Transcriptome analysis and functional verification reveal the roles of copper in resistance to potato virus Y infection in tobacco.

Potato virus Y (PVY) is one of the most important pathogens in the genus Potyvirus that seriously harms agricultural production. Copper (Cu), as a micronutrient, is closely related to plant immune response. In this study, we found that foliar application of Cu could inhibit PVY infection to some extent, especially at 7 days post inoculation (dpi). To explore the effect of Cu on PVY infection, transcriptome sequencing analysis was performed on PVY-infected tobacco with or without Cu application. Several key pathways regulated by Cu were identified, including plant-pathogen interaction, inorganic ion transport and metabolism, and photosynthesis. Moreover, the results of virus-induced gene silencing (VIGS) assays revealed that NbMLP423, NbPIP2, NbFd and NbEXPA played positive roles in resistance to PVY infection in Nicotiana benthamiana. In addition, transgenic tobacco plants overexpressing NtEXPA11 showed increased resistance to PVY infection. These results contribute to clarify the role and regulatory mechanism of Cu against PVY infection, and provide candidate genes for disease resistance breeding.

First Report of Tomato Yellow Mottle-Associated Virus Infecting Tobacco in China.

Tomato yellow mottle-associated virus (TYMaV) belongs to the genus Cytorhabdovirus in the family Rhabdoviridae and has been reported to infect a variety of Solanaceae crops, such as Solanum lycopersicum, S. nigrum, Capsicum annuum and Nicotiana benthamiana (Li et al. 2022, Li et al. 2023, Xu et al. 2017, Zhou et al. 2019). In August 2022, about 500 out of 2000 tobacco (N. tabacum) plants showing leaf distortion, crinkling and mosaic symptoms were found in one tobacco growing field in Xingren City, Guizhou Province, China. To identify the causal pathogen(s), leaves from 20 symptomatic tobacco plants were collected and pooled to perform small RNA deep sequencing (sRNA-Seq) and assembly. Briefly, total RNA was extracted with TRIzol Reagent (Takara, Kusatsu, Japan). A small RNA cDNA library was constructed by the small RNA Sample Pre Kit. sRNA-Seq was performed with an Illumina NovaSeq 6000 platform. About 29 million reads were obtained and 334 contigs generated after removal of host-derived sequences. Among them, 31 unique contigs mapped to the TYMaV genome (NC_034240.1), covering 28.43% of the genome with the mean read coverage of 0.92%. Meanwhile, 226 contigs mapped to the genome of a potyvirus, chilli veinal mottle virus (ChiVMV, NC_005778.1), covering 88.79% of the genome with the mean read coverage of 0.83%. To verify the sRNA-Seq result for TYMaV identification, reverse transcription (RT)- PCR was performed with specific primers TYMaV-F (5'-CTGACGTAGTGTTGGCAGAT-3') and TYMaV-R (5'-AACCTCCATGCAGAACCATGG-3'). The expected-size 936-bp fragment was amplified from total RNA of all 20 samples. Dot enzyme-linked immunosorbent assays (Dot-ELISA) with antibody for TYMaV (kindly provided by Dr. Zhenggang Li from Guangdong Academy of Agricultural Sciences) were performed and further verified TYMaV infection. In addition, five asymptomatic tobacco plants from the same field as controls were used to detect TYMaV by RT-PCR and Dot-ELISA, and all samples showed negative test results. Subsequently, 17 primer pairs (Supplementary Table 1) were used to obtain the full-length sequence of TYMaV from a single positive tobacco sample by RT-PCR, followed by Sanger sequencing at Sangon Biotech (Shanghai, China). The resulting amplicon sequences were assembled into a nearly full-length genome sequence of a TYMaV isolate from tobacco in Guizhou (TYMaV-GZ). BLASTn analysis of the 13, 393 nt-long sequence (GeneBank accession number, PP444718) revealed 84.7% and 87.2% nt sequence identity with the TYMaV tomato isolate (KY075646.1) and the TYMaV S. nigrum isolate (MW527091.1), respectively. Moreover, five S. nigrum plants showing leaf crinkling and mosaic symptoms from tobacco fields tested positive for TYMaV by RT-PCR assay, suggesting a potential spread of TYMaV between tobacco and S. nigrum, which may serve as a reservoir for the virus in the tobacco fields. However, the transmission route of TYMaV remains unknown, and further verification is needed. To our knowledge, this is the first report of TYMaV infecting tobacco crop in China. It will be important to assess the potential economic importance of TYMaV to tobacco production in China and elsewhere, and to elucidate the respective roles of this virus and ChiVMV in the leaf distorting and yellowing symptoms.

Antibacterial Activities and Underlying Mechanisms of the Compound SYAUP-491 against Xanthomonas oryzae pv. oryzae.

SYAUP-491 is a novel alkyl sulfonamide. In this study, in vivo and in vitro tests were performed along with a proteomic analysis to determine the effects and underlying mechanisms of the antibacterial activity of SYAUP-491 against the causative agent of bacterial leaf blight in rice. The antibacterial test results suggested that SYAUP-491 exhibited significant activities against Xanthomonas oryzae pv. oryzae (Xoo) in vitro and in vivo. The minimal EC50 values reached 6.96 µg/mL and the curative activity reached 74.1%. Detailed studies demonstrated that SYAUP-491 altered membrane permeability and caused morphological changes. Based on proteomics results, SYAUP-491 might inhibit bacterial protein synthesis. SYAUP-491 may disrupt and alter cell membrane permeability and could further act on ribosomes in the bacterial body. Given the above results, SYAUP-491 could serve as a new lead compound in the research of antibacterial control of plant pathogenic bacterial disease.

First report of tomato brown rugose fruit virus infecting Solanum lycopersicum in Northeast China.

Tomato (Solanum lycopersicum L.) is an important fruit and vegetable crop with high economic value due to its rich vitamins (Friedman. 2002). Over the past five years, due to tomato brown rugose fruit virus (ToBRFV) infection, the tomato production in many countries and regions in Asia, America and Europe have experienced declines in yield and quality (Salem et al. 2023). ToBRFV is a positive-sense single-stranded RNA virus of the genus Tobamovirus in the family Virgaviridae (Salem et al. 2016). In the field, ToBRFV mainly infects solanaceous crops, including tomato and pepper (Zhang et al. 2022). Symptoms on ToBRFV-infected tomato plants mainly include foliar mottle, vein necrosis, and brown mottled rugose fruit (Alfaro-Fernández et al. 2020, Hamborg et al. 2022, Ma et al. 2021). In April 2023, about 150 tomato plants showing leaf curl, brown patch, and rugose surface on fruits were found in a greenhouse grown with about 500 tomato plants in Huludao City, Liaoning province, China. Two leaves and eight fruits from each of 10 symptomatic tomato plants were sampled and subjected to dot enzyme-linked immunosorbent assay (Dot-ELISA) with an antibody against ToBRFV (LV BAO, Chengdu, China); and all samples tested positive. Sap inoculations were prepared from 0.1 g of ToBRFV-positive tomato leaves via homogenization with 0.01 mol·L-1 PBS (phosphate buffered saline, pH 7.2), which were then inoculated mechanically onto 10 tomato cv. Moneymaker and 10 Nicotiana benthamiana plants at four- to six-leaf stage, respectively. At 10 days post inoculation (dpi), the leaf curl symptoms of all tomato plants were shown, which were consistent with those on greenhouse-infected plants. At 5 dpi, the upper leaves of all N. benthamiana plants showed yellowing and curling symptoms. The results of Dot-ELISA assays revealed that these mechanically inoculated plants were positive for ToBRFV. Total RNAs of inoculated and greenhouse-collected samples were extracted using TRIzolTM reagent and analyzed by reverse-transcription (RT)-PCR with specific primers ToBRFV-FD (5' GTCCCGATGTCTGTAAGGCTTGC) and ToBRFV-RD (5' GCAGGTGCAGAGGACCATTGTAA) for ToBRFV detection, respectively. The results showed that a 680-bp fragment was obtained in all tested samples. Then, primers ToBRFV-F1 (5' GTGTATTTTTTACAACATATACC) and ToBRFV-R1 (5' AACCATTGACTCAGAACTC), ToBRFV-F2 (5' TAGCCAAGAATCACGCATG) and ToBRFV-R2 (5' AGCAGCAATAATCACCGTA), ToBRFV-F3 (GAAAGAGTGGGGACGTTACAACATTCATCGGTAAT) and ToBRFV-R3 (TGGGCCCCTACCGGGGGTTCCGGGGGAATTCGAAT) were used to amplify the full-length sequence of ToBRFV using field-collected samples. The methods of primer design are shown in supplemental file 1. The sequence obtained by Sanger sequencing showed 99.86% nucleotide (nt) identity with ToBRFV-SD isolate (accession no. MT018320.1) from Shandong province, China. The full-length sequence of ToBRFV was uploaded to GenBank database with the accession number OR437354. To our knowledge, this is the first report of ToBRFV infecting tomato in Northeast China.

Transcriptomic and Functional Analyses Reveal the Different Roles of Vitamins C, E, and K in Regulating Viral Infections in Maize.

Maize lethal necrosis (MLN), one of the most important maize viral diseases, is caused by maize chlorotic mottle virus (MCMV) infection in combination with a potyvirid, such as sugarcane mosaic virus (SCMV). However, the resistance mechanism of maize to MLN remains largely unknown. In this study, we obtained isoform expression profiles of maize after SCMV and MCMV single and synergistic infection (S + M) via comparative analysis of SMRT- and Illumina-based RNA sequencing. A total of 15,508, 7567, and 2378 differentially expressed isoforms (DEIs) were identified in S + M, MCMV, and SCMV libraries, which were primarily involved in photosynthesis, reactive oxygen species (ROS) scavenging, and some pathways related to disease resistance. The results of virus-induced gene silencing (VIGS) assays revealed that silencing of a vitamin C biosynthesis-related gene, ZmGalDH or ZmAPX1, promoted viral infections, while silencing ZmTAT or ZmNQO1, the gene involved in vitamin E or K biosynthesis, inhibited MCMV and S + M infections, likely by regulating the expressions of pathogenesis-related (PR) genes. Moreover, the relationship between viral infections and expression of the above four genes in ten maize inbred lines was determined. We further demonstrated that the exogenous application of vitamin C could effectively suppress viral infections, while vitamins E and K promoted MCMV infection. These findings provide novel insights into the gene regulatory networks of maize in response to MLN, and the roles of vitamins C, E, and K in conditioning viral infections in maize.

Identification of 3-Methoxyphenylacetic Acid as a Phytotoxin, Produced by Rhizoctonia solani AG-3 TB.

Tobacco target spot disease is caused by Rhizoctonia solani AG-3 TB, which causes serious harm to the quality and yield of tobacco. In this study, thin layer chromatography (TLC), high performance liquid chromatography (HPLC), infrared absorption spectroscopy (IR), and nuclear magnetic resonance spectroscopy (NMR) were used to purify and identify the potential phytotoxin produced by R. solani AG-3 TB. The result indicated that the purified toxin compound was 3-methoxyphenylacetic acid (3-MOPAA) (molecular formula: C9H10O3). The exogenous purified compound 3-MOPAA was tested, and the results revealed that 3-MOPAA can cause necrosis in tobacco leaves. 3-MOPAA is a derivative of phenylacetic acid (PAA), which should be produced by specific enzymes, such as hydroxylase or methylase, in the presence of PAA. These results enrich the research on the pathogenic phytotoxins of R. solani and provide valuable insights into the pathogenic mechanism of AG-3 TB.

Next-generation sequencing identification and multiplex RT-PCR detection for viruses infecting cigar and flue-cured tobacco.

BACKGROUND: Early, precise and simultaneous identification of plant viruses is of great significance for preventing virus spread and reducing losses in agricultural yields. METHODS AND RESULTS: In this study, the identification of plant viruses from symptomatic samples collected from a cigar tobacco planting area in Deyang and a flue-cured tobacco planting area in Luzhou city, Sichuan Province, China, was conducted by deep sequencing of small RNAs (sRNAs) through an Illumina sequencing platform, and plant virus-specific contigs were generated based on virus-derived siRNA sequences. Additionally, sequence alignment and phylogenetic analysis were performed to determine the species or strains of these viruses. A total of 27930450, 21537662 and 28194021 clean reads were generated from three pooled samples, with a total of 105 contigs mapped to the closest plant viruses with lengths ranging from 34 ~ 1720 nt. The results indicated that the major viruses were potato virus Y, Chilli veinal mottle virus, tobacco vein banding mosaic virus, tobacco mosaic virus and cucumber mosaic virus. Subsequently, a fast and sensitive multiplex reverse transcription polymerase chain reaction assay was developed for the simultaneous detection of the most frequent RNA viruses infecting cigar and flue-cured tobacco in Sichuan. CONCLUSIONS: These results provide a theoretical basis and convenient methods for the rapid detection and control of viruses in cigar- and flue-cured tobacco.

Identification of Cyclic Dipeptides and a New Compound (6-(5-Hydroxy-6-methylheptyl)-5,6-dihydro-2H-pyran-2-one) Produced by Streptomyces fungicidicus against Alternaria solani.

As an important microbial resource, Actinomycetes, especially Streptomyces, have important application values in medicine and biotechnology. Streptomyces fungicidicus SYH3 was isolated from soil samples in tomato-growing areas and showed good inhibitory effects on Alternaria solani in tomato. To obtain pure active compounds, SYH3 fermentation broth was subjected to XAD-16 macroporous resin and silica gel column chromatography. Combined with the repeated preparation and separation of preparative high-performance liquid chromatography (HPLC), a total of four monomer compounds were obtained after activity tracking. Compound 4 was identified as a new six-membered lactone ring compound named 6-(5-hydroxy-6-methylheptyl)-5,6-dihydro-2H-pyran-2-one by 1D and 2D nuclear magnetic resonance (NMR) data and mass spectrometry (MS). The other three active compounds belong to the cyclodipeptide, and their half maximal inhibitory concentration (IC50) values against A. solani were 43.4, 42.9, and 30.6 µg/mL, respectively. Compound 4 significantly inhibited the spore germination and induced swollen and deformed local hyphae of A. solani with an IC50 value of 24.9 µg/mL. Compound 4 also had broad-spectrum antifungal activity and had a good antifungal effect on the tested plant-pathogenic fungi. The modes of action of new compound (4) still require further investigation, representing a novel and effective anti-fungal agent for future application.

Transcriptomic and functional analyses reveal an antiviral role of autophagy during pepper mild mottle virus infection.

BACKGROUND: Pepper mild mottle virus (PMMoV) is a member in the genus Tobamovirus and infects mainly solanaceous plants. However, the mechanism of virus-host interactions remains unclear. To explore the responses of pepper plants to PMMoV infection, we analyzed the transcriptomic changes in pepper plants after PMMoV infection using a high-throughput RNA sequencing approach and explored the roles of host autophagy in regulating PMMoV infection. RESULTS: A total of 197 differentially expressed genes (DEGs) were obtained after PMMoV infection, including 172 significantly up-regulated genes and 25 down-regulated genes. The Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses revealed that most up-regulated DEGs were involved in plant abiotic and biotic stresses. Further analyses showed the expressions of multiple autophagy-related genes (ATGs) were increased after PMMoV infection in pepper and Nicotiana benthamiana plants. Through confocal microscopy and transmission electron microscopy, we have found that PMMoV infection in plant can induce autophagy, evidenced by the increased number of GFP-ATG8a fluorescent punctate and the appearance of double membrane autophagic structures in cells of N. benthamiana. Additionally, inhibition of autophagy significantly increased PMMoV RNA accumulation and aggravated systemic PMMoV symptoms through autophagy inhibitor (3-MA and E64d) treatment and silencing of NbATG expressions by a Tobacco rattle virus-induced gene silencing assays. These results indicated that autophagy played a positive role in plant resistance to PMMoV infection. CONCLUSIONS: Taken together, our results provide a transcriptomic insight into pepper responding to PMMoV infection and reveal that autophagy induced by PMMoV infection has an antiviral role in regulating PMMoV infection. These results also help us to better understand the mechanism controlling PMMoV infection in plants and to develop better strategies for breeding projects for virus-resistant crops.

Characterization and a RT-RPA assay for rapid detection of Chilli Veinal mottle virus (ChiVMV) in tobacco.

BACKGROUND: Chilli veinal mottle virus (ChiVMV), which belongs to the genus Potyvirus of the family Potyviridae, mainly infects solanaceous plants and has caused serious economic losses in Asia and Africa. Tobacco plants infected with ChiVMV suffered from punctate necrosis of leaves, leaf deformation, systemic necrosis of leaves and stems, and eventually plant death. However, ChiVMV infection could not usually be identified given the lack of rapid and efficient detection assays in tobacco plants. Therefore, an isolate of tobacco-infecting ChiVMV (ChiVMV-LZ) was obtained, and a novel isothermal amplification and detection technique, reverse transcription-recombinase polymerase amplification (RT-RPA), was established to detect ChiVMV in tobacco plants. METHODS: In this study, the full-length genome of ChiVMV-LZ was obtained using reverse transcription-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE) assays. The genome sequence of ChiVMV-LZ was characterized by sequence alignment and phylogenetic analysis. Then, a RT-RPA assay was established for rapid and sensitive detection of ChiVMV-LZ in tobacco. Additionally, the established RT-RPA assay was compared to the RT-PCR assay in aspect of sensitivity and application in field-collected tobacco samples. RESULTS: ChiVMV-LZ was isolated from diseased tobacco in Luzhou, Sichuan, China. The tobacco plants inoculated with ChiVMV-LZ showed typical symptoms of yellow and round spots on the leaves, and curled and folded leaf margin, similar to those observed on naturally ChiVMV-infected tobacco in the field. The full-length genomic sequence of ChiVMV-LZ was determined to be 9742 nucleotides. Sequence alignment and phylogenetic analysis showed that ChiVMV-LZ was most closely related to ChiVMV-Yp8 isolated from pepper plants in Sichuan province while distantly related to ChiVMV-YN from tobacco in Yunnan province, indicating a possibly geographical differentiation of ChiVMV isolates. Additionally, a RT-RPA assay was established for rapid detection of ChiVMV in tobacco. The RT-RPA has no cross-reaction with other related tobacco viruses and is about 10-fold more sensitive than conventional RT-PCR method. CONCLUSION: The characterization of ChiVMV-LZ infecting tobacco was determined, and the established RT-RPA assay provides a reliable and effective method for rapid detection of ChiVMV in tobacco.

Effects of ε-poly-l-lysine on vegetative growth, pathogenicity and gene expression of Alternaria alternata infecting Nicotiana tabacum.

Microbial secondary metabolites produced by Streptomyces are applied to control plant diseases. ε-poly-l-lysine (ε-PL) is a non-toxic food preservative, but the potential application of ε-PL as a microbial fungicide in agriculture has rarely been reported. In this study, Alternaria alternata (A. alternata) was used to reveal the effect and mode of action for ε-PL on the plant pathogenic fungi. The results showed that ε-PL effectively inhibited necrotic-lesion development caused by A. alternata on tobacco. Mycelial growth was also significantly inhibited in vitro by 100 µg/ml ε-PL using in vitro analysis. Moreover, 25 µg/ml ε-PL inhibited spore germination and induced abnormal morphological development of A. alternata hyphae. To clarify the molecular-genetic antifungal mechanisms, we selected several crucial genes involved in the development and pathogenesis of A. alternata and studied their expression regulated by ε-PL. Results of real-time quantitative PCR showed that a mycelium morphology and pathogenic process related cyclic adenosine monophosphate protein (cAMP) dependent protein kinase A (PKA), Alternaria alternata cAMP-dependent protein kinase catalytic subunit (AAPK1) and the early infection-related glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were down-regulated after ε-PL treatment. The results provide novel insights for the application of ε-PL in the control of plant diseases caused by A. alternata.

Novel combined biological antiviral agents Cytosinpeptidemycin and Chitosan oligosaccharide induced host resistance and changed movement protein subcellular localization of tobacco mosaic virus.

Plant viral diseases cause severe economic losses in agricultural production. Development of microorganism-derived antiviral agents provides an alternative strategy to efficiently control plant viral diseases. In this study, the antiviral effect and mechanism of a combined biological agent Cytosinpeptidemycin and Chitosan oligosaccharide (CytPM-COS) were investigated. CytPM-COS effectively inhibited tobacco mosaic virus (TMV) in Nicotiana glutinosa, suppressed viral RNA and CP accumulation in BY-2 protoplast and affected the subcellular localization as well as punctate formation of TMV MP in N. benthamiana leaves. In addition, CytPM-COS triggered reactive oxygen species (ROS) production and induced up-regulation of various defense responsive genes including PR-1, PR-5, FLS2, Hsp70. Our results indicated that CytPM-COS can potentially act as a pesticide for integrated control of plant viruses in the future.

iTRAQ-Based Proteomic Analysis of Watermelon Fruits in Response to Cucumber green mottle mosaic virus Infection.

Cucumber green mottle mosaic virus (CGMMV) is an important viral pathogen on cucurbit plants worldwide, which can cause severe fruit decay symptoms on infected watermelon (usually called "watermelon blood flesh"). However, the molecular mechanism of this disease has not been well understood. In this study, we employed the isobaric tags for relative and absolute quantitation (iTRAQ) technique to analyze the proteomic profiles of watermelon fruits in response to CGMMV infection. A total of 595 differentially accumulated proteins (DAPs) were identified, of which 404 were upregulated and 191 were downregulated. Functional annotation analysis showed that these DAPs were mainly involved in photosynthesis, carbohydrate metabolism, secondary metabolite biosynthesis, plant-pathogen interaction, and protein synthesis and turnover. The accumulation levels of several proteins related to chlorophyll metabolism, pyruvate metabolism, TCA cycle, heat shock proteins, thioredoxins, ribosomal proteins, translation initiation factors, and elongation factors were strongly affected by CGMMV infection. Furthermore, a correlation analysis was performed between CGMMV-responsive proteome and transcriptome data of watermelon fruits obtained in our previous study, which could contribute to comprehensively elucidating the molecular mechanism of "watermelon blood flesh". To confirm the iTRAQ-based proteome data, the corresponding transcripts of ten DAPs were validated by determining their abundance via quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR). These results could provide a scientific basis for in-depth understanding of the pathogenic mechanisms underlying CGMMV-induced "watermelon blood flesh", and lay the foundation for further functional exploration and verification of related genes and proteins.

Recombinase polymerase amplification assay for rapid detection of maize chlorotic mottle virus in maize.

Maize chlorotic mottle virus (MCMV), an important quarantine virus, causes lethal necrosis in maize when coinfected with a potyvirid, which is seriously threatening the production of maize worldwide. In this study, recombinase polymerase amplification (RPA), a novel isothermal DNA amplification and detection technique, was developed to detect MCMV in maize crops. A pair of specific primers was designed based on the conserved sequences of the MCMV coat protein region. The RT-RPA assay was carried out as an isothermal reaction at 38 °C that was complete within 30 min, and no cross-reactivity was detected with other viruses infecting maize in China. The limit of detection of the RT-RPA assay was tenfold lower than that of ordinary RT-PCR. Moreover, this method was successfully applied to test field-collected samples. The newly developed RT-RPA assay offers a reliable, sensitive and efficient method for rapid detection of MCMV in maize in equipment-limited diagnostic laboratories and on-site facilities.

Purification and Structural Analysis of the Effective Anti-TMV Compound ε-Poly-l-lysine Produced by Streptomyces ahygroscopicus.

Microbial secondary metabolites produced by actinomycetes are important natural products widely applied to control plant diseases. A variety of actinomycetes were isolated from soil samples collected from Tianzhu Mountain in Shenyang, China. A Streptomyces strain Shenyang Tianzhu (STZ) exhibits effective antiviral activity against Tobacco mosaic virus (TMV). The isolate was identified as Streptomyces ahygroscopicus based on its cultural, morphological, physiological, biochemical characteristics as well as the phylogenetic analysis using 16S rRNA sequences. To obtain the pure anti-TMV compound from Streptomyces STZ, the culture broth was subjected to Amberlite IRC-50 ion-exchange resin, SX-8 macroporous adsorption resin and Sephadex G-25 gel column chromatography. The purified active compound was confirmed to be ε-poly-l-lysine (ε-PL), with molecular mass in the range of 3454⁻4352 Da by structural analysis with infrared (IR), matrix-assisted laser desorption ionization-time-of-flight MS (MALDI-TOF), thin-layer chromatography (TLC) and high-resolution magic angle spinning nuclear magnetic resonance (HR-MAS NMR). The protective and curative effects of the purified compound ε-PL were tested and the results showed that the compound exhibited significant protective and curative activity against TMV. The potential application of ε-PL as an efficient anti-plant virus agent was expected.

ZmmiR398b negatively regulates maize resistance to sugarcane mosaic virus infection by targeting ZmCSD2/4/9.

MicroRNAs (miRNAs) are widely involved in various biological processes of plants and contribute to plant resistance against various pathogens. In this study, upon sugarcane mosaic virus (SCMV) infection, the accumulation of maize (Zea mays) miR398b (ZmmiR398b) was significantly reduced in resistant inbred line Chang7-2, while it was increased in susceptible inbred line Mo17. Degradome sequencing analysis coupled with transient co-expression assays revealed that ZmmiR398b can target Cu/Zn-superoxidase dismutase2 (ZmCSD2), ZmCSD4, and ZmCSD9 in vivo, of which the expression levels were all upregulated by SCMV infection in Chang7-2 and Mo17. Moreover, overexpressing ZmmiR398b (OE398b) exhibited increased susceptibility to SCMV infection, probably by increasing reactive oxygen species (ROS) accumulation, which were consistent with ZmCSD2/4/9-silenced maize plants. By contrast, silencing ZmmiR398b (STTM398b) through short tandem target mimic (STTM) technology enhanced maize resistance to SCMV infection and decreased ROS levels. Interestingly, copper (Cu)-gradient hydroponic experiments demonstrated that Cu deficiency promoted SCMV infection while Cu sufficiency inhibited SCMV infection by regulating accumulations of ZmmiR398b and ZmCSD2/4/9 in maize. These results revealed that manipulating the ZmmiR398b-ZmCSD2/4/9-ROS module provides a prospective strategy for developing SCMV-tolerant maize varieties.

Unveiling novel anti-viral mechanisms of ε-poly-l-lysine on tobacco mosaic virus-infected Nicotiana tabacum through microRNA and transcriptome sequencing.

MicroRNAs (miRNAs) play important roles in plant defense against various pathogens. ε-poly-l-lysine (ε-PL), a natural anti-microbial peptide produced by microorganisms, effectively suppresses tobacco mosaic virus (TMV) infection. To investigate the anti-viral mechanism of ε-PL, the expression profiles of miRNAs in TMV-infected Nicotiana tabacum after ε-PL treatment were analyzed. The results showed that the expression levels of 328 miRNAs were significantly altered by ε-PL. Degradome sequencing was used to identify their target genes. Integrative analysis of miRNAs target genes and gene-enriched GO/KEGG pathways indicated that ε-PL regulates the expression of miRNAs involved in critical pathways of plant hormone signal transduction, host defense response, and plant pathogen interaction. Subsequently, virus induced gene silencing combined with the short tandem targets mimic technology was used to analyze the function of these miRNAs and their target genes. The results indicated that silencing miR319 and miR164 reduced TMV accumulation in N. benthamiana, indicating the essential roles of these miRNAs and their target genes during ε-PL-mediated anti-viral responses. Collectively, this study reveals that microbial source metabolites can inhibit plant viruses by regulating crucial host miRNAs and further elucidate anti-viral mechanisms of ε-PL.

Molecular characterization and pathogenicity of a novel monopartite geminivirus infecting tobacco in China.

The occurrence of geminiviruses causes significant economic losses in many economically important crops. In this study, a novel geminivirus isolated from tobacco in Sichuan province of China, named tomato leaf curl Chuxiong virus (TLCCxV), was characterized by small RNA-based deep sequencing. The full-length of TLCCxV genome was determined to be 2744 nucleotides (nt) encoding six open reading frames. Phylogenetic and genome-wide pairwise identity analysis revealed that TLCCxV shared less than 91% identities with reported geminiviruses. A TLCCxV infectious clone was constructed and successfully infected Nicotiana benthamiana, N. tabacum, N. glutinosa, Solanum lycopersicum and Petunia hybrida plants. Furthermore, expression of the V2, C1 and C4 proteins through a potato virus X vector caused severe chlorosis or necrosis symptom in N. benthamiana. Taken together, we identified a new geminivirus in tobacco plants, and found that V2, C1 and C4 contribute to symptom development.

RNA interference-based exogenous double-stranded RNAs confer resistance to Rhizoctonia solani AG-3 on Nicotiana tabacum.

BACKGROUND: Rhizoctonia solani Kühn is a pathogenic fungus causing tobacco target spot disease, and leads to great losses worldwide. At present, resistant varieties and effective control strategy on tobacco target spot disease are very limited. Host-induced gene silencing (HIGS) as well as the exogenous dsRNA can be used to suppress disease progression, and reveal the function of crucial genes involved in the growth and pathogenesis of the fungus. RESULTS: The silencing of endoPGs or RPMK1 in host plants by TRV-based HIGS resulted in a significant reduction in disease development in Nicotiana benthamiana. In vitro analysis validated that red fluorescence signals were consistently observed in the hyphae treated with Cy3-fluorescein-labeled dsRNA at 12, 24, 48 and 72 h postinoculation (hpi). Additionally, application of dsRNA-endoPGs, dsRNA-RPMK1 and dsRNA-PGMK (fusion of partial endoPGs and RPMK1 sequences) effectively inhibited the hyphal growth of R. solani YC-9 in vitro and suppressed disease progression in the leaves, and quantitative real-time PCR confirmed that the application of dsRNAs significantly reduced the expression levels of endoPGs and RPMK1. CONCLUSION: These results provide theoretical basis and new direction for RNAi approaches on the prevention and control of disease caused by R. solani. © 2024 Society of Chemical Industry.

Antiviral Mechanisms of Anisomycin Produced by Streptomyces albulus SN40 on Potato Virus Y.

Microbial secondary metabolites produced by Streptomyces have diverse application prospects in the control of plant diseases. Herein, the fermentation filtrate of Streptomyces SN40 effectively inhibited the infection of tobacco mosaic virus (TMV) in Nicotiana glutinosa and systemic infection of potato virus Y (PVY) in Nicotiana benthamiana. Additionally, metabolomic analysis indicated that anisomycin (C14H19NO4) and trans-3-indoleacrylic acid (C11H9NO2) were highly abundant in the crude extract and that anisomycin effectively suppressed the infection of TMV as well as PVY. Subsequently, transcriptomic analysis was conducted to elucidate its mechanisms on the induction of host defense responses. Furthermore, the results of molecular docking suggested that anisomycin can potentially bind with the helicase domain (Hel) of TMV replicase, TMV coat protein (CP), and PVY helper component proteinase (HC-Pro). This study demonstrates new functions of anisomycin in virus inhibition and provides important theoretical significance for the development of new biological pesticides to control diverse plant viruses.