ATM-dependent phosphorylation of nibrin in response to radiation exposure.

Mutations in the gene ATM are responsible for the genetic disorder ataxia-telangiectasia (A-T), which is characterized by cerebellar dysfunction, radiosensitivity, chromosomal instability and cancer predisposition. Both the A-T phenotype and the similarity of the ATM protein to other DNA-damage sensors suggests a role for ATM in biochemical pathways involved in the recognition, signalling and repair of DNA double-strand breaks (DSBs). There are strong parallels between the pattern of radiosensitivity, chromosomal instability and cancer predisposition in A-T patients and that in patients with Nijmegen breakage syndrome (NBS). The protein defective in NBS, nibrin (encoded by NBS1), forms a complex with MRE11 and RAD50 (refs 1,2). This complex localizes to DSBs within 30 minutes after cellular exposure to ionizing radiation (IR) and is observed in brightly staining nuclear foci after a longer period of time. The overlap between clinical and cellular phenotypes in A-T and NBS suggests that ATM and nibrin may function in the same biochemical pathway. Here we demonstrate that nibrin is phosphorylated within one hour of treatment of cells with IR. This response is abrogated in A-T cells that either do not express ATM protein or express near full-length mutant protein. We also show that ATM physically interacts with and phosphorylates nibrin on serine 343 both in vivo and in vitro. Phosphorylation of this site appears to be functionally important because mutated nibrin (S343A) does not completely complement radiosensitivity in NBS cells. ATM phosphorylation of nibrin does not affect nibrin-MRE11-RAD50 association as revealed by radiation-induced foci formation. Our data provide a biochemical explanation for the similarity in phenotype between A-T and NBS.

ATM associates with and phosphorylates p53: mapping the region of interaction.

The human genetic disorder ataxia-telangiectasia (AT) is characterized by immunodeficiency, progressive cerebellar ataxia, radiosensitivity, cell cycle checkpoint defects and cancer predisposition. The gene mutated in this syndrome, ATM (for AT mutated), encodes a protein containing a phosphatidyl-inositol 3-kinase (PI-3 kinase)-like domain. ATM also contains a proline-rich region and a leucine zipper, both of which implicate this protein in signal transduction. The proline-rich region has been shown to bind to the SH3 domain of c-Abl, which facilitates its phosphorylation and activation by ATM. Previous results have demonstrated that AT cells are defective in the G1/S checkpoint activated after radiation damage and that this defect is attributable to a defective p53 signal transduction pathway. We report here direct interaction between ATM and p53 involving two regions in ATM, one at the amino terminus and the other at the carboxy terminus, corresponding to the PI-3 kinase domain. Recombinant ATM protein phosphorylates p53 on serine 15 near the N terminus. Furthermore, ectopic expression of ATM in AT cells restores normal ionizing radiation (IR)-induced phosphorylation of p53, whereas expression of ATM antisense RNA in control cells abrogates the rapid IR-induced phosphorylation of p53 on serine 15. These results demonstrate that ATM can bind p53 directly and is responsible for its serine 15 phosphorylation, thereby contributing to the activation and stabilization of p53 during the IR-induced DNA damage response.

Vaccine-induced cytotoxic T lymphocytes protect against retroviral challenge.

The development of prophylactic vaccines against retroviral diseases has been impeded by the lack of obvious immune correlates for protection. Cytotoxic T-lymphocyte (CTL), CD4-lymphocyteS, chemokine and/or antibody responses have all been associated with protection against HIV and AIDS; however, effective and safe vaccination strategies remain elusive. Here we show that vaccination with a minimal ovine CTL peptide epitope identified within gp51 of the retrovirus bovine leukemia virus (BLV), consistently induced peptide-specific CTLs. Only sheep whose CTLs were also capable of recognizing retrovirus-infected cells were fully protected when challenged with BLV. This retrovirus displays limited sequence variation; thus, in the relative absence of confounding CTL escape variants, virus-specific CTLs targeting a single epitope were able to prevent the establishment of a latent retroviral infection.

An anaplerotic approach to correct the mitochondrial dysfunction in ataxia-telangiectasia (A-T).

BACKGROUND: ATM, the protein defective in the human genetic disorder, ataxia-telangiectasia (A-T) plays a central role in response to DNA double-strand breaks (DSBs) and in protecting the cell against oxidative stress. We showed that A-T cells are hypersensitive to metabolic stress which can be accounted for by a failure to exhibit efficient endoplasmic reticulum (ER)-mitochondrial signalling and Ca2+ transfer in response to nutrient deprivation resulting in mitochondrial dysfunction. The objective of the current study is to use an anaplerotic approach using the fatty acid, heptanoate (C7), a metabolic product of the triglyceride, triheptanoin to correct the defect in ER-mitochondrial signalling and enhance cell survival of A-T cells in response to metabolic stress. METHODS: We treated control cells and A-T cells with the anaplerotic agent, heptanoate to determine their sensitivity to metabolic stress induced by inhibition of glycolysis with 2- deoxyglucose (2DG) using live-cell imaging to monitor cell survival for 72 h using the Incucyte system. We examined ER-mitochondrial signalling in A-T cells exposed to metabolic stress using a suite of techniques including immunofluorescence staining of Grp75, ER-mitochondrial Ca2+ channel, the VAPB-PTPIP51 ER-mitochondrial tether complexes as well as proximity ligation assays between Grp75-IP3R1 and VAPB1-PTPIP51 to establish a functional interaction between ER and mitochondria. Finally, we also performed metabolomic analysis using LC-MS/MS assay to determine altered levels of TCA intermediates A-T cells compared to healthy control cells. RESULTS: We demonstrate that heptanoate corrects all aspects of the defective ER-mitochondrial signalling observed in A-T cells. Heptanoate enhances ER-mitochondrial contacts; increases the flow of calcium from the ER to the mitochondrion; restores normal mitochondrial function and mitophagy and increases the resistance of ATM-deficient cells and cells from A-T patients to metabolic stress-induced killing. The defect in mitochondrial function in ATM-deficient cells was accompanied by more reliance on aerobic glycolysis as shown by increased lactate dehydrogenase A (LDHA), accumulation of lactate, and reduced levels of both acetyl CoA and ATP which are all restored by heptanoate. CONCLUSIONS: We conclude that heptanoate corrects metabolic stress in A-T cells by restoring ER-mitochondria signalling and mitochondrial function and suggest that the parent compound, triheptanoin, has immense potential as a novel therapeutic agent for patients with A-T.

T cell-T cell killing is induced by specific epitopes: evidence for an apoptotic mechanism.

Epstein-Barr virus-specific cytotoxic T lymphocyte clones were shown to be an effective target for their own lysis when incubated in the presence of their specific epitopes but not in the presence of irrelevant epitopes. The mode of cell killing appeared to be by apoptosis and was prevented by previously described inhibitors of the process. Degranulation, as measured by serine esterase activity, was involved in this form of T cell-T cell killing. This is the first report of T cell-T cell killing by apoptosis and is only observed in the presence of a specific epitope. This result may be of significance in the use of peptide-based vaccines.

Interleukin-1 beta-converting enzyme-like protease cleaves DNA-dependent protein kinase in cytotoxic T cell killing.

Cytotoxic T cells (CTL) represent the major defense mechanism against the spread of virus infection. It is believed that the pore-forming protein, perforin, facilitates the entry of a series of serine proteases (particularly granzyme B) into the target cell which ultimately leads to DNA fragmentation and apoptosis. We demonstrate here that during CTL-mediated cytolysis the catalytic subunit of DNA-dependent protein kinase (DNA-PKcs), an enzyme implicated in the repair of double strand breaks in DNA, is specifically cleaved by an interleukin (IL)-1 beta-converting enzyme (ICE)-like protease. A serine protease inhibitor, 3,4-dichloroisocoumarin (DCl), which is known to block granzyme B activity, inhibited CTL-induced apoptosis and prevented the degradation of DNA-PKcs in cells but failed to prevent the degradation of purified DNA-PKcs by CTL extracts. However, Tyr-Val-Ala-Asp-CH2Cl (YVAD-CMK) and other cysteine protease inhibitors prevented the degradation of purified DNA-PKcs by CTL extracts. Furthermore, incubation of DNA-PKcs with granzyme B did not produce the same cleavage pattern observed in cells undergoing apoptosis and when this substrate was incubated with either CTL extracts or the ICE-like protease, CPP32. Sequence analysis revealed that the cleavage site in DNA-PKcs during CTL killing was the same as that when this substrate was exposed to CPP32. This study demonstrates for the first time that the cleavage of DNA-PKcs in this intact cell system is exclusively due to an ICE-like protease.

A single ataxia telangiectasia gene with a product similar to PI-3 kinase.

A gene, ATM, that is mutated in the autosomal recessive disorder ataxia telangiectasia (AT) was identified by positional cloning on chromosome 11q22-23. AT is characterized by cerebellar degeneration, immunodeficiency, chromosomal instability, cancer predisposition, radiation sensitivity, and cell cycle abnormalities. The disease is genetically heterogeneous, with four complementation groups that have been suspected to represent different genes. ATM, which has a transcript of 12 kilobases, was found to be mutated in AT patients from all complementation groups, indicating that it is probably the sole gene responsible for this disorder. A partial ATM complementary DNA clone of 5.9 kilobases encoded a putative protein that is similar to several yeast and mammalian phosphatidylinositol-3' kinases that are involved in mitogenic signal transduction, meiotic recombination, and cell cycle control. The discovery of ATM should enhance understanding of AT and related syndromes and may allow the identification of AT heterozygotes, who are at increased risk of cancer.

Common evolution of waprin and kunitz-like toxin families in Australian venomous snakes.

The venoms of Australian snakes contain a myriad of pharmacologically active toxin components. This study describes the identification and comparative analysis of two distinct toxin families, the kunitztype serine protease inhibitors and waprins, and demonstrates a previously unknown evolutionary link between the two. Multiple cDNA and full-length gene isoforms were cloned and shown to be composed of three exons separated by two introns. A high degree of identity was observed solely within the first exon which coded for the propeptide sequence and its cleavage site, and indicates that each toxin family has arisen from a gene duplication event followed by diversification only within the portion of the gene coding for the functional toxin. It is proposed that while the mechanism of toxin secretion is highly conserved, diversification of mature toxin sequences allows for the existence of multiple protein isoforms in the venom to adapt to variations within the prey environment.

A novel form of ataxia oculomotor apraxia characterized by oxidative stress and apoptosis resistance.

Several different autosomal recessive genetic disorders characterized by ataxia with oculomotor apraxia (AOA) have been identified with the unifying feature of defective DNA damage recognition and/or repair. We describe here the characterization of a novel form of AOA showing increased sensitivity to agents that cause single-strand breaks (SSBs) in DNA but having no gross defect in the repair of these breaks. Evidence for the presence of residual SSBs in DNA was provided by dramatically increased levels of poly (ADP-ribose)polymerase (PARP-1) auto-poly (ADP-ribosyl)ation, the detection of increased levels of reactive oxygen/nitrogen species (ROS/RNS) and oxidative damage to DNA in the patient cells. There was also evidence for oxidative damage to proteins and lipids. Although these cells were hypersensitive to DNA damaging agents, the mode of death was not by apoptosis. These cells were also resistant to TRAIL-induced death. Consistent with these observations, failure to observe a decrease in mitochondrial membrane potential, reduced cytochrome c release and defective apoptosis-inducing factor translocation to the nucleus was observed. Apoptosis resistance and PARP-1 hyperactivation were overcome by incubating the patient's cells with antioxidants. These results provide evidence for a novel form of AOA characterized by sensitivity to DNA damaging agents, oxidative stress, PARP-1 hyperactivation but resistance to apoptosis.

Identification of claudin-4 as a marker highly overexpressed in both primary and metastatic prostate cancer.

In the quest for markers of expression and progression for prostate cancer (PCa), the majority of studies have focussed on molecular data exclusively from primary tumours. Although expression in metastases is inferred, a lack of correlation with secondary tumours potentially limits their applicability diagnostically and therapeutically. Molecular targets were identified by examining expression profiles of prostate cell lines using cDNA microarrays. Those genes identified were verified on PCa cell lines and tumour samples from both primary and secondary tumours using real-time RT-PCR, western blotting and immunohistochemistry. Claudin-4, coding for an integral membrane cell-junction protein, was the most significantly (P<0.00001) upregulated marker in both primary and metastatic tumour specimens compared with benign prostatic hyperplasia at both RNA and protein levels. In primary tumours, claudin-4 was more highly expressed in lower grade (Gleason 6) lesions than in higher grade (Gleason >or=7) cancers. Expression was prominent throughout metastases from a variety of secondary sites in fresh-frozen and formalin-fixed specimens from both androgen-intact and androgen-suppressed patients. As a result of its prominent expression in both primary and secondary PCas, together with its established role as a receptor for Clostridium perfringens enterotoxin, claudin-4 may be useful as a potential marker and therapeutic target for PCa metastases.

A novel rat model for glioblastoma multiforme using a bioluminescent F98 cell line.

In experimental neuro-oncology there remains a need for animal models that can be used to assess the efficacy of new and innovative treatment methodologies for glioblastoma multiforme (GBM). Rat models have remained the mainstay of neuro-oncology research for over 30 years; however, despite extensive experimentation, there is no one rat model that truly reflects the features of human tumours. We have developed a novel rat brain tumour model that closely resembles human GBM in biological behaviour and that utilizes bioluminescence imaging (BLI) to follow day-to-day in vivo progress of the tumour. F98 glioma cells were transfected with the firefly luciferase gene and injected orthotopically into the brains of 24 rats. Weekly BLI after subcutaneous injection of luciferin allowed for in vivo monitoring of the progress of the brain tumours. Euthanasia and histological analysis of the rodent brains at varying stages post-implantation, allowed for statistically significant correlation between tumour size and luminescence (p=0.002). The utility of this model is readily apparent, allowing us a way of examining the effects of new and novel therapeutics in these rats.

The complexity of p53 stabilization and activation.

A number of proteins are activated by stress stimuli but none so spectacularly or with the degree of complexity as the tumour suppressor p53 (human p53 gene or protein). Once stabilized, p53 is responsible for the transcriptional activation of a series of proteins involved in cell cycle control, apoptosis and senescence. This protein is present at low levels in resting cells but after exposure to DNA-damaging agents and other stress stimuli it is stabilized and activated by a series of post-translational modifications that free it from MDM2 (mouse double minute 2 but used interchangeably to denote human also), a ubiquination ligase that ubiquitinates it prior to proteasome degradation. The stability of p53 is also influenced by a series of other interacting proteins. In this review, we discuss the post-translational modifications to p53 in response to different stresses and the consequences of these changes.

Ataxia-telangiectasia: a multifaceted genetic disorder associated with defective signal transduction.

The gene responsible for the defect in the human genetic disorder ataxia-telangiectasia, ATM, was cloned recently. The part of the gene coding for a phosphatidylinositol 3-kinase domain showed it to be related to a family of genes involved in signal transduction, cell cycle control and the response to DNA damage. The elucidation of the role of the ATM gene product will provide valuable insight into the radiosensitivity, cancer predisposition, immunodeficiency and neuropathology that characterize this syndrome.

A subgroup of spinocerebellar ataxias defective in DNA damage responses.

A subgroup of human autosomal recessive ataxias is also characterized by disturbances of eye movement or oculomotor apraxia. These include ataxia telangiectasia (A-T); ataxia telangiectasia like disorder (ATLD); ataxia oculomotor apraxia type 1 (AOA1) and ataxia oculomotor apraxia type 2 (AOA2). What appears to be emerging is that all of these have in common some form of defect in DNA damage response which could account for the neurodegenerative changes seen in these disorders. We describe here sensitivity to DNA damaging agents in AOA1 and evidence that these cells have a defect in single strand break repair. Comparison is made with what appears to be a novel form of AOA (AOA3) which also shows sensitivity to agents that lead to single strand breaks in DNA as well as a reduced capacity to repair these breaks. AOA3 cells are defective in the DNA damage-induced p53 response. This defect can be overcome by incubation with the mdm2 antagonists, nutlins, but combined treatment with nutlins and DNA damage does not enhance the response. We also show that AOA3 cells are deficient in p73 activation after DNA damage. These data provide further evidence that different forms of AOA have in common a reduced capacity to cope with damage to DNA, which may account for the neurodegeneration observed in these syndromes.

DNA-binding protein activated by gamma radiation in human cells.

DNA damage-inducible responses in mammalian cells tend to lack specificity and can be activated by any one of a number of damaging agents. Although a number of different induced proteins have been described, their involvement in DNA processing and transcriptional control remains unresolved. We describe the appearance of a previously unreported, specific DNA-binding protein in nuclei from human cells exposed to ionizing radiation, which was not detected in nuclear extracts from unperturbed cells. The distal part of the simian virus 40 enhancer (without the AP-1 site) and oligonucleotide sequences derived from that sequence were used in binding studies. The appearance of this activity was dose dependent and transient, reaching a maximum at 1 h postirradiation and disappearing from nuclei by 9 h. This protein was induced in cells by a mechanism not requiring de novo protein synthesis, and the response was specific for ionizing radiation and radiomimetic agents; neither UV nor heat shock invoked a response. The DNA-binding protein was present in the cytoplasm of untreated cells, apparently being translocated to the nucleus only after radiation exposure. Southwestern (DNA-protein) analysis demonstrated that the nuclear and cytoplasmic proteins were approximately the same size, 43,000 daltons. The protected DNA-binding motif, using the distal fragment of the simian virus 40 enhancer as the substrate, was shown by DNase I footprint analysis to be pTGTCAGTTAGGGTACAGTCAATCCCAp. This was confirmed by dimethyl sulfate footprinting.

UV-induced hyperphosphorylation of replication protein a depends on DNA replication and expression of ATM protein.

Exposure to DNA-damaging agents triggers signal transduction pathways that are thought to play a role in maintenance of genomic stability. A key protein in the cellular processes of nucleotide excision repair, DNA recombination, and DNA double-strand break repair is the single-stranded DNA binding protein, RPA. We showed previously that the p34 subunit of RPA becomes hyperphosphorylated as a delayed response (4-8 h) to UV radiation (10-30 J/m(2)). Here we show that UV-induced RPA-p34 hyperphosphorylation depends on expression of ATM, the product of the gene mutated in the human genetic disorder ataxia telangiectasia (A-T). UV-induced RPA-p34 hyperphosphorylation was not observed in A-T cells, but this response was restored by ATM expression. Furthermore, purified ATM kinase phosphorylates the p34 subunit of RPA complex in vitro at many of the same sites that are phosphorylated in vivo after UV radiation. Induction of this DNA damage response was also dependent on DNA replication; inhibition of DNA replication by aphidicolin prevented induction of RPA-p34 hyperphosphorylation by UV radiation. We postulate that this pathway is triggered by the accumulation of aberrant DNA replication intermediates, resulting from DNA replication fork blockage by UV photoproducts. Further, we suggest that RPA-p34 is hyperphosphorylated as a participant in the recombinational postreplication repair of these replication products. Successful resolution of these replication intermediates reduces the accumulation of chromosomal aberrations that would otherwise occur as a consequence of UV radiation.

Identification of a potentially radiosensitive subgroup among patients with breast cancer.

BACKGROUND: The description of genes and genetic syndromes, such as ataxia-telangiectasia, that predispose some women to breast cancer will provide greater insight into the genetic basis of cancer susceptibility. PURPOSE: Our goal was to establish cell lines from patients with breast and bladder cancers, to screen for enhanced levels of radiation-induced arrest in the G2 phase of the cell cycle such as is observed in ataxia-telangiectasia heterozygotes, and to correlate G2 arrest with other prognostic indicators of these cancers and in vivo radiosensitivity. METHODS: Epstein-Barr virus-transformed lymphoblastoid cells were established from 108 female patients with breast cancer and 24 age-matched female control subjects, and from 45 patients with bladder cancer and 18 age-matched control subjects. Cells were exposed to 3 Gy of gamma radiation, and the percentages of cells in G1 and G2 phases were determined at 18 and 24 hours after irradiation by fluorescence-activated cell sorter analysis. Postirradiation delay in G2 phase was determined by calculating the percentage of cells in G2 and by using the ratio G2/G1. RESULTS: When we determined the percentage of cells in G2 phase at 18 hours after irradiation in 108 lymphoblastoid cells from breast cancer patients, we observed an increase of between 3% and 38% in the number of cells in G2 phase in comparison with cells that were not irradiated. Comparison with previous G2-phase arrest data for ataxia-telangiectasia heterozygotes using a cutoff point at 29% delay demonstrated that 20% and 8% of the breast cancer cell lines of the case patients and control subjects, respectively, fell into that category (P < .001). At the same time after irradiation, it was not possible to distinguish between bladder cancer cell lines (7%) and those of the corresponding control group (6%). Assessment of radiation effects by G2/G1 ratio showed that 18% of the breast cancer patients and 8% of the control subjects were in the high range. When G2 arrest was correlated with other prognostic factors, we found that case patients with a greater G2 block were more likely to have had a family history of breast cancer (P < .006) and more aggressive tumors when assessed by number of involved lymph nodes (P < .002) and tumor size (P < .05). Furthermore, an adverse response to radiotherapy was observed in a group of patients with high G2 arrest. IMPLICATIONS: While the postirradiation increase in G2-phase arrest in cells from breast cancer patients observed in this study may indicate genetic heterozygosity for ataxia-telangiectasia, it might also reflect other genetic abnormalities important to breast cancer.

Resistance to radiation-induced apoptosis in Burkitt's lymphoma cells is associated with defective ceramide signaling.

Increased sensitivity to ionizing radiation has been shown to be due to defects in double-strand break repair and mutations in the proteins that detect DNA damage. However, it is now recognized that the cellular radiation response is complex and that radioresistance/radiosensitivity may also be regulated at different levels in the radiation signal transduction pathway. Here, we describe a direct relationship between resistance to radiation-induced apoptosis and defective ceramide signaling. Radiation sensitivity in human tumor cells correlated with the immediate accumulation of the second messenger ceramide. In the BL30A Burkitt's lymphoma line, ceramide increased 4-fold by 10 min postirradiation (10 Gy), and in the moderately sensitive HL-60 leukemia cells, ceramide accumulated 2.5-fold above basal levels. In contrast, in all radioresistant tumor cells examined, including several Burkitt's lymphoma lines (BL30K, BL29, and BL36) and the MO59K glioma cell line, ceramide did not accumulate postirradiation. The ability to abrogate ceramide production by pretreatment with the tumor promoter, 12-O-tetradecanoylphorbol 13-acetate, conferred resistance to radiation-induced apoptosis in the sensitive BL30A cells. An isogenic subline of BL30A, BL30K, was resistant to both C8-ceramide (20 microM) and ionizing radiation-induced apoptosis. Bypassing the block in radiation-induced ceramide production by the addition of exogenous ceramide was not sufficient to induce apoptosis; this suggests the existence of a second ceramide-associated signaling defect in these radioresistant cells that confers resistance to ceramide-induced apoptosis. Thus, these results provide compelling evidence that ceramide is an essential mediator of radiation-induced apoptosis and that defective ceramide signaling confers an apoptosis-resistant phenotype in tumor cells.

Eighth International Workshop on Ataxia-Telangiectasia (ATW8).

ATW8 was a unique opportunity to review the complex and growing field of ataxia-telangiectasia (A-T) research and to cross-fertilize ideas for new experimental designs. A-T biology now encompasses human and mouse neurology, neurobiology, immunology, radiobiology, cell signalling, cell cycle checkpoints, gametogenesis, and oncogenesis, as well as radiotherapy, cancer epidemiology, premature aging, cytogenetics, and DNA repair mechanisms. By an as yet undetermined mechanism, the ATM protein appears to sense double strand breaks (DSB) during meiosis or mitosis, or breaks consequent to the damage of free radicals which are generated during the metabolism of food. As a protein kinase, ATM then directly phosphorylates p53 and interacts with many other molecules involved in homologous and nonhomologous DSB repair, as well as in cell signalling. Some of these molecule targets include: c-abl, ATR, chk-1, chk-2, RPA, BRCA1, BRCA2, NFkappaB/IkappaB alpha, beta-adaptin, and perhaps ATM itself. Thus, ATM is a "hierarchical kinase," initiating many pathways simultaneously. Parallel sessions or longer meetings will clearly be necessary for future A-T workshops.