First report of Fusarium graminearum causing Fusarium Head Blight (FHB) of wheat and barley in Lower Mainland of British Columbia, Canada.

Fusarium head blight (FHB), predominantly caused by Fusarium graminearum is one of the most economically important fungal diseases of small-grain cereals. Since the early 1990s, FHB has been a devastating wheat disease in parts of Canada and the United States, causing significant economic impacts on the cereal grain industry through reduced seed quality and yield, and grain contamination with fungal toxins (Brar et al. 2019). Spikes of wheat and barley with bleached spikelets and pinkish coloration were observed with low incidence and high severity in August 2021 field stripe rust nursery at UBC Totem Plant Science Farm in Vancouver, Canada (Supplementary File 1). FHB-like Symptomatic spikes were collected during the growing season. The Fusarium damaged kernels (FDK) were surface-sterilized with 1% sodium hypochlorite (NaOCl) for 1.5 min, rinsed three times in distilled water and dried using sterile filter paper discs in Biological Safety Cabinet. The kernels were placed on Petri dishes containing three layers of moist blotter papers and incubated in the dark at 22-25°C for 24 hours. The Petri dishes were transferred into a -20°C freezer for 24 hours, followed by five days of incubation at 22-25°C under fluorescent light, during which distilled water was added onto blotter papers every day to maintain moisture. After incubation, mycelium growing on kernels was transferred to potato dextrose agar (PDA) media and subcultured based on the colony and conidial morphology of F. graminearum (Leslie and Summerell 2006). The colonies selected grew white mycelia with a pink pigment at the bottom. Macroconidia with five to six septate were produced after seven days and microconidia were absent. Seven isolates derived from different wheat samples were derived from single conidia and identified based on amplicon sequencing using a MinION Flongle flow cell described by Boutigny et al. (2019). Reads which passed the integrated MinKNOW quality control step were mapped to the Partial translation elongation factor 1- α (EF1a) gene, using primers EF1-F2 (5'TCATC GGCCACGTCGACTCT3') and EF1-R3 (5'TACCAGCCTCGAACTCACCA3'). The consensus sequence for each sample was aligned to the reference sequence (JF740867.1) using BLASTn, revealing all the similarities of more than 99.5% (Supplementary File 2). The morphological characteristics (colony, pink pigment, shape of macroconidia, absence of microconidia) (Leslie and Summerell, 2006) and sequencing results indicated that the seven isolates from wheat were F. graminearum of the 3ADON chemotype. Besides, Koch's postulates were performed by spray-inoculating healthy inflorescences of eight wheat plants derived from the cross Avocet/CDC Silex at half anthesis stage (one isolate per plant and one non-inoculated control). Each spike was thoroughly sprayed with 1ml of spore suspension containing 5 × 104 conidia per ml (4-5 spikes per plant). The spikes on one plant were treated with distilled water (1 ml per spike) as a blank control. The inoculated spikes were covered with moist plastic bags for 48 hours, and the plants were placed in a growth chamber under a 12-h photoperiod at 18°C. Seven days later, spikes of the spores-treated plants exhibited bleached spikelets, which is a typical symptom of FHB, and there was no disease on the control plant. F. graminearum was re-isolated from FDK of diseased spikes using the isolation methodology and identified by morphology described above. To our knowledge and based on a literature review, this is the first report of F. graminearum causing FHB on wheat and barley in the Lower Mainland of British Columbia. The reason for the concealment of F. graminearum in BC might be the small acreage of commercially grown small-grain cereals. Further, there is limited cultivation of winter wheat and barley in the region for forage/silage, but the crops are harvested at the soft dough stage leaving limited grain/spike residue for the next crop. While presently there is very low acreage of cereal host crops of F. gramineraum in Lower Mainland, this acreage might increase in future years as winter cereals are slowly expanding in the region as cover crops, forages, and even grain production for sale to forgae producers or for local breweries in case of barley; therefore, finding of F. gramineraum could have economic consequences on cereal production in the region in future. Further investigation is needed to better understand the aggressiveness of the strains and their population structure of the pathogen in the Region.

A KNIME Workflow to Assist the Analogue Identification for Read-Across, Applied to Aromatase Activity.

The reduction and replacement of in vivo tests have become crucial in terms of resources and animal benefits. The read-across approach reduces the number of substances to be tested, exploiting existing experimental data to predict the properties of untested substances. Currently, several tools have been developed to perform read-across, but other approaches, such as computational workflows, can offer a more flexible and less prescriptive approach. In this paper, we are introducing a workflow to support analogue identification for read-across. The implementation of the workflow was performed using a database of azole chemicals with in vitro toxicity data for human aromatase enzymes. The workflow identified analogues based on three similarities: structural similarity (StrS), metabolic similarity (MtS), and mechanistic similarity (McS). Our results showed how multiple similarity metrics can be combined within a read-across assessment. The use of the similarity based on metabolism and toxicological mechanism improved the predictions in particular for sensitivity. Beyond the results predicting a large population of substances, practical examples illustrate the advantages of the proposed approach.

Position statement: nonoperative management of lateral epicondylitis in adults.

We sought to compare methods of nonsurgical treatment of lateral epicondylitis in men and women older than 18 years to develop a guideline intended for orthopedic surgeons and other health care providers who assess, counsel and care for these patients. We searched Medline, Embase and Cochrane through to Mar. 9, 2021, and included all English-language studies comparing nonsurgical approaches. We compared physiotherapy versus no active treatment, corticosteroids versus placebo, platelet-rich plasma (PRP) versus placebo, and autologous blood injection versus placebo. Outcomes of interest were pain outcomes (visual analogue scale scores) and functional outcomes. We rated the quality of the evidence and strength of recommendations using the Grading of Recommendations Assessment, Development, and Evaluation (GRADE) approach. This guideline will benefit patients seeking nonsurgical intervention for lateral epicondylitis by improving counselling on nonsurgical treatment options and possible outcomes. It will also benefit surgical providers by improving their knowledge of various nonsurgical approaches. Data presented could be used to develop frameworks and tools for shared decision-making.

11C-Methionine PET/CT in Assessment of Multiple Myeloma Patients: Comparison to 18F-FDG PET/CT and Prognostic Value.

Multiple myeloma (MM) is the second most common haematological malignancy and remains incurable despite therapeutic advances. 18F-FDG (FDG) PET/CT is a relevant tool MM for staging and it is the reference imaging technique for treatment evaluation. However, it has limitations, and investigation of other PET tracers is required. Preliminary results with L-methyl-[11C]- methionine (MET), suggest higher sensitivity than 18F-FDG. This study aimed to compare the diagnostic accuracy and prognostic value of 1FDG and MET in MM patients. We prospectively compared FDG and MET PET/CT for assessment of bone disease and extramedullary disease (EMD) in a series of 52 consecutive patients (8 smoldering MM, 18 newly diagnosed MM and 26 relapsed MM patients). Bone marrow (BM) uptake patterns and the detection of focal lesions (FLs) and EMD were compared. Furthermore, FDG PET parameters with known MM prognostic value were explored for both tracers, as well as total lesion MET uptake (TLMU). Median patient age was 61 years (range, 37-83 years), 54% were male, 13% of them were in stage ISS (International Staging System) III, and 31% had high-risk cytogenetics. FDG PET/CT did not detect active disease in 6 patients, while they were shown to be positive by MET PET/CT. Additionally, MET PET/CT identified a higher number of FLs than FDG in more than half of the patients (63%). For prognostication we focussed on the relapsed cohort, due to the low number of progressions in the two other cohorts. Upon using FDG PET/CT in relapsed patients, the presence of more than 3 FLs (HR 4.61, p = 0.056), more than 10 FLs (HR 5.65, p = 0.013), total metabolic tumor volume (TMTV) p50 (HR 4.91, p = 0.049) or TMTV p75 (HR 5.32, p = 0.016) were associated with adverse prognosis. In MET PET/CT analysis, TMTV p50 (HR 4.71, p = 0.056), TMTV p75 (HR 6.27, p = 0.007), TLMU p50 (HR 8.8, p = 0.04) and TLMU p75 (HR 6.3, p = 0.007) adversely affected PFS. This study confirmed the diagnostic and prognostic value of FDG in MM. In addition, it highlights that MET has higher sensitivity than FDG PET/CT for detection of myeloma lesions, including FLs. Moreover, we show, for the first time, the prognostic value of TMTV and TLMU MET PET/CT in the imaging evaluation of MM patients.

Local Fractal Connections to Characterize the Spatial Processes of Deforestation in the Ecuadorian Amazon.

Deforestation by human activities is a common issue in Amazonian countries. This occurs at different spatial and temporal scales causing primary forest loss and land fragmentation issues. During the deforestation process as the forest loses connectivity, the deforested patches create new intricate connections, which in turn create complex networks. In this study, we analyzed the local connected fractal dimension (LCFD) of the deforestation process in the Sumaco Biosphere Reserve (SBR) with two segmentation methods, -CA-wavelet and K-means-to categorize the complexity of deforested patches' connections and then relate these with the spatial processes. The results showed an agreement with both methods, in which LCFD values below 1 corresponded to isolated patches with simple shapes and those above 1 signified more complex and connected patches. From CA-wavelet a threshold of 1.57 was detected allowing us to identify and discern low and high land transformation, while the threshold for K-means was 1.61. Both values represent the region from which deforestation performs local aggressive expansion networks. The thresholds were used to map the LCFD in which all spatial processes were visually detected. However, the threshold of 1.6 ± 0.03 was more effective in discerning high land transformation. such as shrinkage and attrition, in the deforestation process in the SBR.

Homology Modeling of the Human P-glycoprotein (ABCB1) and Insights into Ligand Binding through Molecular Docking Studies.

The ABCB1 transporter also known as P-glycoprotein (P-gp) is a transmembrane protein belonging to the ATP binding cassette super-family of transporters; it is a xenobiotic efflux pump that limits intracellular drug accumulation by pumping the compounds out of cells. P-gp contributes to a decrease of toxicity and possesses broad substrate specificity. It is involved in the failure of numerous anticancer and antiviral chemotherapies due to the multidrug resistance (MDR) phenomenon, where it removes the chemotherapeutics out of the targeted cells. Understanding the details of the ligand-P-gp interaction is therefore crucial for the development of drugs that might overcome the MRD phenomenon and for obtaining a more effective prediction of the toxicity of certain compounds. In this work, an in silico modeling was performed using homology modeling and molecular docking methods with the aim of better understanding the ligand-P-gp interactions. Based on different mouse P-gp structural templates from the PDB repository, a 3D model of the human P-gp (hP-gp) was constructed by means of protein homology modeling. The homology model was then used to perform molecular docking calculations on a set of thirteen compounds, including some well-known compounds that interact with P-gp as substrates, inhibitors, or both. The sum of ranking differences (SRD) was employed for the comparison of the different scoring functions used in the docking calculations. A consensus-ranking scheme was employed for the selection of the top-ranked pose for each docked ligand. The docking results showed that a high number of π interactions, mainly π-sigma, π-alkyl, and π-π type of interactions, together with the simultaneous presence of hydrogen bond interactions contribute to the stability of the ligand-protein complex in the binding site. It was also observed that some interacting residues in hP-gp are the same when compared to those observed in a co-crystallized ligand (PBDE-100) with mouse P-gp (PDB ID: 4XWK). Our in silico approach is consistent with available experimental results regarding P-gp efflux transport assay; therefore it could be useful in the prediction of the role of new compounds in systemic toxicity.

Towards an Understanding of the Mode of Action of Human Aromatase Activity for Azoles through Quantum Chemical Descriptors-Based Regression and Structure Activity Relationship Modeling Analysis.

Aromatase is an enzyme member of the cytochrome P450 superfamily coded by the CYP19A1 gene. Its main action is the conversion of androgens into estrogens, transforming androstenedione into estrone and testosterone into estradiol. This enzyme is present in several tissues and it has a key role in the maintenance of the balance of androgens and estrogens, and therefore in the regulation of the endocrine system. With regard to chemical safety and human health, azoles, which are used as agrochemicals and pharmaceuticals, are potential endocrine disruptors due to their agonist or antagonist interactions with the human aromatase enzyme. This theoretical study investigated the active agonist and antagonist properties of "chemical classes of azoles" to determine the relationships of azole interaction with CYP19A1, using stereochemical and electronic properties of the molecules through classification and multilinear regression (MLR) modeling. The antagonist activities for the same substituent on diazoles and triazoles vary with its chemical composition and its position and both heterocyclic systems require aromatic substituents. The triazoles require the spherical shape and diazoles have to be in proper proportion of the branching index and the number of ring systems for the inhibition. Considering the electronic aspects, triazole antagonist activity depends on the electrophilicity index that originates from interelectronic exchange interaction (ωHF) and the LUMO energy ( E LUMO PM 7 ), and the diazole antagonist activity originates from the penultimate orbital ( E HOMONL PM 7 ) of diazoles. The regression models for agonist activity show that it is opposed by the static charges but favored by the delocalized charges on the diazoles and thiazoles. This study proposes that the electron penetration of azoles toward heme group decides the binding behavior and stereochemistry requirement for antagonist activity against CYP19A1 enzyme.

Phase 1 dose escalation multicenter trial of pracinostat alone and in combination with azacitidine in patients with advanced hematologic malignancies.

BACKGROUND: Pracinostat is a potent histone deacetylase inhibitor with antitumor activity in both solid tumor and acute myeloid leukemia (AML) cell lines. Pracinostat is reported to have modest clinical activity in patients with advanced solid tumors. Given the higher preclinical sensitivity of hematologic malignancies to pracinostat, the authors conducted a phase 1 study to assess the safety, maximum tolerated dose, recommended phase 2 dose, efficacy, pharmacokinetics, and pharmacodynamics of pracinostat in patients with advanced hematological malignancies. METHODS: Pracinostat was administered orally 3 times a week for 3 weeks on a 28-day cycle. Patients were assigned to 7 dose levels using a 3 + 3 dose escalation design. RESULTS: A total of 44 patients were enrolled, 25 of whom had AML and 14 of whom had myelodysplastic syndrome. The maximum tolerated dose was 120 mg and the recommended phase 2 dose was 60 mg. Two patients with AML achieved a response: 1 complete remission (CR) and 1 complete cytogenetic response. Despite a dose-dependent increase in the plasma concentration of pracinostat, a similar increase in histone acetylation was not observed. As an extension, 10 additional patients with myelodysplastic syndrome were enrolled to assess the safety and efficacy of pracinostat in combination with azacitidine. Six patients achieved a CR and 3 achieved a CR without platelet recovery with no added toxicity. CONCLUSIONS: The results of the current study demonstrate that pracinostat is safe, with modest single-agent activity in patients with hematological malignancies. Cancer 2017;123:4851-9. © 2017 American Cancer Society.

Current management of patients with chronic myelomonocytic leukemia.

PURPOSE OF REVIEW: The present review will focus on the current management of patients with chronic myelomonocytic leukemia (CMML) as well as in future therapeutic perspectives. RECENT FINDINGS: CMML is a clonal hematopoietic stem cell disorder characterized by peripheral blood monocytosis and myelodysplastic and myeloproliferative alterations in the bone marrow. Clinical behavior of the disease can be heterogeneous, with some patients having an indolent form of the disease, whereas others experience an aggressive course with decreased survival and eventual transformation to leukemia. Multiple studies have helped define the clinical, cytogenetic and mutational prognostic features of the disease. In addition, several prognostic scoring systems have been developed for patients with CMML. Incorporation of mutation data, particularly presence of frameshift and nonsense ASXL1 mutations, into these models seems to be allowing to further improve our ability to predict patient outcomes. SUMMARY: Prognosis of patients with CMML is heterogeneous. Incorporation of mutational data into current clinical prognostic models has allowed to improve our ability to predict patient outcomes. Allogeneic stem cell transplantation remains the only potentially curative treatment for patients with CMML but is only an option for a subset of patients. For this reason, hypomethylating agents such as 5-azacitidine and decitabine have become the backbone of current therapy for patients with CMML, but new therapeutic strategies are required to improve their outcomes.

First-line use of rituximab correlates with increased overall survival in late post-transplant lymphoproliferative disorders: retrospective, single-centre study.

This retrospective study evaluates the impact of rituximab on PTLD response and survival in a single-centre cohort. PTLD cases between 1984 and 2009, including heart, kidney, liver and lung transplant recipients, were included. Survival was analysed taking into account the type of PTLD (monomorphic vs. polymorphic), EBV infection status, IPI score, Ann Arbor stage and use of rituximab. Among 1335 transplanted patients, 24 developed PTLD. Median age was 54 yr (range 29-69), median time to diagnosis 50 months (range 0-100). PTLD type was predominantly late/monomorphic (79% and 75%), mostly diffuse large B-cell type. Overall response rate (ORR) was 62% (66% rituximab vs. 50% non-rituximab; P = 0.5). R-CHOP-like regimens were used most frequently (72% of patients treated with rituximab). Median overall survival was 64 months (CI 95% 31-96). OS was significantly increased in patients treated with rituximab (P = 0.01; CI 95% rituximab 58-79 months; non-rituximab 1-30 months). Post-transplant immunosuppression regimen had no effect on survival or time to PTLD, except for cyclosporine A (CyA), which associated with increased time to PTLD (P = 0.02). Rituximab was associated with increased survival in our single-centre series, and it should be considered as first-line therapy for PTLD patients. The possible protective effect of CyA for development of PTLD should be prospectively evaluated.

Natural history of chronic myelomonocytic leukemia treated with hypomethylating agents.

Hypomethylating agents (HMA) are the most commonly used therapeutic intervention in chronic myelomonocytic leukemia (CMML). Due to the lack of CMML-specific clinical trials, the impact of these agents in the natural history of CMML is not fully understood. We present the largest retrospective series of CMML (n = 151) treated with HMA. Mean age at diagnosis was 69 years (range 50-88). According to the CMML-specific prognostic scoring system (CPSS): 17 (15%) were low-risk, 45 (39%) intermediate-1 risk, 42 (36%) intermediate-2, and 12 (10%) high-risk. 35 (23%) patients received single agent azacitidine, 73 (48%) single agent decitabine, and 43 (29%) combinations. With a median follow-up of 17 months, overall response rate (ORR) was 75%, with 41% achieving complete response (CR). Median overall survival (OS) was 24 months (95%CI: 20-28) and event-free survival 14 months (95%CI: 11-17). By multivariate analysis, age < 70 years, higher levels of hemoglobin, absence of blast in peripheral blood and lower CPSS cytogenetic risk predicted for better OS. CR was significantly higher in those patients treated with decitabine (58.3%) when compared with azacitidine (20.6%) (P < .001). 13 patients (9%) received allo-SCT after a median of 4 cycles of HMA. 66 patients (50%) had HMA failure: 26 primary (34%) and 50 secondary (66%), including 35 (46%) that transformed to AML. Outcomes after HMA failure were poor with OS of 7 months (95%CI: 3-12). In conclusion, HMA are effective in CMML but new agents and combinations are needed. This data could be a benchmark for further drug development in CMML.

Different exosome cargo from plasma/bronchoalveolar lavage in non-small-cell lung cancer.

Tumor-derived exosomes mediate tumorigenesis by facilitating tumor growth, metastasis, development of drug resistance, and immunosuppression. However, little is known about the exosomes isolated from bronchoalveolar lavage (BAL) in patients with lung neoplasm. Exosomes isolated in plasma and BAL from 30 and 75 patients with tumor and nontumor pathology were quantified by acetylcholinesterase activity and characterized by Western Blot, Electron Microscopy, and Nanoparticle Tracking Analysis. Differences in exosome cargo were analyzed by miRNA quantitative PCR in pooled samples and validated in a second series of patients. More exosomes were detected in plasma than in BAL in both groups (P < 0.001). The most miRNAs evaluated by PCR array were detected in tumor plasma, tumor BAL, and nontumor BAL pools, but only 56% were detected in the nontumor plasma pool. Comparing the top miRNAs with the highest levels detected in each pool, we found close homology only between the BAL samples of the two pathologies. In tumor plasma, we found a higher percentage of miRNAs with increased levels than in tumor BAL or in nontumor plasma. The data reveal differences between BAL and plasma exosome amount and miRNA content.

Screening for occult malignancy with FDG-PET/CT in patients with unprovoked venous thromboembolism.

Extensive screening strategies to detect occult cancer in patients with unprovoked venous thromboembolism (VTE) are complex and no benefit in terms of survival has been reported. FDG-PET/CT (2-[F-18] fluoro-2-deoxy-D-glucose positron emission tomography combined with computed tomography), a noninvasive technique for the diagnosis and staging of malignancies, could be useful in this setting. Consecutive patients ≥ 50 years with a first unprovoked VTE episode were prospectively included. Screening with FDG-PET/CT was performed 3-4 weeks after the index event. If positive, appropriate diagnostic work-up was programmed. Clinical follow-up continued for 2 years. Blood samples were collected to assess coagulation biomarkers. FDG-PET/CT was negative in 68/99 patients (68.7%), while suspicious FDG uptake was detected in 31/99 patients (31.3%). Additional diagnostic work-up confirmed a malignancy in 7/31 patients (22.6%), with six of them at early stage. During follow-up, two patients with negative FDG-PET/CT were diagnosed with cancer. Sensitivity (S), positive (PPV) and negative predictive values (NPV) of FDG-PET/CT as single tool for the detection of occult malignancy were 77.8% (95% CI: 0.51-1), 22.6% (95% CI: 0.08-0.37) and 97.1% (95% CI: 0.93-1), respectively. Median tissue factor (TF) activity in patients with occult cancer was 5.38 pM vs. 2.40 pM in those without cancer (p = 0.03). Limitation of FDG-PET/CT screening to patients with TF activity > 2.8 pM would improve the PPV to 37.5% and reduce the costs of a single cancer diagnosis from 20,711€ to 11,670€. FDG-PET/CT is feasible for the screening of occult cancer in patients with unprovoked VTE, showing high S and NPV. The addition of TF activity determination may be useful for patient selection.

Severe laryngeal edema after CAR-T cell treatment in a patient with multiple myeloma: A case report.

This case aims to report an unusual clinical situation with uncommon and severe side effects, which can even be life threatening for the patient. The ENT and Hematology specialist should be aware of diagnosing and treating adequately.

Optimization of universal allogeneic CAR-T cells combining CRISPR and transposon-based technologies for treatment of acute myeloid leukemia.

Despite the potential of CAR-T therapies for hematological malignancies, their efficacy in patients with relapse and refractory Acute Myeloid Leukemia has been limited. The aim of our study has been to develop and manufacture a CAR-T cell product that addresses some of the current limitations. We initially compared the phenotype of T cells from AML patients and healthy young and elderly controls. This analysis showed that T cells from AML patients displayed a predominantly effector phenotype, with increased expression of activation (CD69 and HLA-DR) and exhaustion markers (PD1 and LAG3), in contrast to the enriched memory phenotype observed in healthy donors. This differentiated and more exhausted phenotype was also observed, and corroborated by transcriptomic analyses, in CAR-T cells from AML patients engineered with an optimized CAR construct targeting CD33, resulting in a decreased in vivo antitumoral efficacy evaluated in xenograft AML models. To overcome some of these limitations we have combined CRISPR-based genome editing technologies with virus-free gene-transfer strategies using Sleeping Beauty transposons, to generate CAR-T cells depleted of HLA-I and TCR complexes (HLA-IKO/TCRKO CAR-T cells) for allogeneic approaches. Our optimized protocol allows one-step generation of edited CAR-T cells that show a similar phenotypic profile to non-edited CAR-T cells, with equivalent in vitro and in vivo antitumoral efficacy. Moreover, genomic analysis of edited CAR-T cells revealed a safe integration profile of the vector, with no preferences for specific genomic regions, with highly specific editing of the HLA-I and TCR, without significant off-target sites. Finally, the production of edited CAR-T cells at a larger scale allowed the generation and selection of enough HLA-IKO/TCRKO CAR-T cells that would be compatible with clinical applications. In summary, our results demonstrate that CAR-T cells from AML patients, although functional, present phenotypic and functional features that could compromise their antitumoral efficacy, compared to CAR-T cells from healthy donors. The combination of CRISPR technologies with transposon-based delivery strategies allows the generation of HLA-IKO/TCRKO CAR-T cells, compatible with allogeneic approaches, that would represent a promising option for AML treatment.

Inclusion of information technology-based assessments of health-related quality of life in routine oncology practice in Uruguay.

BACKGROUND: Previous research has shown that the inclusion of patient-reported outcomes measures in the patient's visit to the oncologists might improve the quality of global health care. The aim of the study was to assess the feasibility, acceptance, and utility perceived by patients and oncologists of health-related quality of life (HRQL) assessments obtained prior to clinical visits, and to evaluate if this has an impact on patient's well-being in a sample of Spanish-speaking patients from Uruguay. METHODS: Patients assisted regularly in the Oncology Clinic were randomized into two groups: an intervention group that completed a set of questionnaires (European Organisation for Research and Treatment of Cancer-Quality of Life Questionnaire-C30 (EORTC QLQ-C30) and Hospital Anxiety and Depression Scale using a touch screen device and a control group that did not respond to these questionnaires. At 2 months, the responses of all the participants to the Functional Assessment of Cancer Therapy-General (FACT-G) were collected over a telephone to determine whether there were differences in the HRQL between the intervention and control groups. The graphed scores of the intervention group were included in the clinical history of the patient during consultation. Patients and physicians completed the questionnaires on the usefulness of these measurements. RESULTS: In total, 58 patients participated in this study: 36 in the intervention group and 22 in the control group; 65% of the participants were female, and median age was 59 years (18-79). Regarding patients, 97% found the questionnaires easy to complete and thought that they included important questions. As for oncologists, 68.8% used the information and 87.5% found it useful for the consultation. There were no significant differences in the FACT-G scores between the intervention and control groups. CONCLUSIONS: The routine HRQL assessments using an electronic device prior to the consultations were positively valued by almost all patients and physicians. This could significantly contribute to a better understanding of the patient's overall problems during consultation. These results confirm the benefits of integrating the patient's self-reported quality of life outcomes into consultations.

Exploration of structural requirements for azole chemicals towards human aromatase CYP19A1 activity: Classification modeling, structure-activity relationships and read-across study.

Human aromatase, also called CYP19A1, plays a major role in the conversion of androgens into estrogens. Inhibition of aromatase is an important target for estrogen receptor (ER)-responsive breast cancer therapy. Use of azole compounds as aromatase inhibitors is widespread despite their low selectivity. A toxicological evaluation of commonly used azole-based drugs and agrochemicals with respect to CYP19A1 is currently requested by the European Union- Registration, Evaluation, Authorization and Restriction of Chemicals (EU-REACH) regulations due to their potential as endocrine disruptors. In this connection, identification of structural alerts (SAs) is an effective strategy for the toxicological assessment and safe drug design. The present study describes the identification of SAs of azole-based chemicals as guiding experts to predict the aromatase activity. Total 21 SAs associated with aromatase activity were extracted from dataset of 326 azole-based drugs/chemicals obtained from Tox21 library. A cross-validated classification model having high accuracy (error rate 5%) was proposed which can precisely classify azole chemicals into active/inactive toward aromatase. In addition, mechanistic details and toxicological properties (agonism/antagonism) of azoles with respect to aromatase were explored by comparing active and inactive chemicals using structure-activity relationships (SAR). Lastly, few structural alerts were applied to form chemical categories for read-across applications.

Skin sensitization quantitative QSAR models based on mechanistic structural alerts.

Allergic contact dermatitis is increasingly of interest for the hazard characterization of chemicals. in vivo animal testing is usually adopted but in silico approaches are becoming the new frontier due to their swiftness and economic efficiency. Indeed, in silico models can rationalise the experimental outcomes besides having predictive ability. The aim of the present work was to explore the electrophilic chemical behaviour responsible for allergic contact dermatitis using quantitative QSAR regression models. Eight models were proposed, using an experimental LLNA dataset of 366 chemicals. Each model is unique to encode a type of electrophilic reactivity domain. The models were obtained using autocorrelation, electro-topological and atom centered fragment based on two-dimensional descriptors, which incorporated the electronic and stereochemical features of substances interacting with skin proteins to induce skin cell proliferation. Finally, simple steps were proposed to integrate the eight models for the application on the test chemicals.