An in vitro model of early islet amyloid polypeptide (IAPP) fibrillogenesis using human IAPP-transgenic mouse islets.

The mechanisms underlying insufficient insulin secretion and loss of beta-cell mass in feline and human type 2 diabetes mellitus are incompletely understood. However, islet amyloid polypeptide (IAPP)-derived islet amyloidosis (IA) has been linked to increased rates of beta-cell apoptosis and, therefore, our goal was to develop an in vitro model of IAPP fibrillogenesis using isolated pancreatic islets from mice transgenic for human IAPP (hIAPP Tg mice). Islets from hIAPP Tg mice, from mice transgenic for non-amyloidogenic murine IAPP (mIAPP Tg mice), and from the FVB background strain were exposed to normal (5.5 mM) or high (28 mM) glucose conditions in cell culture for 8 days. On days 0 and 8, islets were collected for electron microscopy (EM). EM showed no abnormalities in the mIAPP Tg or FVB islets at either time point. On day 8, hIAPP Tg islets cultured at high glucose concentration formed extracellular IAPP-derived flocculent deposits. No significant differences in rates of apoptosis were found between groups. Our findings, therefore, show that in vitro culture of hIAPP Tg mouse islets under high glucose conditions produces a readily available and rapidly inducible model of IAPP-derived fibrillogenesis and enables the study of early phases of the molecular pathogenesis of IA.

Naturally occurring reticuloendotheliosis in turkeys: transmission.

This report describes the natural occurrence and experimental transmission of reticuloendotheliosis in a turkey flock. In the naturally affected turkeys, lesions were present in the liver, spleen, heart, intestines, and peripheral nerves, and were composed mainly of lymphoreticular cells. The disease was experimentally reproduced in turkey poults with cellfree tissue extracts of infected birds. A type-C RNA virus similar to reticuloendotheliosis virus (strain T) was present in the tissues of turkey poults experimentally inoculated. This virus was unrelated to the type-C RNA viruses of the avian leukosis sarcoma complex.

Etiological factors, stages, and the role of the foreign body in foreign body tumorigenesis: a review.

Attempts were made to analyze the process of foreign body (FB) tumorigenesis and to identify etiologically significant factors by correlating information in the literature and recent experimental data from our labroatory. It appears that the process of FB tumorigenesis is dependent on sequence of specific conditions as expressed by the following criteria: (a) cellular proliferation and tissue infiltration during acute FB reaction; (b) fibrosis of the tissue capsule surrounding the FB; (c) quiescence of the tissue reaction, i. e., dormancy and phagocytic inactivity of FB-attached macrophages; and (d) availability of a FB surface for direct contact with clonal preneoplastic cells. There is no indication that the initial acquisition of neoplastic potential and the determination of specific tumor characteristics are based on direct physical or chemical reaction between cells and the FB. These etiological key events occur presumably in mesenchymal stem cells associated with the microvasculature no later than during the acute stage of FB reaction and certainly long before clonal descendants of these cells are first found in contact with the FB surface. In fact, there is no reason to assume that cells with neoplastic determination may be present in normal tissue prior to the introduction of a FB and that the FB would only create the conditions required for stepwise preneoplastic maturation.

Islet amyloid polypeptide and insulin secretion from isolated perfused pancreas of fed, fasted, glucose-treated, and dexamethasone-treated rats.

Rats from four experimental treatment groups, including fed controls, 24- to 30-h fasted, dexamethasone-treated, and intraperitoneal glucose-treated, were used to assess the effects of these treatments on the immunohistochemically detectable islet amyloid polypeptide (IAPP) content in the pancreatic islets. Isolated perfused pancreases from additional animals in these groups were used to assess insulin and IAPP secretion and relative amounts of these hormones secreted into the perfusate under low-glucose (2.75 mM) and high-glucose (16.7 mM) conditions. Insulin and IAPP concentrations in the perfusate were measured by radioimmunoassays. Titration of immunohistochemical staining revealed the highest levels of IAPP in the dexamethasone- and glucose-treated groups, followed by the fed controls; the least amount was observed in the fasted group. In the perfusion experiments, the dexamethasone-treated group had significantly higher IAPP secretion than did all of the other groups under stimulation with 16.7 mM glucose. In addition, both dexamethasone treatment and glucose treatment increased the relative amount of IAPP to insulin secretion during 16.7 mM glucose stimulation in comparison with fed controls and fasted groups. Fasting tended to have the opposite effect and significantly decreased the relative amount of IAPP to insulin secreted under stimulation with 16.7 mM glucose. In all groups, IAPP and insulin secretion were generally parallel, which is consistent with their colocalization in the beta-cell secretory vesicle and co-release after glucose stimulation. However, significant differences in the insulin-IAPP ratios between experimental groups is consistent with the hypothesis that production of IAPP and insulin are regulated differently in the beta-cell.(ABSTRACT TRUNCATED AT 250 WORDS)

Newly identified pancreatic protein islet amyloid polypeptide. What is its relationship to diabetes?

Islet amyloid polypeptide (IAPP) or amylin is a newly identified 37-amino acid COOH-terminal-amidated polypeptide that is the major protein constituent of amyloid deposits in insulinomas and amyloid deposits in pancreatic islets of non-insulin-dependent (type II) diabetic humans and adult diabetic cats. IAPP is stored with insulin in beta-cell secretory vesicles and is cosecreted with insulin in response to glucose and several secretagogues. IAPP has been demonstrated in normal pancreatic islets of many species, but IAPP-derived amyloid develops commonly in the islets of only a few species (e.g., humans and cats), especially in association with age-related diabetes. IAPP from the human and cat inherently contains a short amyloidogenic sequence that is not present in species that do not form islet amyloid. Studies in animals indicate that an aberration in the synthesis or processing of IAPP, leading to a local increase in concentration of IAPP in the islet, is also required to facilitate the conversion of IAPP to amyloid. The formation of islet amyloid may contribute to the development of type II diabetes by causing disruption of islet cells and by replacement of islets. It has also been proposed that an abnormality of IAPP homeostasis underlies the pathogenesis of type II diabetes. A significant causal relationship between IAPP and type II diabetes is based on reports that IAPP inhibits glucose-stimulated insulin release by beta-cells and that IAPP inhibits insulin-stimulated rates of glycogen synthesis and glucose uptake by skeletal muscle cells.(ABSTRACT TRUNCATED AT 250 WORDS)

Islet amyloid polypeptide in human insulinomas. Evidence for intracellular amyloidogenesis.

Amyloid deposits that characteristically form in the pancreatic islets of patients with non-insulin-dependent diabetes mellitus (NIDDM) and in insulinomas are both derived from islet amyloid polypeptide (IAPP). Evidence from previous studies has suggested that deposition of IAPP-derived amyloid is related to inherent amyloidogenic sequences present within normal human IAPP, together with an increased production and local concentration of IAPP. However, whether the aggregation of IAPP to form amyloid fibrils is primarily an intra- or extracellular event is not clear. To address this question, we studied 20 human insulinomas by light and electron microscopy. By light microscopy, amyloid deposits were demonstrated in 13 of 20 (65%) human insulinomas. Furthermore, evaluation of Congo red-stained tumor sections showed small, globular or irregular, congophilic amyloid deposits within the cytoplasm of many tumor cells in 10 of 13 (77%) amyloid-containing insulinomas. Dense, punctate areas of IAPP immunoreactivity within tumor cells corresponded with the congophilic intracellular deposits. Ubiquitin immunoreactivity also was observed as punctate intracellular labeling and within large extracellular amyloid deposits. Among the 10 insulinomas available for electron microscopic evaluation, pathological IAPP-immunoreactive (immunogold) deposits were found in 3 of 5 insulinomas in which amyloid was demonstrated by light microscopy and in none of 5 tumors found negative for amyloid by light microscopy. Morphology of IAPP-immunoreactive deposits varied from those with the classical distinct 7- to 10-nm diameter nonbranching fibrils to those with distinct but faint fibrillarity to those without discernable fibrils.(ABSTRACT TRUNCATED AT 250 WORDS)

Structure of cat islet amyloid polypeptide and identification of amino acid residues of potential significance for islet amyloid formation.

Cats and humans, unlike most rodent species, develop amyloid in the islets of Langerhans in conjunction with non-insulin-dependent diabetes mellitus. The amyloid consists of a 37-amino acid polypeptide referred to as islet amyloid polypeptide (IAPP). The primary structures of IAPP from human and three rodent species have previously been determined. Sequence divergence was seen in the region corresponding to amino acid residues 20-29, which in human IAPP has been suggested to confer the amyloidogenic properties to the molecule. Using polymerase chain-reaction methodology, we determined the primary sequence of cat IAPP. Amino acid region 20-29 shows specific similarities and differences compared with human and rodent IAPP, respectively. A synthetic cat IAPP20-29 decapeptide formed amyloid fibrils spontaneously in vitro. Comparison between the structure and amyloid fibril-forming activity of various synthetic peptides suggests that the amino acid residues at positions 25-26 in mature IAPP are important for the amyloidogenic properties of the molecule.

A beta-associated cerebral angiopathy and senile plaques with neurofibrillary tangles and cerebral hemorrhage in an aged wolverine (Gulo gulo).

In this study of an aged wolverine (Gulo gulo), we document neuropathologic lesions (cerebral amyloid angiopathy (CAA), neuritic plaques (NPs), neurofibrillary tangles (NFTs), and granulovacuolar degeneration strikingly similar to those present in aging and Alzheimer's disease (AD), with the additional finding of concurrent cerebral hemorrhage. A beta immunoreactive cerebral amyloid angiopathy and senile plaques (neuritic and diffuse) were present throughout the cerebral cortex and hippocampus. Ubiquitin immunoreactivity was noted in peripheral portions of some of the plaques. Argyrophilic intracellular neurofibrillary tangles containing abnormally phosphorylated (Ser 202) tau protein were present within cortical and hippocampal neurons. The wolverine should be added to the list of nonhuman species (dogs, nonhuman primates, polar bears) with amyloid deposits similar to those in aged humans and in humans with AD. The aged wolverine appears to be distinct from other nonhuman species in possessing plaques and NFTs, as well as other histologic cerebral lesions frequently associated with AD.

Sequence divergence in a specific region of islet amyloid polypeptide (IAPP) explains differences in islet amyloid formation between species.

Amyloid deposits in the islets of Langerhans occur in association with type 2 diabetes mellitus (DM) in humans and cats and consist of a 37-amino-acid polypeptide known as islet amyloid polypeptide (IAPP). In order to find an explanation for the situation that islet amyloid (IA) does not develop in common rodent species, we have deduced the amino acid sequence of the IAPP molecule in mouse, rat and hamster. We find that a specific region of the molecule diverges to a high degree. Synthetic peptides corresponding to this region of human and hamster IAPP were compared for their ability to form amyloid fibrils in vitro. Whereas the human peptide readily formed fibrils with amyloid character, the hamster peptide completely lacked this property. We suggest this to be a likely explanation for the differences in IA formation between humans and rodents and discuss our findings in relation to the type 2 DM syndrome.

Absorption and circular dichroism spectroscopy of nucleic acid duplexes and triplexes.

Absorption and CD measurements of complementary oligomers and mixtures are described. The concentrations of oligomers may be estimated from absorption measurements and nearest-neighbor calculations of molar extinction coefficients. Interactions between complementary strands in mixtures can lead to obvious differences between measured CD spectra and the average of the spectra of the individual strands. CD spectra also allow an assessment of whether the individual strands are in self-complexes, which could compete with duplex or triplex formation. Isodichroic and isoabsorptive points provide important indicators of the stoichiometry of the strands in base-paired complexes. CD spectra provide an important means of characterizing differences in the conformations of DNA, RNA, and hybrid duplexes or triplexes having analogous sequences.

Unusual vascular findings in transplanted kidneys.

Of 189 unsuccessful renal transplant cases, eight were selected for retrospective analysis because they had been classified histologically as "chronic rejection with marked vascular changes" even though they had been removed less than 60 days after transplantation. Review of these cases revealed that only one of the eight transplants had postoperative function and that this transplant had only marginal functions. All eight kidneys had intimal damage that was unlike the usual lesions of rejection. Five kidneys showed evidence of thrombosis with recanalization, and five had what appeared to be a double layer of the intima. The findings in eight cases suggest that severe intimal damage occurred within 60 days of implantation and may not represent the usual rejection processes; it may reflect, in part, damage to the intima prior to or during implantation.

Quantitative immunohistochemical analysis of islet amyloid polypeptide (IAPP) in normal, impaired glucose tolerant, and diabetic cats.

Islet amyloid polypeptide (IAPP, "amylin") has been proposed as having important roles in the pathogenesis of type 2 diabetes mellitus via its biological activity and by forming islet amyloid. The domestic cat develops a type of diabetes that closely resembles type 2 diabetes in humans, including the frequent formation of islet amyloid deposits in the impaired glucose tolerant (IGT) and diabetic state. With the aid of computerized image analysis and immunohistochemistry, we examined the IAPP and insulin content in pancreatic islets of normal, IGT and diabetic cats. IAPP immunoreactivity in beta cells from IGT cats was significantly stronger (p < 0.01) as compared with cells from normal cats, while the insulin labelling strength was unchanged. Overtly diabetic cats were usually almost devoid of beta cells. As in humans, cellular IAPP but not IAPP in islet amyloid deposits was labelled by the newly developed monoclonal antibody to IAPP 4A5, thus providing further evidence that IAPP is modified by a yet unknown mechanism during the amyloidogenic process. The study provides evidence that an increased beta cell storage of IAPP independent of insulin may be an important factor in the early phase of the development of islet amyloid in this form of diabetes.

Effects of bacterial endotoxin on protecting copper-deficient rats from hyperoxia.

The administration of very low doses of bacterial endotoxin protects rats during exposure to hyperoxia and is associated with the induction of lung antioxidant enzyme activities. Copper-deficient rats have increased susceptibility to O2 toxicity, which may be related to their decreased lung superoxide dismutase activity (SOD) or decreased plasma ceruloplasmin concentrations. To determine whether endotoxin can protect against hyperoxia in this susceptible model, we exposed copper-deficient and control rats to a fractional inspiratory concentration of O2 greater than 0.95 for 96 h after pretreatment with 500 micrograms/kg of bacterial endotoxin or phosphate-buffered saline (PBS). Mortality in the copper-deficient and control rats given PBS and exposed to O2 for 96 h was 100%. Copper-deficient rats died significantly earlier during the exposure than controls. No mortality occurred in either group treated with endotoxin and hyperoxia despite the decreased activity of copper-dependent enzymes in the copper-deficient rats. Copper-deficient rats treated with endotoxin and exposed to hyperoxia did increase lung Cu-Zn-SOD activity, but activity remained below levels found in air-exposed controls. Mn-SOD activity was found to be induced above air-exposed controls in the copper-deficient rats treated with endotoxin and exposed to hyperoxia. Hyperoxic exposure resulted in a marked increase in plasma ceruloplasmin concentrations in the control rats, but no increases in ceruloplasmin occurred in the copper-deficient animals. Endotoxin protects copper-deficient rats from hyperoxia despite their decreased lung Cu-Zn-SOD activity, and decreased plasma ceruloplasmin.

Rat lung glutathione release: response to oxidative stress and selenium deficiency.

We performed experiments to characterize the glutathione-dependent metabolism occurring during tert-butyl hydroperoxide infusion in isolated perfused rat lungs and to examine the effect of selenium deficiency on this metabolism. Selenium deficiency resulted in decreased lung glutathione peroxidase activity but normal glutathione reductase activity and glutathione content. Infusion of the hydroperoxide into control lungs caused a proportional increase in tissue glutathione disulfide (GSSG) concentration and release of GSSG into the perfusate up to an infusion rate of 250 nmol of tert-butyl hydroperoxide X min-1 X 100 g body wt-1. Infusion rates greater than this resulted in continued rise of tissue GSSG concentrations but GSSG release into the perfusate plateaued. Infusion of tert-butyl hydroperoxide into selenium-deficient rat lungs resulted in much lower concentrations of tissue GSSG and GSSG release into the perfusate; however, release in the selenium-deficient rat lung was also found to be saturable at infusion rates of 450 nmol of tert-butyl hydroperoxide X min-1 X 100 g of body wt-1. Selenium deficiency in the rat decreases the rate of reduction of infused tert-butyl hydroperoxide by glutathione and may predispose the lung to free radical damage.

Islet amyloid polypeptide (IAPP) competes for two binding sites of CGRP.

Two distinct binding sites for [125I]human calcitonin gene-related peptide (hCGRP) were found in rat brain, skeletal muscle, and liver. Each tissue had a high affinity site with an average Kd of 46 pM and a low affinity site with an average Kd of 22 nM. Islet amyloid polypeptide (IAPP), which has N- and C-terminal sequence homology to CGRP and is produced by islet beta-cells, bound to both sites but had a potency closer to that of CGRP at the low affinity binding site. A C-terminal fragment of IAPP competed for [125I]hCGRP binding at the low affinity site with potency comparable to that of hIAPP. No specific binding to membrane preparations was found in experiments using [125I]rIAPP, which was iodinated at the C-terminal tyrosyl residue. These results suggest that some of the previously reported biological effects occurring at nM or microM concentrations of IAPP may be mediated by IAPP binding to low affinity CGRP receptors. This study further indicates that the C-terminal region of IAPP is important for binding to low affinity CGRP receptors, and suggests that C-terminal fragments of IAPP may be of biological importance.

Islet amyloid polypeptide (IAPP) and pro-IAPP immunoreactivity in human islets of Langerhans.

Islet amyloid polypeptide (IAPP) is a 37-amino-acid putative hormone which is expressed by islet B-cells and most probably is co-released with insulin. IAPP is synthesized as an 89-amino-acid prepropeptide in which IAPP is flanked by two short peptides. The two short peptides are ultimately cleaved off at basic residues. In the present study, we used antisera to three different synthetic peptides corresponding to positions 18-30, 40-50 and 53-62 of prepro-IAPP. The two latter peptides fall within the mature IAPP molecule while the first peptide corresponds to the N-terminal flanking peptide. We demonstrate that normal B-cells and islet amyloid both react immunohistochemically with all of these antisera. Using the immunogold labelling technique, we also demonstrate electron microscopically that both the IAPP immunoreactivity and the pro1-IAPP immunoreactivity in amyloid deposits are confined to the amyloid fibrils per se. These data indicate that not only mature IAPP but also the N-terminal flanking peptide is present in islet amyloid deposits. It remains to be shown if the propeptide segments are involved in the pathogenesis of these amyloid depositions.

Analysis of an RNA pseudoknot structure by CD spectroscopy.

The RNA PK5 (GCGAUUUCUGACCGCUUUUUUGUCAG) forms a pseudoknotted structure at low temperatures and a hairpin containing an A.C opposition at higher temperatures (J. Mol. Biol. 214, 455-470 (1990)). CD and absorption spectra of PK5 were measured at several temperatures. A basis set of spectra were fit to the spectra of PK5 using a method that can provide estimates of the numbers of A.U, G.C, and G.U base pairs as well as the number of each of 11 nearest-neighbor base pairs in an RNA (Biopolymers 31, 373-384 (1991)). The fits were close, indicating that PK5 retained the A conformation in the pseudoknot structure and that the fitting technique is not hindered by pseudoknots or A.C oppositions. The results from the analysis were consistent with the pseudoknotted structure at low temperatures and with the hairpin structure at higher temperatures. We concluded that the method of spectral analysis should be useful for determining the secondary structures of other RNAs containing pseudoknots and A.C oppositions.

Membranous nephropathy in a renal allograft. Its occurrence in a patient with previous anti-glomerular basement membrane disease.

Glomerulonephritis (GN) in transplant recipients has been attributed to recurrent as well as de novo disease. Although GN is thought to be common in renal allografts, few documented cases of de novo membranous GN in renal allografts have been reported. To our knowledge, this is the second reported case of membranous nephropathy of a renal allograft in a patient whose original disease was anti-glomerular basement membrane disease.

Amyloidosis in a case of canine systemic lupus erythematosus.

Concurrent systemic lupus erythematosus (SLE) and amyloidosis (renal and splenic) are reported in a 7-year-old female miniature Schnauzer. Treatment of tissue sections with potassium permanganate and dilute sulphuric acid prior to staining with Congo red indicated that the amyloid in this case is composed of AA protein (i.e. reactive systemic amyloid or so-called secondary amyloid). The rare association of amyloidosis and SLE, in both man and the dog, and the association with granulomatous pneumonia and leukopenia in this case are discussed.