Influence of interleukin-8 and interleukin-10 on sporadic colon cancer development and progression.

Cytokines produced in the tumour microenvironment have an important role in cancer pathogenesis. Altered cytokine expression may result in increased susceptibility to and/or poor prognosis in certain cancers. Therefore, the aim of this study was to investigate the influence of interleukin (IL)-8 and IL-10 on sporadic colon cancer development and progression. In our study, a statistically significant increase in IL-8 messenger RNA (mRNA) expression and decrease in IL-10 mRNA expression in tumour tissue compared with normal mucous tissue was observed (P = 0.003; P = 1.3 x 10(-9)). No association was found between IL-8 -251 A/T genotypes and IL-8 mRNA expression in tumour and corresponding normal mucous tissue, as well as susceptibility to sporadic colon cancer. Positive immunohistochemical IL-8 staining was more frequent in moderately and poorly differentiated tumours compared with well-differentiated tumours (P = 0.024). Finally, IL-8 significantly stimulated invasion of HT-29 cells in vitro (P = 0.000172). Significant association of IL-10 -1082 A/G, -819 T/C and -592 A/C genotypes and IL-10 mRNA expression in tumour tissue was observed (P = 0.022; P = 0.013; P = 0.02). Significant association of -819 T/C and -592 A/C genotypes and IL-10 mRNA expression in corresponding normal mucous tissue was observed (P = 0.01; P = 0.04) as well. IL-10 single-nucleotide polymorphism (SNP) promoter genotypes associated with low IL-10 mRNA expression (-819 TT; -592 AA) were also associated with increased risk of sporadic colon cancer compared with high-expression genotypes [odds ratio, 5.53; 95% confidence interval (CI), 1.53-20.1; odds ratio, 4.07; 95% CI, 1.28-12.96]. Positive IL-10 immunohistochemical reaction was more frequent in well-differentiated and moderately differentiated tumours compared with poorly differentiated tumours (P = 0.036). In Dukes' C tumours, positive IL-10 immunohistochemical reaction was less frequent compared with Dukes' A and B tumours (P = 0.023). Taken together, our results point to possible tumour promoting role of IL-8 and potential protective role of IL-10 in sporadic colon cancer.

D-Optimal Design in the Development of Rheologically Improved In Situ Forming Ophthalmic Gel.

In situ forming ophthalmic gels need to be fine tuned considering all the biopharmaceutical challenges of the front of the eye in order to increase drug residence time at the application site resulting in its improved bioavailability and efficacy. The aim of this study was to develop in situ forming ophthalmic poloxamer P407/poloxamer P188/chitosan gel fine tuned in terms of polymer content, temperature of gelation, and viscosity. Minimizing the total polymer content while retaining the advantageous rheological properties has been achieved by means of D-optimal statistical design. The optimal in situ forming gel was selected based on minimal polymer content (P407, P188, and chitosan concentration of 14.2%, 1.7%, and 0.25% w/w, respectively), favorable rheological characteristics, and in vitro resistance to tear dilution. The optimal in situ forming gel was proved to be robust against entrapment of active pharmaceutical ingredients making it a suitable platform for ophthalmic delivery of active pharmaceutical ingredients with diverse physicochemical properties.

Molecular genetic alterations of FHIT and p53 genes in benign and malignant thyroid gland lesions.

Several oncogenes and tumor-suppressor genes are involved either as early or late event in thyroid gland carcinogenesis. Human FHIT (fragile histidine triad) gene is highly conserved gene whose loss of function may be important in the development and/or progression of various types of cancer. We undertook this study to analyze FHIT and p53 gene status in different benignant and malignant thyroid tumors. Status of these genes as well as intensity of apoptosis was analyzed in tumor tissues by molecular genetic methods, immunohistochemistry, and FACS-scan analysis. The majority of the malignant thyroid cancers displayed aberrant expression of FHIT gene, concominant with p53 gene inactivation. This is followed by low rate of apoptosis, which may be important in the development and/or progression of thyroid cancer. We found higher incidence of p53 mutation and aberrant processing of FHIT mRNA in malignant tumors (papillary, follicular, medullary and anaplastic carcinomas) and in those tumors with distant metastasis. The growth of p53(-)/FHIT(-) follicular carcinoma of human origin was much faster in nude mice than p53(+)/FHIT(+) follicular carcinoma, and mice had shorter survival rate. Our results show a correlation between aberrant FHIT and p53 expression, low rate of apoptosis, and malignancy. Concomitant aberration of FHIT gene and p53 could be responsible for development of highly malignant types of thyroid cancer and may be considered as a prognostic marker for these tumors.

Classification of torasemide based on the Biopharmaceutics Classification System and evaluation of the FDA biowaiver provision for generic products of CLASS I drugs.

The biopharmaceutical properties of an in-house developed new crystal modification of torasemide (Torasemide N) were investigated in comparison with the most well known crystal modification form of torasemide (Torasemide I) in order to classify the drug according to the Biopharmaceutics Classification System (BCS), and to evaluate the data in line with current US Food and Drug Administration (FDA) guidance (with biowaiver provision for Class I drugs) to determine if the biowaiver provision could be improved. The solubility profiles of Torasemide I and Torasemide N were determined, and tablets prepared from both forms of the drug were studied for in-vitro release characteristics in media recommended by the current FDA guidance for biowaiver of generic products, and in other media considered more appropriate for the purpose than the ones recommended by the FDA. Two separate bioequivalence studies in healthy humans (following oral administration) were performed with two test products (both prepared from Torasemide I) against a single reference product (prepared from Torasemide N). The absorption profiles of the drug from the tablets were determined by deconvolution for comparison with the in-vitro release profiles to determine the appropriateness of some dissolution media for predicting in-vivo performance and to determine the comparative rate and extent of absorption. The drug was absorbed from the tested products quickly and almost completely (about 95% within 3.5 h of administration). However, one test product failed to meet the bioequivalence criteria and had a significant initial lower absorption rate profile compared with the reference product (P< or =0.05), whereas the other product was bioequivalent and had a similar absorption profile to the reference product. A dissolution medium at pH 5.0, in which torasemide has minimum solubility, was found to be more discriminatory than the media recommended by the FDA. Torasemide has been classified as a Class I drug according to the BCS up to a maximum dose of 40 mg and the data suggest that the current FDA guidance could be improved by giving more emphasis to selection of appropriate dissolution media than is given in its current form for approving biowaiver to generic products of Class I drugs.

Influence of H. pylori infection and eradication on p53, c-erbB-2 and Ki-67 in gastric mucosa.

BACKGROUND/AIMS: To evaluate the expression of antigens c-erbB-2, p53, and Ki-67 in gastric biopsy, bacteria density and urease activity in two groups of patients with chronic gastritis separated on the basis of the success or failure of H. pylori eradication. METHODOLOGY: Sixty-five patients with chronic gastritis were split in two groups (n=45/20) related to response to the therapy. The gastric mucosa samples (Sydney system) were analyzed histologically in both groups of patients before and after standard therapy (for eradicated, E group after one cycle; for non-eradicated, NE group after three cycles) for H. pylori infection, urease activity, c-erbB-2, p53 and Ki-67 expression. Sera samples taken before and after treatment were also analyzed for specific antibody against H. pylori. RESULTS: The eradication of H. pylori in patients of the E group was accompanied with significant lower colonization grades of bacteria, urease activity, proliferating rate, p53, and Ki-67 expression while c-erbB-2 expression was unchanged. In the NE group, all parameters were the same before and after therapy with exception of p53, which was slightly higher on both locations. Strong expression of c-erbB-2 in corpus of the NE group was determinate. Serum activity of specific antibodies against H. pylori was lower after the therapy in both groups of patients, but in the eradicated group this change was much stronger that in the non-eradicated. CONCLUSIONS: Long persisting infection is related with higher colonization grades of bacteria, urease activity, p53, c-erbB-2 and Ki-67 expression. Changes of those markers are connected with duration of infection and location where these changes were obtained.

Modulation of neutrophil and inflammation markers in chronic obstructive pulmonary disease by short-term azithromycin treatment.

The anti-inflammatory potential of azithromycin in chronic obstructive pulmonary disease (COPD) patients was explored following a standard oral dosing regimen. Patients with moderate and severe COPD were treated with azithromycin (500 mg, n=16) or placebo (n=8) once daily for 3 days in a randomized, double blind design, to compare effects on inflammation markers with those seen in a previous study in healthy volunteers. A battery of tests was made on serum, blood neutrophils and sputum on days 1 (baseline), 3, 4, 11, 18 and 32. In comparison to placebo, azithromycin resulted in an early transient increase in serum nitrites plus nitrates (day 3), associated with a tendency towards an increase in the blood neutrophil oxidative burst to phorbol myristic acetate. Subsequently, prolonged decreases in blood leukocyte and platelet counts, serum acute phase protein (including C reactive protein) and soluble E-selectin and blood neutrophil lactoferrin concentrations and a transient decrease in serum interleukin-8 were observed. Blood neutrophil glutathione peroxidase activity showed a prolonged increase after azithromycin treatment. The biphasic facilitatory-then-inhibitory response to azithromycin seen in healthy volunteers is not so clearly detectable in COPD patients, only potential anti-inflammatory effects. Treatment for longer periods may give therapeutic anti-inflammatory benefit in these patients.

Status of the DPC4 tumor suppressor gene in sporadic colon adenocarcinoma of Croatian patients: identification of a novel somatic mutation.

Loss of heterozygosity (LOH) of loci on chromosome 18q occurs in a majority of colorectal cancers. The DPC4 (Smad4) tumor suppressor gene, located at 18q21.1, may be a predisposing gene for Juvenile Polyposis Syndrome. To investigate alterations of the DPC4 gene in sporadic colon adenocarcinoma, a panel of 60 tumor specimens from Croatian patients was surveyed for evidence of LOH and also for mutations within the entire DPC4 coding region (exons 1-11). Using three pairs of specific primers for the three DPC4 microsatellite repetitive sequences, we investigated the frequency of LOH. The presence of single nucleotide change at restriction sites of specific codons in exons 2, 8, 10, and 11 (which belong to the conserved region of the gene) was examined by RFLP analysis. The investigation was extended to search for any other mutation within the entire coding region of the DPC4 gene by single strand conformation polymorphism (SSCP) analysis. Our results show a high frequency of heterozygosity in 58 of 60 (97%) colon adenocarcinoma samples. LOH at any one of the three flanking markers was observed in 26 (45%) of the 58 informative cases. The loss of one allele of the DPC4 gene was negatively correlated with tumor size; more frequent in smaller tumors (<5 cm) than in larger ones. A mutation was found in exon 11 in only one tumor sample (T18), and the mutation was verified by sequencing. Sequencing demonstrated a novel mutation-a deletion in exon 11 (134-153 del TAGACGAAGTACTTCATACC) of the DPC4 gene in the MH2 domain. These data suggest that inactivation of the DPC4 gene contributes to the genesis of colorectal carcinoma through allelic loss whereas mutation in the coding region of the DPC4 gene is infrequently detected in Croatian patients with A, B or C stages of colorectal cancers.

Preoperative assessment of ovarian tumors by CA 125 measurement and transvaginal color Doppler ultrasound.

The accuracy of combined use of serum CA 125 and transvaginal color Doppler for preoperative assessment of ovarian lesions in premenopausal patients was evaluated. Seventy-six ovarian lesions were analyzed the day before surgery using transvaginal color Doppler ultrasound. On the same day, serum CA 125 was measured in each patient. A novel index is proposed for the detection of ovarian malignancy combining resistance index (RI) obtained from newly formed vessels within the ovarian lesion and serum CA 125 level: (RI/CA 125) x 100. Values below the cut-off value of 1.5 were associated with a high risk of ovarian malignancy. Assessment of ovarian lesions by the novel index had a sensitivity and specificity of 94.44% and 100%, while positive and negative predictive values were 100% and 98.31%, respectively. The best prediction of ovarian malignancy was achieved by a combined use of transvaginal color Doppler ultrasound and serum CA 125 in the form of index: (RI/CA 125) x 100.

IL-2 -330 T/G SNP and serum values-potential new tumor markers in neuroendocrine tumors of the gastrointestinal tract and pancreas (GEP-NETs).

Cytokines participate in tumorigenesis of gastroenteropancreatic neuroendocrine tumors (GEP-NETs). Single nucleotide polymorphisms (SNPs) in cytokine genes influence expression of proteins and are evaluated in cancer susceptibility. The aim of this study was to evaluate IL-2 -330 T/G SNP and susceptibility to GEP-NETs, and analyze the correlation between G-allele and IL-2 serum values in GEP-NET patients. Moreover we assessed the value of IL-2 as a tumor serum marker. IL-2 -330 T/G SNP was examined in 101 patients and 150 healthy volunteers and IL-2 serum levels in patients and 20 controls. Patients' IL-2 serum levels were compared to IL-2 -330 T/G genotypes and tumor functional status and finally with known markers such as chromogranin A (CgA) and 5-hydroxyindolacetic acid (5-HIAA). There was a significant difference in genotype distribution of the IL-2 -330 polymorphisms between GEP-NET and control group (p = 0.0006) as well as in the frequency of G-allele (p = 0.010). G-allele correlated with higher IL-2 serum levels (p = 0.028) and elevated in all patients, being highest in patients with functional tumors (p = 0.039). Compared to CgA and 5-HIAA, IL-2 was more specific in detecting GEP-NET patients (p < 0.0001 and p < 0.0001, respectively). Our results indicate importance of IL-2 in GEP-NET development and biochemical diagnosis.

IL-6-174 C/G polymorphism in the gastroenteropancreatic neuroendocrine tumors (GEP-NETs).

IL-6 is a pleiotropic cytokine with still controversial role in tumorigenesis of different cancer types. Its promoter SNP-174 C/G is associated with increased IL-6 transcription and in some tumor types with elevated IL-6 serum levels. The role of IL-6 polymorphisms and IL-6 serum values and their correlation in the gastroenteropancreatic neuroendocrine tumors is lacking. We investigated for the first time frequencies of IL-6-174 genotypes in 80 GEP-NET patients and 162 age- and sex-matched healthy controls, serum values of IL-6 in GEP-NET patients and their correlation with IL-6-174 genotypes. To analyze IL6-174 C/G polymorphism PCR-NlaIII RFLP method was used, and serum levels were measured on Immulite analyzer by enzymatic solid-phase chemiluminescent immunometric method. Serum IL-6 values were elevated (>5.9 pg/ml) in 36.8% GEP-NET patients. Differences in genotypes distribution between patients and healthy controls as well as between patients with gastrointestinal and pancreatic neuroendocrine tumors (PETs) and functioning and nonfunctioning PETs were tested by chi(2) test and Fisher's Exact test. Analysis of variance (ANOVA with proc GLM in SAS/Stat) was performed for the group comparison. Level of significance was alpha=0.05. Patients with nonfunctioning PETs had only high expression IL-6-174 CG and GG genotypes and according to genotypes differed significantly (p=0.0289) from functioning PETs. High serum IL-6 values in all GEP-NET patients correlated significantly with GG IL-6-174 genotype (p=0.0139). Nonfunctioning PET patients had significantly (p=0.000777) higher IL-6 serum values in comparison to patients with functioning PETs and gastrointestinal NETs. Serum IL-6 values correlated significantly with IL-6-174 genotypes in nonfunctioning PETs and gastrointestinal NETs (p<0.05), but not in functioning PETs.

APC gene loss of heterozygosity, mutations, E1317Q, and I1307K germ-line variants in sporadic colon cancer in Croatia.

Colorectal carcinomas are characterized by multiple genetic aberrations that occur during tumorigenesis. Several tumor suppressor genes associated with colorectal carcinoma have been identified: MCC, APC, p53, nm23-H1, DCC, DPC4. We examined 73 cases of sporadic human colon cancer and corresponding normal tissue samples to evaluate the loss of heterozygosity (LOH) at the APC gene loci. The purpose of this study was also to evaluate whether the LOH at the APC gene is associated with clinicopathological characteristics in sporadic colon cancer. We also investigated presence and the frequency of the most common APC gene mutations and APC E1317Q and I1307K germ-line variants in Croatian colorectal cancer patients. Five markers in all patients were found to be heterozygous and informative for LOH analysis. LOH at the APC locus was detected in 30.1% of tumors were examined. The majority of APC gene LOH was observed in Dukes' B (55.6%) and in the moderately differentiated tumors (42.9%). Only 1309 APC gene mutation was detected in our samples. In one tumor sample, a new sporadic mutation of the APC gene in codon 1374 was detected. APC E1317Q and I1307K germ-line variants were not detected in our population. But APC E1317Q sporadic mutation was found in one tumor sample.

Gastric cancer: the role of insulin-like growth factor 2 (IGF 2) and its receptors (IGF 1R and M6-P/IGF 2R).

Insulin-like growth factor 2 (IGF 2) appears to be involved in the progression of many tumours. It binds to at least two different types of receptor: IGF type 1 (IGF 1R) and mannose 6-phosphate/IGF type 2 (M6-P/IGF 2R). Ligand binding to IGF 1R provokes mitogenic and anti-apoptotic effects. M6-P/IGF 2R has a tumour suppressor function--it mediates IGF 2 degradation. Mutation of M6-P/IGF 2R causes both diminished growth suppression and augmented growth stimulation. The aim of this study was to investigate the role of IGF 2 and its receptors (IGF 1R and IGF 2R) in human gastric cancer. The expression of IGF 2 and its receptors was measured in order to analyse the possible correlation between the activity of these genes and cell proliferation in two different gastric tumour types: diffuse and intestinal. The effect of IGF 1 receptor blockage on cell proliferation and anchorage-independent cell growth was also examined. Increased expression of IGF 2 and IGF 1R genes (at the mRNA and protein level) was found in gastric cancer when compared with non-tumour tissue. Furthermore, there was a significant difference between IGF 2 expression in the more aggressive diffuse type and that in the intestinal type of gastric cancer. Moreover, the IGF 2 peptide level in the culture media obtained from the diffuse type of cancer cells was significantly higher when compared with the intestinal type. The level of IGF 2 peptide in the conditioned media strongly correlated with [3H]thymidine incorporation and cell proliferation. On the contrary, IGF 2R mRNA expression was much higher in the intestinal type of cancer than in the diffuse type. In addition, IGF 2R protein expression was substantially lower with progression of the diffuse cancer type to a higher stage. The alphaIR3 monoclonal antibody strongly inhibited [3H]thymidine incorporation and decreased the number of colonies in soft agar of cells overexpressing IGF 2. These findings suggest that members of the IGF family are involved in the pathogenesis of gastric cancer, probably by autocrine/paracrine stimulation of cell growth. Such tumours might be excellent candidates for therapeutic strategies aimed at interference with this pathway.