Spanish Consensus on the Management of Chronic Rhinosinusitis With Nasal Polyps (POLIposis NAsal/POLINA 2.0).

Chronic rhinosinusitis with nasal polyps (CRSwNP) is a highly prevalent and burdensome disease for both individuals and health systems. Its management involves many specialties, including otorhinolaryngology, allergology, pulmonology, primary care, pharmacy, and pediatrics. A multidisciplinary approach and the participation of the patient in decision-making are essential, both for diagnosis and for therapy. The authors of the consensus aim to translate current knowledge into an easy-to-read practical guide and emphasize those aspects requiring further discussion or with unmet needs owing to the lack of appropriate scientific evidence. An iterative approach for the development of an evidence-based systematic review with recommendations was followed using a standard quality assessment approach (Scottish Intercollegiate Guidelines Network [SIGN] and National Institute for Health and Care Excellence [NICE]). The guideline was critically evaluated using the Appraisal of Guidelines for Research and Evaluation (AGREE II) and Recommendation Excellence (AGREE REX) instruments. Consequently, POLINA has been considered a high-quality guideline by an independent agency. The POLINA consensus provides new definitions of control, therapeutic management (including surgery and evaluation of severity), indications for use of biologics, and response. Finally, this guideline focuses on unmet research needs in CRSwNP.

Craniofacial morphology/phenotypes influence on mandibular range of movement in the design of a mandibular advancement device.

BACKGROUND: The mandibular opening path movements have different directions according to the craniofacial morphology of the patient but always downward and backward, therefore increasing the collapse of the upper airway. The aim of this work is to determine if there is a relationship between the craniofacial morphology and the mandibular movement to help understand the impact on the mandibular position. METHODS: 52 students with full permanent dentition aged 19 to 23 years (mean 21.3 SD 1.7; 29 females and 23 males), participated in the study. Each subject had a lateral cephalometric radiograph taken. The opening angle was determined for two levels of vertical openings at 5 and 10 mm. RESULTS: The opening angle showed a greater variability between subjects ranging from 63.15 to 77.08 for 5 mm angle and from for 61.65 to 75.72 for the 10 mm angle. Differences of facial phenotypes was evident when comparing the individual dissoccluding angle of the low angle horizontal pattern and high angle vertical pattern. CONCLUSIONS: The opening angle is related to craniofacial morphology with higher vertical anterior and shorter anteroposterior faces having a more horizontal path of mandibular movement than shorter vertical anterior and longer anteroposterior subjects who have a more vertical path.

Letter to the Editor "Drosha, DGCR8, and Dicer mRNAs are downregulated in human cells infected with dengue virus 4" - Genet. Mol. Res. 15 (2): gmr.15027891 - Drosha, Dicer, and TRBP mRNA are downregulated in Vero cells with the 3'UTR of Dengue virus.

Dear Editor, A recent paper (Casseb et al., 2016) published in the journal Genetics and Molecular Research described the interesting concept that dengue virus (DENV)-4 infection, in the human cell line A-549, leads to the downregulation of expression of key components of microRNA (miRNA) biogenesis, such as Drosha, Dicer, and DGCR8. For this, the authors performed a time course infection of A-549 cells for 5 days. The highest viral load was observed at 3 days post-infection, which corresponded with the maximum downregulation of expression of Drosha, Dicer, and DGCR8, assayed by quantitative PCR (RT-qPCR). These results supported the recent notion of a complex interaction between DENV and the host miRNA machinery and of the host miRNA response to this particular infection. Extensive evidence has shown that DENV can take advantage of host miRNAs for its own replication (Zhu et al., 2014) and that host miRNAs can inhibit DENV replication (Wu et al., 2013).

A novel begomovirus isolated from sida contains putative cis- and trans-acting replication specificity determinants that have evolved independently in several geographical lineages.

A novel begomovirus isolated from a Sida rhombifolia plant collected in Sinaloa, Mexico, was characterized. The genomic components of sida mosaic Sinaloa virus (SiMSinV) shared highest sequence identity with DNA-A and DNA-B components of chino del tomate virus (CdTV), suggesting a vertical evolutionary relationship between these viruses. However, recombination analysis indicated that a short segment of SiMSinV DNA-A encompassing the plus-strand replication origin and the 5´-proximal 43 codons of the Rep gene was derived from tomato mottle Taino virus (ToMoTV). Accordingly, the putative cis- and trans-acting replication specificity determinants of SiMSinV were identical to those of ToMoTV but differed from those of CdTV. Modeling of the SiMSinV and CdTV Rep proteins revealed significant differences in the region comprising the small ß1/ß5 sheet element, where five putative DNA-binding specificity determinants (SPDs) of Rep (i.e., amino acid residues 5, 8, 10, 69 and 71) were previously identified. Computer-assisted searches of public databases led to identification of 33 begomoviruses from three continents encoding proteins with SPDs identical to those of the Rep encoded by SiMSinV. Sequence analysis of the replication origins demonstrated that all 33 begomoviruses harbor potential Rep-binding sites identical to those of SiMSinV. These data support the hypothesis that the Rep ß1/ß5 sheet region determines specificity of this protein for DNA replication origin sequences.

No detection of Besnoitia besnoiti DNA in the semen of chronically infected bulls.

Bovine besnoitiosis is a chronic and debilitating disease observed in many European countries that may cause important economic losses in cattle. The recent widespread of the parasite in Europe had led the European Food Safety Authority to declare bovine besnoitiosis as a re-emerging disease in Europe. Many aspects of the epidemiology of bovine besnoitiosis such as the main routes of transmission are still unclear and need to be further studied. Among the different hypotheses, a sexual transmission has not yet been investigated. Therefore, the aim of this study was to evaluate the presence of Besnoitia besnoiti DNA in the semen of naturally infected bulls by using a highly sensitive method (real-time qPCR). Both pre-sperm and sperm fractions of 40 bulls, including seronegative (n = 11), seropositive subclinically (n = 17), and seropositive clinically (n = 12) infected animals, were collected by electroejaculation and analyzed by real-time qPCR. No B. besnoiti DNA was detected in 27 pre-sperm and 28 sperm fractions of the 40 examined bulls, suggesting that the transmission of B. besnoiti infection by the semen of chronically infected bulls is very unlikely.

Relationship between quality of life, emotional symptomology and perceived emotional intelligence in a sample of burn victims.

The main objective of this study is to analyse the association between Quality of Life (QOL), Emotional Symptomology and perceived Emotional Intelligence (EI) in burn patients. Additionally, it is intended determine the predictor models of QOL, and confirm the mediating effect of emotional symptomology between QOL and perceived EI. This is a transversal study developed in the Hospital da Prelada, Porto, Portugal, with a sample of 92 patients that were hospitalized in the Burn Unit and the Reconstructive Plastic Surgery Service. The assessment protocol consisted of a sociodemographic and clinical data sheet. To assess the perception of QOL of the burn patient it was used the Burn Specific Health Scale - Revised (BSHS-R), the emotional symptomology was measured by the Brief Symptom Inventory (BSI) and Trait Met-Mood Scale-24 (TMMS) was used to assess Emotional Intelligence (EI). The cross-sectional and correctional data were analysed through descriptive statistics, correlations, regressions and simple mediations. The results obtained suggest significant associations between QOL, perceived EI and Emotional Symptomology in burn patients. The results of the predictor models of the QOL domains encompass the Positive Symptom Distress Index (PSDI of Emotional Symptomology), where the total variance is explained mainly by the models of QOL Affect and Body Image 46% and Treatment 31%. The mediating effect of the PSDI in the relationship between QOL in the Affect and Body Image dimension and the Mood Repairs (MR) was also tested, having proved to have a total mediation (the Mood Repairs loses its contribution in the QOL model when the PSDI variable is introduced). This study underscores the importance of perceived Emotional Intelligence and its association with the burn impact in the different dimensions of QOL of the patients. The intention of this study is to alert health professionals for patient support in the search for strategies that aim for positive adaptation which promotes QOL and emotional adjustment of burn patients to their new condition.

Survey of flea infestation in cats in Spain.

Fleas are a common cause of feline skin disorders as well as vectors of zoonotic diseases. This study evaluated the flea species infesting domestic cats in Spain and assessed factors influencing their distribution. Fleas from 217 cats from 57 localities in Spain were identified and associations between abundance, and host-dependent, host habitat and environmental factors were examined. Variations in infracommunity and component community structure were also explored. Three species were present, of which Ctenocephalides felis (Bouché) (Siphonaptera: Pulicidae) was the most abundant (98.4%), followed by Ctenocephalides canis (Curtis) (1.1%) and Pulex irritans (L.) (Siphonaptera: Pulicidae) (0.5%). Overall abundance and abundances of both C. felis and C. canis were higher on farms than in apartments, but overall flea abundance and abundances of both C. felis and C. canis were lower in rural than urban environments. Overall abundance and C. felis abundance were lower during the warmest months, and mean annual rainfall was positively correlated with overall, C. felis and C. canis abundances. No relationship between the number of species per cat and any host, habitat or physiographical variable was found. Species richness was not correlated with mean annual temperature or rainfall. Flea abundance was mainly associated with host habitat and environmental factors.

Periodization of altitude training: A collective case study of high-level swimmers.

The objective was to quantify parallel changes in performance and physiological measures in relation to periodization of sequential altitude training over a season in elite swimmers. The altitude training of four female and two male international swimmers in selected seasons was examined using a collective case study approach. All swimmers were a medalist in World (WC) and/or European Championships (EC) 2013, 2014, 2016 and 2018 in short or long course competition. A traditional periodization model was employed using three macrocycles with 3-4 altitude camps (duration 21-24 days each) scheduled over the season, following a polarized training intensity distribution (TID) with a volume ranged between 729 km and 862 km. The timing of return from altitude prior to competition was between 20-32 days, with 28 days the most common period. Competition performance was assessed with major (international) and minor (regional or national) competitions. Hemoglobin concentration, hematocrit, anthropometric characteristics, were measured before and after each camp. Competition performance following the altitude training camps improved by 0.6% ± 0.8% (personal best time; mean ± SD) (95% confidence limits (CL) 0.1%-1.1%), 1.6% ± 0.7% (95% CL 1.2% to 2.0%) (season best time) and 1.6% ± 0.5% (95% CL 1.3%-1.9%) (previous season time). Hemoglobin concentration increased 4.9% from pre-to post-altitude training camps, while hematocrit increased by 4.5%. The sum of six skinfolds reduced by 14.4% (95% CL 18.8%-9.9%) and 4.2% (95% CL 2.4%-9.2%) for the two males (EC), and by 15.8% (95% CL 19.5%-12.0%) for two females (WC). Three to four altitude training camps in a competitive season, around 21-24 days of duration, scheduling the last return between 20-32 days before the main competition, integrated in a traditional periodized sequence, can induce worthwhile improvements in international swimming performance, hematological parameters, and anthropometric characteristics.

A new strain of tomato severe leaf curl virus and a unique variant of tomato yellow leaf curl virus from Mexico.

The complete genome sequence of a distinct variant of tomato yellow leaf curl virus-Israel (TYLCV-IL) and the DNA-A sequence of a new strain of tomato severe leaf curl virus (ToSLCV) isolated in San Luis Potosi, Mexico, are described and analyzed. The TYLCV-IL[MX:SLP:11] variant differs from all TYLCV-IL isolates described so far by a unique 42-nt duplicated sequence comprising a part of the conserved stem-loop element of the virion-strand replication origin and adjacent regulatory sequences. TYLCV-IL[MX:SLP:11] was associated with tomato chino La Paz virus (ToChLPV-B[MX:SLP:11]) in a Solanum pimpinellifolium plant, and with pepper huasteco yellow vein virus (PHYVV-[MX:SLP:11]) and ToSLCV-GT[MX:SLP:11] in a Solanum lycopersicum plant. In addition, a distinct ToSLCV exhibiting low sequence identity (<89 %) to other ToSLCV isolates from Mexico was found in a tomato plant collected in the same field. Sequence analysis of this new ToSLCV strain indicates that it is a recombinant of close relatives of ToSLCV-GT[MX:SLP:11] and ToChLPV-B[MX:SLP:11] found in mixed infections with TYLCV-IL[MX:SLP:11].

First Report of Beet mild curly top virus in Dry Bean in Zacatecas, Mexico.

In August 2009, yellowing, upward curling of leaves, and stunted growth were observed on 15 to 40% of dry bean (Phaseolus vulgaris cv. Aluvori) plants in each of several experimental fields in Zacatecas, Mexico. Symptoms and presence of the beet leafhopper (Circulifer tenellus) in affected fields suggested an infection by curtoviruses (Geminiviridae). Total DNA extracts from 18 plant samples exhibiting symptoms were obtained by a modified Dellaporta method (2) and subjected to PCR analysis using two pairs of new, degenerate primers specific for curtoviruses: RepQEW-for (CCRAARTAAGMATCRGCCCAYTCTTG) in combination with CP450-rev (GTCCTCGAGTAGACGGCATAGCCTGACC) and V2Gen910-for (ATGTCGACGAAGCATTTGAAGTTTGATATGGC) with Rep2GQ-rev (GAAGATCTGCWCGMGGAGGYCARCAGACGGCT). This double set of primers was used to amplify two overlapping DNA segments encompassing the complete curtovirus genome. All samples produced amplicons of the expected size (1.75 and 1.8 kb, respectively) that were cloned into pGEM-T Easy Vector (Promega, Madison, WI). Restriction fragment length polymorphism analysis of PCR clones with EcoRI and HinfI endonucleases suggested the presence of a single curtovirus species because only one restriction fragment pattern was observed in all cases. Viral amplicons from three plants were sequenced, and the overlapping DNA fragments were subsequently assembled into a complete genome sequence. Comparison of the virus sequence (Accession No. HQ634913) with sequences of all curtovirus isolates available in GenBank showed that it shared the highest nucleotide identity (98%) with Beet mild curly top virus-Mexico SLP1 from pepper (BMCTV-MX [SLP1]; Accession No. EU586260). Amino acid sequence identity of the seven predicted proteins (Rep, TrAP, REn, C4, V1, V2, and V3) encoded by the virus isolated from bean plants shared 98.0, 97.3, 98.5, 98.8, 100, 99.2, and 97.8% sequence identity, respectively, with the homologous proteins of BMCTV-MX [SLP1]. A BMCTV isolate from pepper collected in Zacatecas in 2007 (Accession No. EU586260) with 96% nucleotide sequence identity to the curtovirus identified in bean induced symptoms in P. vulgaris cv. Topcrop similar to those observed in bean in Zacatecas (1). To determine the presence of curtoviruses in the local populations of insect vectors, beet leafhoppers were collected in one of the sampled dry bean fields and total DNA was isolated from a pool of approximately 20 insects. Amplification of viral DNA with the degenerate primers RepQEW-for and CP450-rev and further sequencing of the PCR products confirmed the presence of a curtovirus DNA sharing almost identical nucleotide identity (99%) with the DNA isolated from bean plants. In 2011, symptoms similar to those observed in bean in 2009 occurred in approximately 30% of dry bean plants, suggesting that BMCTV is endemic in the Zacatecas Region. To our knowledge, this is the first report of BMCTV in legumes in Mexico. References: (1) L. F. Chen et al. Arch. Virol. 156:547, 2011. (2) S. L. Dellaporta et al. Plant Mol. Biol. Rep. 1:19, 1983.

Use of domperidone in the treatment of canine visceral leishmaniasis: a clinical trial.

The aim of this study was to evaluate the effects of domperidone, a dopamine D2 receptor antagonist, in dogs naturally infected by Leishmania infantum. Ninety-eight dogs were treated with single-agent domperidone at 1mg/kg twice a day orally for 1 month. Clinical, serological, biochemical and immunological examinations were conducted for the following 12 months. Domperidone was effective in controlling and reducing clinical signs and antibody titre. Significant decreases in reciprocal serum antibodies were seen in 74.3% of the dogs with mild clinical signs and 40% of the dogs became seronegative. In dogs with several clinical signs and high antibody titres, clinical improvement occurred in 86% of animals and the reciprocal serum antibody titres decreased in 38% of these dogs. A significant increase was noted in the immune cellular status, as measured by the leishmanin skin test and a lymphocyte proliferation assay.

The adaptation of the Burn Specific Health Scale-Revised (BSHS-R) into the Portuguese context.

The objective of this study was the adaptation of the Burn Specific Health Scale-Revised (BSHS-R) into the Portuguese context. The authors of the original version of BSHS-R with 31 items are Blalock, Bunker and DeVellis and it was developed to evaluate the health status of burns victims. The Brazilian version of the BSHS-R was translated from Portuguese (Brazil) to Portuguese (Portugal), through a semantic adaptation process, by independent Portuguese-Brazilian specialists, followed by a verbal comprehension assessment of all items, with a heterogeneous group of people, in terms of age, education and occupation. After the survey adaptation to Portuguese (Portugal), a psychometric study of the BSHS-R has been realized with a sample of 92 patients, which had been hospitalized in the Burn, Plastic and Reconstructive Surgery units of the Prelada Hospital, Porto, Portugal. For the process of instrument validation, a factorial exploratory analysis has been conducted and the internal consistency indicators were analysed using Cronbach's alpha (reliability). The results analysis allowed to assess and identify the validity of the construct through the factorial exploratory analysis, which confirmed the same previous factorial structure identified in the original language and in the Brazilian version. The BSHS-R also presented good internal consistency indicators (global α = .921; affect and body image α = .874; heat sensitivity α = .830; simple functional abilities α = .893; treatment regimens α = .772; work α = .876; interpersonal relationships α = .804). The Portuguese (Portugal) adapted version has revealed useful, valid and reliable for the quality of life assessment related to the health of people that suffered burn injuries.

Assessment of the neutron radiation field with activation foils and intermittent irradiations around a PETtrace biomedical cyclotron.

This work aimed at assessing the neutron radiation field with activation foils around of the PETtrace biomedical cyclotron. Activation foils of gold, gold covered with cadmium, indium and nickel was used to evaluate the thermal, epithermal and fast neutron contributions, respectively. The irradiations of the activation foils were performed using the intermittent irradiation method to conciliate the measurements with the routine 18F production. The evaluated points showed the contributions of the thermal, epithermal and fast neutrons due to interaction with the vault room, cyclotron accelerator and main cyclotron components.

Mechanism of the modulation of Kv4:KChIP-1 channels by external K+.

In response to a prolonged membrane depolarization, inactivation autoregulates the activity of voltage-gated ion channels. Slow inactivation involving a localized constriction of the selectivity filter (P/C-type mechanism) is prevalent in many voltage-gated K(+) channels of the Kv1 subfamily. However, the generalization of this mechanism to other Kv channel subfamilies has remained uncertain and controversial. In agreement with a "foot-in-the-door" mechanism and the presence of ion-ion interactions in the pore, elevated external K(+) slows the development of P/C-type inactivation and accelerates its recovery. In sharp contrast and resembling the regulation of the hippocampal A-type K(+) current, we found that Kv4.x channels associated with KChIP-1 (an auxiliary subunit) exhibit accelerated inactivation and unaffected recovery from inactivation when exposed to elevated external K(+). This regulation depends on the ability of a permeant ion to enter the selectivity filter (K(+) = Rb(+) = NH4(+) > Cs(+) > Na(+)); and the apparent equilibrium dissociation constant of a single regulatory site is 8 mM for K(+). By applying a robust quantitative global kinetic modeling approach to all macroscopic properties over a 210-mV range of membrane potentials, we determined that elevated external K(+) inhibits unstable closed states outside the main activation pathway and thereby promotes preferential closed-state inactivation. These results suggest the presence of a vestigial and unstable P/C-type mechanism of inactivation in Kv4 channels and strengthen the concept of novel mechanisms of closed-state inactivation. Regulation of Kv4 channel inactivation by hyperkalemia may help to explain the pathophysiology of electrolyte imbalances in excitable tissues.

Fleas parasitizing domestic dogs in Spain.

In addition to their importance to veterinary clinical practice as ectoparasites, fleas of domestic dogs are of special concern because they can be vectors of disease, including zoonoses. Flea assemblages parasitizing domestic dogs usually comprise several flea species whose distribution is determined by factors acting at several scales. Knowledge of these factors will aid in assessment of the distribution patterns of flea parasitism, and is an important tool in developing control strategies and in evaluation of flea-borne disease risk in dogs and humans. In this survey we used data from 744 domestic dogs from 79 localities in Spain to explore the associations between the abundance of flea species, host-dependent factors (sex and age), and host habitat factors including abode (farm, house with garden, apartment), location (urban or rural), the presence of other pets, and dog activity (measured as the frequency with which dogs left their abode). We also considered environmental factors including the time of year and mean annual temperature and rainfall. Variations in flea community structure at infracommunity and component community levels were also explored. Four flea species were found parasitizing dogs. Ctenocephalides felis was the most abundant (88.02% of fleas identified), followed by Ctenocephalides canis (10.38%), Pulex irritans (1.47%) and Echidnophaga gallinacea (0.13%). Overall flea abundance was higher on dogs living on farms than in apartments, as was the abundance of Ct. felis, Ct. canis and P. irritans. Ct. felis was more abundant on dogs living in houses than in apartments, but the reverse was found for P. irritans. Overall flea abundance and Ct. canis abundance were highest in rural areas, whereas the presence of other pets sharing the abode was associated with higher overall flea abundance and Ct. felis abundance. Only P. irritans abundance was positively related to the activity of dogs. Ct. canis and P. irritans abundances were higher during the warm period of the year. Mean annual temperature was negatively correlated with overall, Ct. canis and P. irritans abundances, but positively related to Ct. felis abundance. Annual rainfall was negatively correlated with Ct. canis and P. irritans abundances. Variations in the number of flea species found on a dog reflected the abundance distribution patterns for each species and their associations with host habitat and environmental factors. At the component community level, flea species richness was inversely related to annual mean temperature. The structure of flea assemblages on dogs was mainly associated with host habitat and environmental variables, and not with host-dependent variables. However, a large amount of variation in flea abundance remained unexplained, suggesting the effect of other non-controlled factors.

Sedative and cardiorespiratory effects of low doses of xylazine with and without acepromazine in Nordestino donkeys.

BACKGROUND: Information on appropriate protocols for sedation of Nordestino donkeys is scarce. OBJECTIVES: To evaluate the sedative and cardiorespiratory effects of low doses of intravenous (i.v.) xylazine with and without acepromazine in 'Nordestino' donkeys. STUDY DESIGN: Seven healthy female Nordestino donkeys (150 ± 18 kg) were included in this blinded, randomised, crossover experiment. METHODS: Four treatments were administered, consisting of two i.v. injections, at baseline (T0, 1st injection) and 15 min later (T15, 2nd injection). Treatments included acepromazine 0.05 mg/kg bwt + saline (AS), saline + xylazine 0.5 mg/kg bwt (SX0.5), acepromazine + xylazine 0.25 mg/kg bwt (AX0.25) or acepromazine + xylazine 0.5 mg/kg bwt (AX0.5). Sedative and cardiorespiratory parameters were evaluated before T0 and 15, 20, 30, 45, 60, 75 and 90 min after treatment. Degree [height of head above ground (HHAG)] and quality of sedation [ataxia, responses to stimuli and visual analogue scale (VAS) scoring] and respiratory rate were evaluated by the main investigator in situ, and heart rate was measured by an assistant investigator. Three experienced evaluators assessed vídeos for ataxia and responses to stimuli. Normal data were analysed by repeated measures ANOVA, and non-normal by Kruskal-Wallis (P<0.05). RESULTS: HHAG was lower than baseline for 15 min after xylazine administration in AX0.25 and for 30 min in SX0.5 and AX0.5 groups. All treatments with xylazine increased VAS and ataxia scores in situ for 15 min after xylazine administration, with no differences between groups. Ataxia scores in situ were higher in SX0.5 and AX0.5 groups than AS for 15 and 30 min after xylazine administration, respectively. MAIN LIMITATIONS: Absence of a negative control group (saline-saline). CONCLUSION: Acepromazine added to xylazine at 0.25 mg/kg bwt produced briefer and milder sedation than xylazine at 0.5 mg/kg bwt.

Moringa plants: Bioactive compounds and promising applications in food products.

Moringa plants have an extensive range of bioactive compounds that can be obtained from different vegetative structures, such as leaves, seeds, stems and pod husks. These bioactive molecules include carbohydrates, phenolic compounds, oils and fatty acids, proteins and functional peptides and have great potential to be used in several formulations of food products. This report collects recent information concerning bioactive molecules in other species of the Moringaceae family, different from Moringa oleifera. Thus, this document aims to describe these bioactive compounds and their functional properties on foodstuffs. In addition, more suitable methodologies applied for their extraction and characterization are reviewed. Finally, an overview of patents required to protect Moringa-derived products and processes is provided.

Development and validation of a new Spanish instrument to measure health-related quality of life in patients with allergic rhinitis: the ESPRINT questionnaire.

OBJECTIVES: To develop and validate an instrument to measure health-related quality of life (HRQOL) specific to patients with allergic rhinitis (AR) and primarily for use in Spanish and Spanish-speaking populations. METHODS: An initial item pool was generated from literature review, focus groups with AR patients, and consultations with clinical experts. Item reduction was performed using clinimetric and psychometric approaches after administration of the item pool to 400 AR patients. The resulting instrument's internal consistency, test-retest (2-4 weeks) reliability, known groups and convergent validity, and sensitivity to change were tested in a longitudinal, observational, multicenter study in 210 AR patients who also completed the Rhinoconjunctivitis Quality of Life Questionnaire (RQLQ). RESULTS: The new questionnaire took a mean (SD) of 7.1 (5.4) minutes to answer. Floor and ceiling effects were less than 15% on all dimensions. Cronbach's alpha values and intraclass correlation coefficient values for six of the sevendimensions and the overall score exceeded 0.70. Statistically significant differences (P < 0.01) were observed on all ESPRINT-28 dimensions and the overall score between patients with mild (mean overall score 1.97, SD 0.99), moderate (mean overall score 2.78, SD 0.88), and severe AR (mean overall score 3.89, SD 0.87). Patients with persistent AR had worse scores (P < 0.05) on all dimensions than patients with intermittent AR. Correlations between the ESPRINT-28 and the RQLQ were generally as expected. Effect sizes for score changes between the two study visits ranged from 0.96 to 1.76 for individual dimensions and the overall score. CONCLUSIONS: This new, Spanish-developed instrument to measure HRQOL in AR patients has shown good reliability, validity, and sensitivity to change. It has also proved easy to use and administer.

First Report of Tomato golden mottle virus on Lycopersicon esculentum and Solanum rostratum in Mexico.

The Rioverde Valley is an important farming area of the San Luis Potosi State in the north-central region of Mexico, where a variety of horticultural crops (i.e., tomato, pepper, cucumber, and watermelon) are annually cultivated. In the summer of 2005, a number of plants exhibiting a variety of symptoms, including leaf yellowing, curling, and stunted growth, were observed in several tomato (Lycopersicon esculentum L.) fields. The presence of whiteflies (Bemisia tabaci Genn.) and symptoms seemed to suggest a begomoviral etiology. Leaves of 12 symptomatic tomato plants and seven plants of the weed Solanum rostratum (Dunal) growing into the same area were collected in July and September from several fields throughout the Rioverde area and assessed for the presence of begomoviruses (genus Begomovirus, family Geminiviridae) by PCR using the degenerate primers prRepDGR (CCTCCTCTAGCASWTCTNCCGTC), SL2050 (2), and prC889 (3). Amplicons of 1.4 kb were derived from viral DNA-A present in all examined S. rostratum and tomato samples, which were cloned into pGEM-T Easy Vector (Promega, Madison, WI) and subsequently analyzed by restriction fragment length polymorphism (RFLP) using MspI and HinfI. Several restriction fragment patterns were observed among the cloned PCR products, hence indicating the occurrence of different begomoviruses in the sampled fields. Sequencing of amplicons derived from one S. rostratum plant revealed the concurrent presence of Tomato severe leaf curl virus (ToSLCV; GenBank Accession No. DQ347946; [2]) and a distinct virus (GenBank Accession No. EF501978) displaying a high sequence identity with Tomato golden mottle virus from Guatemala (ToGMoV-GT94-R2; GenBank Accession No. AF32852). Restriction fragment patterns identical to that of the ToGMoV-like isolate were found in PCR clones from three additional S. rostratum plants and five tomato samples. A set of partially overlapping PCR products of 1.8 and 1.4 kb encompassing the complete DNA-A component of ToGMoV were obtained from one tomato sample by using two pairs of degenerate primers, prRepQGR-rev and prCP70 (1) and prRepDGR and prC889. Amplicons were cloned, sequenced, and compared with viral sequences available in the GenBank database using BlastN and Clustal V alignments (MegAlign, DNASTAR, Madison, WI). The 2,614-bp DNA-A sequence of the Rioverde isolate (GenBank Accession No. DQ520943) displays 93% sequence identity with the Guatemalan isolate of ToGMoV. In addition, a number of B. tabaci specimens of unidentified biotype were collected in one tomato field and total DNA was isolated from them by a modified Dellaporta method. Amplification of viral DNA present in the whiteflies was carried out and the PCR products were cloned and sequenced. One of the begomoviral DNA-A genomes isolated from the whiteflies (GenBank Accession No. EF501976) displayed 99% sequence identity with the virus isolated from plants. Previously, ToGMoV had been found only in Central America ( http://gemini.biosci.arizona.edu/viruses ), but this report considerably expands its known geographical distribution. References: (1) R. De La Torre-Almaraz et al. Plant Dis. 90:378, 2006. (2) J. A. Mauricio-Castillo et al. Plant Dis. 90:1116, 2006. (3) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

Isolation and development of haematopoietic progenitor cells from peripheral blood of adult and newborn pigs.

Pluripotent stem cells (PSCs), already described in human beings, are fibroblast-like cells that exhibit a CD34 marker specific for haematopoietic stem cells. In this work we have demonstrated the presence of PSCs in the peripheral blood of pigs, a species frequently used in transplantation studies as an animal model for human diseases. Differentiation into haematopoietic colonies (granulomacrophagic colonies, erythroid colonies and mixed colonies) has been carried out with the peripheral blood of adult and newborn pigs, using solely human commercial media. Peripheral blood mononuclear cells (PBMNCs) were cultured in semisolid methylcellulose based media enriched with recombinant human cytokines, achieving granulomacrophagic-colony forming unit (GM-CFU) and mixed-colony forming unit (Mix-CFU) growth with erythroblastic lineage proliferation in the presence of erythropoietin (Epo). In all the samples CFU growth was associated with the presence of recombinant human cytokine. No evidence of proliferation in control plates without cytokines was found. From liquid medium culture, a population of macrophages and CD34+ fibroblast like cells were retrieved 21 days after sowing. These findings allow us to think about the direct application of this simple and standardised method in several work fields such as the study of pharmacological effects of many drugs over the haematopoietic line and in the study of new strategies in cellular therapy for some human diseases.