydeoxyribonucleotide.
Asunto(s)
Morfolinos , Ácidos Nucleicos , Oligodesoxirribonucleótidos , Adenina/química , Morfolinos/síntesis química , Morfolinos/química , Morfolinos/aislamiento & purificación , Conformación de Ácido Nucleico , Ácidos Nucleicos/síntesis química , Ácidos Nucleicos/química , Oligodesoxirribonucleótidos/síntesis química , Oligodesoxirribonucleótidos/química , Oligodesoxirribonucleótidos/aislamiento & purificación , Uracilo/químicaRESUMEN
A simple and effective method for the synthesis of 2'-aminomethylmorpholino-4'-carboxymethyl nucleoside analogues and Boc-modified derivatives as synthons for peptide synthesis was developed.
Asunto(s)
Morfolinas/química , Nucleótidos/síntesis química , Oligonucleótidos/síntesis química , Estructura MolecularRESUMEN
Autoantibodies, immunoglobulins G (IgG) against the desmosomal proteins desmogleins 1 and 3, play a significant role in the pathogenesis of pemphigus vulgaris. The basic therapy for pemfigus includes systemic corticosteroids, but their use should be as brief as possible because of the severe side effects. In cases of corticosteroid- resistant pemfigus, adjuvant therapy, in particular extracorporeal methods, is used. The most effective and safest extracorporeal therapy is immunosorbtion. Immunosorbtion is based on the removal of pemphigus antibodies from the blood using an affinity sorbent during a therapeutic apheresis procedure. Existing immunosorbents are nonselective and increase the risk of infection. We designed an immunosorbent based on an agarose matrix, Affi-Gel 15, and human recombinant desmoglein 3, as a ligand, for a selective removal of autoantibodies from pemphigus patients' sera. It was shown on a pemphigus experimental model in vivo (neonatal Balb/c mouse model) and in vitro that the immunosorbent can effectively remove desmoglein 3-associated autoantibodies. The experimental results demonstrate that the solid-phase matrix immunosorbent Affi-Gel 15-Dsg3 is a promising product for the development of pemphigus therapy.
RESUMEN
The aim of the present work was to perform a combined analysis of the degree of activation of the anterior hypothalamus of the rat and expression of the interleukin-2 gene during treatments of different types: mild stress ("handling") and adaption to it, as well as intranasal administration of physiological saline and the peptides Vilon (Lys-Glu) and Epitalon (Ala-Glu-Asp-Gly). Changes in the numbers of c-Fos-and IL-2-positive cells in structures of the lateral area (LHA) and anterior (AHN), supraoptic (SON), and paraventricular (PVN) nuclei of the hypothalamus in Wistar rats. Ratios of the quantities of c-Fos-and IL-2-positive cells were determined in intact animals and after activation of brain cells initiated by different treatments; the influences of adaptation to handling on the nature of changes in the expression of these proteins was also studied. Combined analysis of the intensity of expression of these two proteins - c-Fos, a marker of neuron activation and a trans-factor for the IL-2 cytokine gene and other inducible genes, and IL-2 - in intact animals and after various treatments showed that the process of cell activation in most of the hypothalamic structures studied correlated with decreases in the quantity of IL-2-positive cells in these structures; different patterns of changes in the numbers of c-Fos-and IL-2-positive cells were seen in response to different treatments in conditions of stress and adaptation to it.
Asunto(s)
Adaptación Fisiológica , Hipotálamo/metabolismo , Interleucina-2/metabolismo , Proteínas Proto-Oncogénicas c-fos/metabolismo , Estrés Psicológico/metabolismo , Animales , Dipéptidos/farmacología , Hipotálamo/efectos de los fármacos , Inmunohistoquímica , Interleucina-2/genética , Masculino , Oligopéptidos/farmacología , Proteínas Proto-Oncogénicas c-fos/genética , Ratas , Ratas Wistar , Distribución TisularRESUMEN
By using their own qualitative and quantitative algorithm of a study of free and induced crystallogenesis, the authors studied intraocular fluid specimens from 68 patients with cataract of varying maturity, including that induced by glaucoma. This criterion was shown to determine the nature of a biomaterial's free crystallization and its initiation potential for the test basic substances.
Asunto(s)
Humor Acuoso/fisiología , Catarata/diagnóstico , Anciano , Algoritmos , Humor Acuoso/química , Cristalización , Cristalografía , Diagnóstico Diferencial , Humanos , Persona de Mediana EdadRESUMEN
Orexins are neuromediators that participate in the regulation of feeding behavior, energy metabolism, circadian rhythms and perception of pain. The aim of the present study was to clarify the responses of the hypothalamic orexin-containing neurons to an intraperitoneal injection of cyclophosphamide (CPA), extremely high frequency (EHF)-electromagnetic stimulation of skin, which is used to modulate side effects of cytostatics and their combination. The activation of orexin-containing neurons was determined by recording of the intensity of c-Fos protein expression. Injection of cyclophosphamide (40mg/kg) or EHF-irradiation of the skin decreased the staining of orexin-containing neurons, which was most pronounced in the subfornical region of the lateral hypothalamic area (LHAs). A redistribution of orexin from the perinuclear space to the processes of these cells took place, which occurs after the activation and the expression of the c-fos-gene. c-Fos protein was expressed in most neurons with minimum content of orexin, i.e. activation of these neurons correlated with the redistribution of orexins caused by skin EHF-irradiation and injection of cyclophosphamide (CPA). EHF-irradiation of the skin before and after injection of CPA increased the staining of orexin-containing neurons, i.e. it prevented the redistribution of orexin.
RESUMEN
Reaction of 4-(N-2-chloroethyl-N-methylamino)benzylphosphamides of oligonucleotides (RCl-(pT)16 and RCl-(pApC)6) with human chromatin in intact nuclei and with metaphase chromosomes has been investigated. The oligonucleotides were targeted to poly(A) and poly(TG)-repeating DNA sequences. It was found that the reagents alkylate DNA and some proteins due to specific complex formation. The affinity character of the reaction was proved by the fact that free corresponding oligonucleotides taken in excess or preliminary treatment of chromatin with S1-nuclease both prevent the biopolymers from modification. The results obtained evidence that in human chromatin there are open DNA sequences available for affinity modification with oligonucleotide derivatives. Analysis of patterns of modified proteins within these chromatin areas may give a key to the structure of these chromatin sites.
Asunto(s)
Cromatina/efectos de los fármacos , Oligonucleótidos/farmacología , Derivados del Benceno/farmacología , Cromatografía de Afinidad , Células HeLa , Humanos , Recién Nacido , Compuestos Organofosforados/farmacologíaRESUMEN
The alkylating derivatives of four individual diastereomers of the oligonucleotide [dTp(Et)]3dTpU and two individual diastereomers of oligonucleotide [dTp(Et)dTp]4 have been synthesized. The reagents with the phosphorus atoms in the enantiomeric p" configuration are shown to be more efficient in reacting with poly(dA) and with nucleic acids in Krebs-2 ascites carcinoma cells compared to those with the phosphorus atoms in the p' configuration.
Asunto(s)
ADN/metabolismo , Oligodesoxirribonucleótidos/metabolismo , Organofosfatos/metabolismo , Compuestos Organofosforados/metabolismo , ARN/metabolismo , Alquilación , Animales , Fenómenos Químicos , Química , Cinética , Ratones , Células Tumorales CultivadasRESUMEN
Oligonucleotide derivatives bearing hemin and deuterohemin groups were synthesized. The derivatives efficiently react with the complementary nucleotide sequence in ssDNA forming covalent adducts and piperidine-labile sites. In the case of the deuterohemin derivative, some direct cleavage of the target DNA occurs.
Asunto(s)
Daño del ADN , ADN de Cadena Simple , Hemo , Hemina , Oligodesoxirribonucleótidos , Secuencia de Bases , Fenómenos Químicos , Química , Cromatografía Líquida de Alta Presión , Hemo/análogos & derivados , Datos de Secuencia Molecular , PiperidinasRESUMEN
The synthesis of new metallophthalocyanine-oligonucleotide conjugates is reported. These conjugates can cause sequence-specific photosensitized or catalytic oxidation of DNA by molecular oxygen.
Asunto(s)
ADN/química , Indoles/química , Oligonucleótidos/química , Compuestos Organometálicos/química , Fármacos Sensibilizantes a Radiaciones/química , Catálisis , Indoles/síntesis química , Isoindoles , Oligonucleótidos/síntesis química , Compuestos Organometálicos/síntesis química , Oxidación-Reducción , Fotoquímica , Fármacos Sensibilizantes a Radiaciones/síntesis químicaRESUMEN
The alkylation of the cell biopolymers (RNA, DNA, proteins) by reagents Tp'(Et)Tp'(Et)Tp'(Et)TpU(CHRCl) (1) Tp'(Et)Tp''(Et)Tp'(Et)TpU(CHRCl) (2) Tp''(Et)Tp'(Et)Tp''(Et)TpU(CHRCl) (3) Tp''(Et)Tp''(Et)Tp''(Et)TpU(CHRCl) (4) Tp(Et)Tp(Et)Tp(Et)TpU(CHRCl) (5) Tp(Et)Tp(Et)Tp(Et)Tp(Et)U(CHRCl) (6) TpTpTpTpU(CHRCl) (7) where (CHRCl) is the residue of 2',3'-O-[4-N-(2-chloroethyl)-N-methylamino]-benzylidene has been investigated in the case of the ascite carcinoma Krebs-2. p' and p" designate the enantiomeric configurations at the internucleotide phosphorus atoms of the triester fragment--Tp(Et)T--, and p designates the racemic mixture. Completely and partly ethylated reagents (1)-(6) have been found to bind to the cells 4-15 fold more effectively than the diester derivative. The concentration of reagents (1)-(6) in the cells is 2-7 fold higher than in the external medium. Among the diastereomers (1)-(4) reagent (4) with the p"-configuration is the most efficient in binding with the cells 2-3 fold more efficient than reagents (1)-(3). The main targents of modifications performed in the cells by means of reagents (1)-(7) have been established. These are RNA, DNA and proteins. The share of the reagents which react with nucleic acids increases from 45% [reagent (1)] to 80% [reagent (4)], and that reacting with proteins decreases from 50 to 20% correspondingly. Reagent (4) with the p" configurations at phosphotriester fragments alkylates nucleic acids most effectively among the phosphotriester diastereomers (1)-(4): 11-fold more efficient than reagent (1) with configuration p'. The extent of modification of poly(A)+-tracts of m-RNA by reagent (4) in comparison with reagent (1) is 50-fold higher.
Asunto(s)
Carcinoma Krebs 2/metabolismo , ADN de Neoplasias/metabolismo , Compuestos de Mostaza/toxicidad , Gas Mostaza/toxicidad , Proteínas de Neoplasias/metabolismo , Oligonucleótidos/toxicidad , Organofosfatos/toxicidad , Compuestos Organofosforados/toxicidad , ARN Neoplásico/metabolismo , Alquilación , Animales , Fenómenos Químicos , Química , ADN de Neoplasias/efectos de los fármacos , Ratones , Ratones Endogámicos C57BL , Conformación Molecular , ARN Neoplásico/efectos de los fármacos , Estereoisomerismo , Células Tumorales Cultivadas/efectos de los fármacos , Células Tumorales Cultivadas/metabolismoRESUMEN
Inhibition of the influenza virus protein NP mRNA with derivatives of an antisense oligonucleotide complementary to the 5' terminus of the mRNA was investigated. The derivatives were prepared by conjugation of aromatic 2-chloroethylamine, cholesterol, porphyrin, and phenazine groups to the 5'-terminal phosphate of the oligonucleotide. The most efficient inhibitors were found to be the conjugates bearing the alkylating, cholesterol and phenaznium groups.
Asunto(s)
Nucleoproteínas , Oligonucleótidos Antisentido/farmacología , Orthomyxoviridae/metabolismo , Biosíntesis de Proteínas/efectos de los fármacos , ARN Mensajero/genética , Proteínas del Núcleo Viral/genética , Secuencia de Bases , Colesterol/metabolismo , Etilaminas/metabolismo , Datos de Secuencia Molecular , Proteínas de la Nucleocápside , Fenazinas/metabolismo , Porfirinas/metabolismoRESUMEN
The effect of modification of terminal groups of deoxyribooligonucleotides on their stability in cell culture and inside mammalian cells, namely Krebs 2, ascite carcinoma (KAC) and mouse fibroblasts L929, has been investigated. Oligonucleotides and their derivatives were found to be stable in culture medium without serum during 24 h. In the medium with KAC cells or ascitic fluid, orthophosphate was rapidly eliminated from the 5'-terminus of the oligonucleotides. In KAC cells, the scission of 5'-phosphomonoester bonds was accompanied by reutilization of the phosphate and by degradation of oligonucleotides to mononucleotides. In the medium with fibroblasts L929, the oligonucleotides were degraded from the 3'-end to tetranucleotides. Modification of oligonucleotides at the 5'-terminus by amidation made the 5'-phosphate groups resistant to KAC. Modification of the oligonucleotides by coupling of cholesterol or phenazinium to the 3'-terminus sufficiently increases their stability in the medium with fibroblasts L929, in that with Krebs 2 ascite carcinoma cells and inside the cells.
Asunto(s)
Oligonucleótidos/química , Animales , Autorradiografía , Carcinoma de Ehrlich/química , Células Cultivadas , Electroforesis en Gel de Poliacrilamida , Fibroblastos/química , Cinética , Ratones , Conformación de Ácido NucleicoRESUMEN
Inhibitory effects on human immunodeficiency virus (HIV) reproduction on lymphoid cell line MT-4 were characterized for antisense and sense oligodeoxynucleotides. It was established that antisense oligonucleotide pCGTAGTTCGTCGAGGTCCGT (MP-20) (ID50 = 0.1 microM) is a more effective HIV inhibitor than the previously described pTGGCGTACTCACCAGTCGCCGC (DSS-22) (ID50 = 4.7 microM) and pTTTTTTTTTTTTTTTT (PA-16) (ID50 = 8.0 microM). A sense oligonucleotide pGCATCAAGCAGCTCCAGGCA (PM-20) (ID50 = 0.5 microM) complementary to the region of the start of translation of the open reading frame on the (+)-chain virus DNA was also investigated. Specificity of the anti-HIV-I action of oligonucleotides was confirmed by experiments with HIV-II.
Asunto(s)
VIH-1/efectos de los fármacos , VIH-2/efectos de los fármacos , Oligodesoxirribonucleótidos/farmacología , Oligonucleótidos Antisentido/farmacología , Replicación Viral/efectos de los fármacos , Secuencia de Bases , Línea Celular , ADN Viral/genética , VIH-1/fisiología , VIH-2/fisiología , Datos de Secuencia Molecular , Biosíntesis de ProteínasRESUMEN
Dinucleoside phosphates that harbor phosphate groups transiently blocked (caged) by o-nitrobenzyl or o-nitroveratryl residues were synthesized. It was shown that the conditions of the UV-induced deprotection largely depend on the nature of the protective group. The phosphotriesters obtained were resistant toward snake venom phosphodiesterase and nucleases of the cellular extract. The synthesis of the dinucleoside phosphates containing a photolabile group preceded the incorporation of the modified blocks into extended oligonucleotides by the phosphoramidite method.
Asunto(s)
Fosfatos de Dinucleósidos/química , Fosfatos de Dinucleósidos/síntesis química , Oligonucleótidos/química , Oligonucleótidos/síntesis química , Etiquetas de Fotoafinidad , Rayos UltravioletaRESUMEN
A convenient preparative synthesis of 2'-amino-2'-deoxyuridine was developed. Starting from 2'-amino-2'-deoxyuridine and 2'-amino-2'-deoxycytidine, monomers for the phosphoamidite oligonucleotide synthesis were obtained that carry a linker with methoxyoxalamide groups in position 2'. The English version of the paper: Russian Journal of Bioorganic Chemistry, 2004, vol. 30, no. 3; see also http://www.maik.ru.