Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 36
Filtrar
1.
Phytopathology ; 2024 Oct 10.
Artículo en Inglés | MEDLINE | ID: mdl-39387826

RESUMEN

We report high-quality genomes of three strains of Xanthomonas citri pv. mangiferaeindicae (Xcm), the causal agent of mango bacterial canker disease, including the pathotype strain of this pathovar and two strains from Burkina Faso that emerged a decade ago. These strains hosted two to three plasmids of sizes ranging from 19 to 86 kb. Genome mining revealed the presence of several secretion systems (SS) and effectors involved in virulence of xanthomonads with (i) a T1SS of the hlyDB group, (ii) xps and xcs T2SSs, (iii) a T3SS with several type three effectors (T3E), including transcription activator-like effectors (TALE), (iv) several T4SSs associated with plasmid or integrative conjugative elements (ICE) mobility, (v) three T5SS subclasses (Va, Vb and Vc) and (vi) a single i3* T6SS. The two strains isolated in Burkina Faso from mango (Mangifera indica L.) and cashew (Anacardium occidentale L.) differed by only 14 SNPs and shared identical secretion systems and T3E repertoire. Several TALEs were identified in each strain, some of which may target plant genes previously found implicated in disease development in other xanthomonad-associated pathosystems. These results support the emergence in Burkina Faso a decade ago of very closely related strains that became epidemic on mango and cashew, i.e., two distinct host genera of a same plant family. These new genomic resources will contribute to better understand the biology and evolution of this agriculturally major crop pathogen.

2.
J Antimicrob Chemother ; 78(8): 1848-1858, 2023 08 02.
Artículo en Inglés | MEDLINE | ID: mdl-37341144

RESUMEN

BACKGROUND: ESBL-producing Escherichia coli (ESBL-Ec) is considered a key indicator for antimicrobial resistance (AMR) epidemiological surveillance in animal, human and environment compartments. There is likelihood of ESBL-Ec animal-human transmission but proof of cross-compartment transmission is still unclear. OBJECTIVES: To characterize ESBL-Ec genetic similarity in various compartments (humans, animals and environment) from a rural area of Madagascar. METHODS: We collected ESBL-Ec isolates prospectively from humans, animals and the environment (water) between April and October 2018. These isolates were subject to WGS and analysed with cutting-edge phylogenomic methods to characterize population genetic structure and infer putative transmission events among compartments. RESULTS: Of the 1454 samples collected, 512 tested positive for ESBL-Ec. We successfully sequenced 510 samples, and a phylogenomic tree based on 179 365 SNPs was produced. Phylogenetic distances between and amongst compartments were indistinguishable, and 104 clusters of recent transmission events between compartments were highlighted. Amongst a large diversity of ESBL-Ec genotypes, no lineage host specificity was observed, indicating the regular occurrence of ESBL-Ec transfer among compartments in rural Madagascar. CONCLUSIONS: Our findings stress the importance of using a phylogenomic approach on ESBL-Ec samples in various putative compartments to obtain a clear baseline of AMR transmissions in rural settings, where one wants to identify risk factors associated with transmission or to measure the effect of 'One Health' interventions in low- and middle-income countries.


Asunto(s)
Infecciones por Escherichia coli , Animales , Humanos , Infecciones por Escherichia coli/epidemiología , Madagascar/epidemiología , Filogenia , beta-Lactamasas/análisis , Escherichia coli , Antibacterianos/farmacología
3.
PLoS Pathog ; 17(7): e1009714, 2021 07.
Artículo en Inglés | MEDLINE | ID: mdl-34324594

RESUMEN

Over the past decade, ancient genomics has been used in the study of various pathogens. In this context, herbarium specimens provide a precious source of dated and preserved DNA material, enabling a better understanding of plant disease emergences and pathogen evolutionary history. We report here the first historical genome of a crop bacterial pathogen, Xanthomonas citri pv. citri (Xci), obtained from an infected herbarium specimen dating back to 1937. Comparing the 1937 genome within a large set of modern genomes, we reconstructed their phylogenetic relationships and estimated evolutionary parameters using Bayesian tip-calibration inferences. The arrival of Xci in the South West Indian Ocean islands was dated to the 19th century, probably linked to human migrations following slavery abolishment. We also assessed the metagenomic community of the herbarium specimen, showed its authenticity using DNA damage patterns, and investigated its genomic features including functional SNPs and gene content, with a focus on virulence factors.


Asunto(s)
Citrus/microbiología , Enfermedades de las Plantas/genética , Enfermedades de las Plantas/historia , Enfermedades de las Plantas/microbiología , Xanthomonas , Genoma Bacteriano , Historia del Siglo XX , Mauricio , Filogenia , Xanthomonas/genética
4.
Plant Dis ; 2023 Nov 15.
Artículo en Inglés | MEDLINE | ID: mdl-37966471

RESUMEN

Pseudocercospora fijiensis, the causal agent of the black leaf streak disease of bananas (plants in the genus Musa) (BLSD), is considered to be the major economic threat to export-banana cultivation (de Bellaire, Fouré, Abadie, & Carlier, 2010). The disease has a worldwide distribution throughout the humid tropical regions and has been previously reported in the Southwestndian Ocean (SWIO) area: in 1993 in Mayotte and Comoros islands (DR Jones & Mourichon, 1993), in 2000 in Madagascar (Jones, 2003; Rivas, Zapater, Abadie, & Carlier, 2004) and in 2018 in Reunion Island (Rieux et al., 2019). In Mauritius, the presence of Pseudocercospora fijiensis was suspected in 1996 (Soomary & Benimadhu, 1998) but has never been confirmed, as symptoms could have been confounded with Pseudocercospora musae or Pseudocercospora eumusae, two causal agents of others leaf spot diseases of banana which were previously described in Mauritius in 1959 (Orieux & Felix, 1968) and 2000 (Carlier, Zapater, Lapeyre, Jones, & Mourichon, 2000), respectively. In March 2022, typical BLSD symptoms were observed at relatively low prevalence in a Cavendish crop located in the "Balance John" area (site S1 on Fig. S1-A) of Mauritius island. Typical early symptoms (stages 2) were 1- to 4-mm long brown streaks at the abaxial leaf surface, and typical older streaks (stages 3 and 4) were also observed (Fig. S1-B). These symptoms were mixed with symptoms of ELSD caused by P. eumusae. Since both species cannot be clearly distinguished only on the description of symptoms, conidial sporulation on stages 2 was checked in the laboratory (Ngando et al., 2015) since P. eumusae does not produce conidia on these young stages. In April 2022, banana leaves bearing symptoms of leaf spot diseases were collected in 7 different sites (Fig. S1-A). All leaf fragments were sent to the CIRAD laboratories where molecular diagnosis was performed following the protocol developed by Arzanlou et al. (2007). In brief, genomic DNA was extracted from ground leaf fragments displaying symptoms using the DNeasy® Plant Mini Kit (Qiagen®, Courtaboeuf, France). At each site, a total of 6 lesions cut from 6 different leaves were pooled. The DNA extracts were added as templates for real-time PCR assay designed to specifically detect the presence of P. fijiensis, P. musae and P. eumusae using MFbf/MFbrtaq/MFbp, MEbf/MEbrtaq/FMep and MMbf/Mmbrtaq/FMep primers and probes, respectively (Arzanlou et al., 2007). Both positive and negative controls were included in the assay and every sample reaction was duplicated. P. fijiensis was detected from 2 out of 7 sites (S2 and S7, see Fig.S2-B). P. eumusae was detected at all sites while P. musae was found in one site only (S6). Interestingly, our results also showed coinfection by P. fijiensis - P. eumusae & P. musae - P. eumusae on several sites. The presence of P. fijiensis was further confirmed by several investigations performed on conidia isolated from S2 samples including i) morphological observations of conidia displaying P. fijiensis type description (Pérez-Vicente, Carreel, Roussel, Carlier, & Abadie (2021), Fig. S2-A), ii) DNA sequencing of 16S ribosomal gene with ITS1 & ITS4 primers (GenBank accessions Nos. OR515818-OR515810) with BLAST results displaying percentages of identity > 99.70% with type strains and iii) Koch's postulates were fulfilled by artificial inoculation of detached leaf pieces as described in Pérez-Vicente, Carreel, Roussel, Carlier, & Abadie (2021) (Fig. S2-D). In brief, for the artificial inoculation, symptoms obtained after inoculation of both a strain isolated in Mauritius (S2-MAU) and a positive control (T+) were compared and shown to be typical of P. fijiensis species for the 3 replicates. To the best of our knowledge, this is the first official report of P. fijiensis and BLSD in Mauritius Island. This revelation holds significant importance for both the agricultural and scientific communities, shedding light on the potential spread and impact of this devastating pathogen in previously unaffected regions. From a global perspective, this discovery underscores the interconnectedness of agricultural ecosystems and the need for vigilance in monitoring and responding to emerging plant diseases in an increasingly interconnected world (Vega et al. 2022). Future investigations will be required to monitor the spread of BLSD on the island, describe the genetic structure of populations and identify routes of invasion at the SWOI scale.

5.
Plant Dis ; 2022 Aug 26.
Artículo en Inglés | MEDLINE | ID: mdl-36018553

RESUMEN

Vanilla (Vanilla planifolia, Orchidaceae) is Madagascar's leading agricultural export resource which provides 80% of world's consumption. During a phytosanitary survey conducted from November 2019 to March 2021 in the main vanilla production regions of Madagascar, 250 plots were indexed for cymbidium mosaic virus (CymMV, Potexvirus genus) and odontoglossum ringspot virus (ORSV, Tobamovirus genus) the two most prevalent viruses of cultivated orchids worldwide (Zettler et al., 1990). For each plot, bulk samples (ten leaves taken at random) were assayed using Immunostrips (AGDIA, ISK 13301). A quarter of the plots (63/250) tested positive for CymMV. The highest prevalence of CymMV was observed in the SAVA region (57 out of 153 plots = 37,2%) where the virus has been reported since 1997 (Grisoni et al., 2010). Six plots located in the district of Mahanoro (Atsinanana) tested positive for ORSV. A few plants in these plots showed chlorotic often annular spots on their leaves. They were individually tested positive for ORSV, and negative for CymMV and potyviruses (Immunostrips AGDIA ISK 27200), the other two viruses reported so far in vanilla in Madagascar. To confirm the diagnosis of ORSV, leaf samples from five of the six infected plots were analysed by Tube Capture-RT-PCR (Grisoni et al., 2017) using two pairs of primers flanking the ORSV coat protein (CP) gene: OrCP1 (GGTCGGTAATGGTGTTAG) / OrCP2 (TGCATTATCGTATGCTCC), and CPOR-F(ATGTCTTACACTATTACAGACC) / CPOR-R(TTAGGAAGAGGTCCAAGTAAG). The five samples gave amplicons of the expected size (820 nt and 476 nt, respectively) and were sequenced with Sanger technology (Macrogen, The Netherlands). The ORSV-CP sequences of the Mahanoro isolates showed very close similarity to 198 ORSV-CP sequences from GenBank (95.8% to 99.6% nucleotide and 94.5 to 100% amino-acid identities), and less than 75.4% nucleotide (80.1% amino-acid) identities with Bell pepper mosaic virus (DQ355023), the tobamovirus closest to ORSV. The five ORSV-CP sequences from vanilla were deposited in GenBank under accessions numbers OM847399 to OM847403. These data confirmed that ORSV infects vanilla vines in Madagascar. To our knowledge, this is the first report of this virus in Madagascar and of its ability to infect symptomatically V. planifolia. The five ORSV isolates from vanilla had more than 98.7 % nucleotide identities of CP gene and clustered into a monophyletic group in maximum likelihood phylogenetic tree, suggesting a single origin of these isolates. To further investigate the origin of ORSV in Madagascar, we made use of RNA sequences isolated at different points in time to infer the timing of evolutionary events (Rieux et al., 2016). We estimated the CP gene substitution rate to 4.8E-4 subst/site/year [95%HPD 2.1E-4 - 8.7E-4] which is close to the estimate of He et al. (2019) based on a slightly different sequences set (1.25E-3 subst/site/year). We dated the initial contamination of vanilla plts by ORSV between 2004 and 2013. Both ORSV and CymMV have deleterious effects on many ornamental orchids, and the pathogenicity of CymMV is exacerbated when co-infecting with ORSV (Lee et al., 2021). Therefore, ORSV represents a new threat to the Malagasy vanilla crop, especially in regions where CymMV is already rife. Given the economic importance of vanilla cultivation in the country, the implementation of prophylactic measures aimed at preventing the spread of ORSV, in particular through the sanitary control of cuttings, should be a priority for the vanilla industry.

6.
Mol Biol Evol ; 37(3): 773-785, 2020 03 01.
Artículo en Inglés | MEDLINE | ID: mdl-31697387

RESUMEN

The protozoan Plasmodium vivax is responsible for 42% of all cases of malaria outside Africa. The parasite is currently largely restricted to tropical and subtropical latitudes in Asia, Oceania, and the Americas. Though, it was historically present in most of Europe before being finally eradicated during the second half of the 20th century. The lack of genomic information on the extinct European lineage has prevented a clear understanding of historical population structuring and past migrations of P. vivax. We used medical microscope slides prepared in 1944 from malaria-affected patients from the Ebro Delta in Spain, one of the last footholds of malaria in Europe, to generate a genome of a European P. vivax strain. Population genetics and phylogenetic analyses placed this strain basal to a cluster including samples from the Americas. This genome allowed us to calibrate a genomic mutation rate for P. vivax, and to estimate the mean age of the last common ancestor between European and American strains to the 15th century. This date points to an introduction of the parasite during the European colonization of the Americas. In addition, we found that some known variants for resistance to antimalarial drugs, including Chloroquine and Sulfadoxine, were already present in this European strain, predating their use. Our results shed light on the evolution of an important human pathogen and illustrate the value of antique medical collections as a resource for retrieving genomic information on pathogens from the past.


Asunto(s)
Malaria Vivax/parasitología , Plasmodium vivax/clasificación , Plasmodium vivax/genética , Secuenciación Completa del Genoma/métodos , Américas , Asia , Evolución Molecular , Genética de Población , Genoma de Protozoos , Secuenciación de Nucleótidos de Alto Rendimiento , Humanos , Oceanía , Filogenia , Filogeografía , España
7.
Mol Ecol ; 30(8): 1823-1835, 2021 04.
Artículo en Inglés | MEDLINE | ID: mdl-33305421

RESUMEN

Horizontal gene transfer is of major evolutionary importance as it allows for the redistribution of phenotypically important genes among lineages. Such genes with essential functions include those involved in resistance to antimicrobial compounds and virulence factors in pathogenic bacteria. Understanding gene turnover at microevolutionary scales is critical to assess the pace of this evolutionary process. Here, we characterized and quantified gene turnover for the epidemic lineage of a bacterial plant pathogen of major agricultural importance worldwide. Relying on a dense geographic sampling spanning 39 years of evolution, we estimated both the dynamics of single nucleotide polymorphism accumulation and gene content turnover. We identified extensive gene content variation among lineages even at the smallest phylogenetic and geographic scales. Gene turnover rate exceeded nucleotide substitution rate by three orders of magnitude. Accessory genes were found preferentially located on plasmids, but we identified a highly plastic chromosomal region hosting ecologically important genes such as transcription activator-like effectors. Whereas most changes in the gene content are probably transient, the rapid spread of a mobile element conferring resistance to copper compounds widely used for the management of plant bacterial pathogens illustrates how some accessory genes can become ubiquitous within a population over short timeframes.


Asunto(s)
Evolución Molecular , Transferencia de Gen Horizontal , Genoma Bacteriano , Enfermedades de las Plantas/microbiología , Bacterias , Filogenia
8.
BMC Microbiol ; 20(1): 296, 2020 10 01.
Artículo en Inglés | MEDLINE | ID: mdl-33004016

RESUMEN

BACKGROUND: Asiatic Citrus Canker, caused by Xanthomonas citri pv. citri, severely impacts citrus production worldwide and hampers international trade. Considerable regulatory procedures have been implemented to prevent the introduction and establishment of X. citri pv. citri into areas where it is not present. The effectiveness of this surveillance largely relies on the availability of specific and sensitive detection protocols. Although several PCR- or real-time PCR-based methods are available, most of them showed analytical specificity issues. Therefore, we developed new conventional and real-time quantitative PCR assays, which target a region identified by comparative genomic analyses, and compared them to existing protocols. RESULTS: Our assays target the X. citri pv. citri XAC1051 gene that encodes for a putative transmembrane protein. The real-time PCR assay includes an internal plant control (5.8S rDNA) for validating the assay in the absence of target amplification. A receiver-operating characteristic approach was used in order to determine a reliable cycle cut-off for providing accurate qualitative results. Repeatability, reproducibility and transferability between real-time devices were demonstrated for this duplex qPCR assay (XAC1051-2qPCR). When challenged with an extensive collection of target and non-target strains, both assays displayed a high analytical sensitivity and specificity performance: LOD95% = 754 CFU ml- 1 (15 cells per reaction), 100% inclusivity, 97.2% exclusivity for XAC1051-2qPCR; LOD95% = 5234 CFU ml- 1 (105 cells per reaction), 100% exclusivity and inclusivity for the conventional PCR. Both assays can detect the target from naturally infected citrus fruit. Interestingly, XAC1051-2qPCR detected X. citri pv. citri from herbarium citrus samples. The new PCR-based assays displayed enhanced analytical sensitivity and specificity when compared with previously published PCR and real-time qPCR assays. CONCLUSIONS: We developed new valuable detection assays useful for routine diagnostics and surveillance of X. citri pv. citri in citrus material. Their reliability was evidenced through numerous trials on a wide range of bacterial strains and plant samples. Successful detection of the pathogen was achieved from both artificially and naturally infected plants, as well as from citrus herbarium samples, suggesting that these assays will have positive impact both for future applied and academic research on this bacterium.


Asunto(s)
Proteínas Bacterianas/genética , Técnicas de Tipificación Bacteriana , Citrus/microbiología , Proteínas de la Membrana/genética , Reacción en Cadena en Tiempo Real de la Polimerasa/métodos , Xanthomonas/genética , Benchmarking , ADN Bacteriano/genética , Expresión Génica , Humanos , Enfermedades de las Plantas/microbiología , Curva ROC , Reacción en Cadena en Tiempo Real de la Polimerasa/normas , Reproducibilidad de los Resultados , Xanthomonas/aislamiento & purificación
9.
Phytopathology ; 110(6): 1161-1173, 2020 Jun.
Artículo en Inglés | MEDLINE | ID: mdl-32040377

RESUMEN

Xanthomonas vasicola pv. vasculorum is an emerging bacterial plant pathogen that causes bacterial leaf streak on corn. First described in South Africa in 1949, reports of this pathogen have greatly increased in the past years in South America and in the United States. The rapid spread of this disease in North and South America may be due to more favorable environmental conditions, susceptible hosts and/or genomic changes that favored the spread. To understand whether genetic mechanisms exist behind the recent spread of X. vasicola pv. vasculorum, we used comparative genomics to identify gene acquisitions in X. vasicola pv. vasculorum genomes from the United States and Argentina. We sequenced 41 genomes of X. vasicola pv. vasculorum and the related sorghum-infecting X. vasicola pv. holcicola and performed comparative analyses against all available X. vasicola genomes. Time-measured phylogenetic analyses showed that X. vasicola pv. vasculorum strains from the United States and Argentina are closely related and arose from two introductions to North and South America. Gene content comparisons identified clusters of genes enriched in corn X. vasicola pv. vasculorum that showed evidence of horizontal transfer including one cluster corresponding to a prophage found in all X. vasicola pv. vasculorum strains from the United States and Argentina as well as in X. vasicola pv. holcicola strains. In this work, we explore the genomes of an emerging phytopathogen population as a first step toward identifying genetic changes associated with the emergence. The acquisitions identified may contain virulence determinants or other factors associated with the spread of X. vasicola pv. vasculorum in North and South America and will be the subject of future work.


Asunto(s)
Xanthomonas , Argentina , Genómica , Filogenia , Enfermedades de las Plantas , Sudáfrica , América del Sur , Estados Unidos , Zea mays
10.
Appl Environ Microbiol ; 85(13)2019 07 01.
Artículo en Inglés | MEDLINE | ID: mdl-31028021

RESUMEN

Xylella fastidiosa is an economically important bacterial plant pathogen. With insights gained from 72 genomes, this study investigated differences among the three main subspecies, which have allopatric origins: X. fastidiosa subsp. fastidiosa, multiplex, and pauca The origin of recombinogenic X. fastidiosa subsp. morus and sandyi was also assessed. The evolutionary rate of the 622 genes of the species core genome was estimated at the scale of an X. fastidiosa subsp. pauca subclade (7.62 × 10-7 substitutions per site per year), which was subsequently used to estimate divergence time for the subspecies and introduction events. The study characterized genes present in the accessory genome of each of the three subspecies and investigated the core genome to detect genes potentially under positive selection. Recombination is recognized to be the major driver of diversity in X. fastidiosa, potentially facilitating shifts to novel plant hosts. The relative effect of recombination in comparison to point mutation was calculated (r/m = 2.259). Evidence of recombination was uncovered in the core genome alignment; X. fastidiosa subsp. fastidiosa in the United States was less prone to recombination, with an average of 3.22 of the 622 core genes identified as recombining regions, whereas a specific clade of X. fastidiosa subsp. multiplex was found to have on average 9.60 recombining genes, 93.2% of which originated from X. fastidiosa subsp. fastidiosa Interestingly, for X. fastidiosa subsp. morus, which was initially thought to be the outcome of genome-wide recombination between X. fastidiosa subsp. fastidiosa and X. fastidiosa subsp. multiplex, intersubspecies homologous recombination levels reached 15.30% in the core genome. Finally, there is evidence of X. fastidiosa subsp. pauca strains from citrus containing genetic elements acquired from strains infecting coffee plants as well as genetic elements from both X. fastidiosa subsp. fastidiosa and X. fastidiosa subsp. multiplex In summary, our data provide new insights into the evolution and epidemiology of this plant pathogen.IMPORTANCEXylella fastidiosa is an important vector-borne plant pathogen. We used a set of 72 genomes that constitutes the largest assembled data set for this bacterial species so far to investigate genetic relationships and the impact of recombination on phylogenetic clades and to compare genome content at the subspecies level, and we used a molecular dating approach to infer the evolutionary rate of X. fastidiosa The results demonstrate that recombination is important in shaping the genomes of X. fastidiosa and that each of the main subspecies is under different selective pressures. We hope insights from this study will improve our understanding of X. fastidiosa evolution and biology.


Asunto(s)
Variación Genética , Genoma Bacteriano , Recombinación Homóloga , Xylella/genética , Filogenia
11.
Proc Natl Acad Sci U S A ; 113(41): 11495-11500, 2016 10 11.
Artículo en Inglés | MEDLINE | ID: mdl-27671660

RESUMEN

Phylogenetic analysis of Plasmodium parasites has indicated that their modern-day distribution is a result of a series of human-mediated dispersals involving transport between Africa, Europe, America, and Asia. A major outstanding question is the phylogenetic affinity of the malaria causing parasites Plasmodium vivax and falciparum in historic southern Europe-where it was endemic until the mid-20th century, after which it was eradicated across the region. Resolving the identity of these parasites will be critical for answering several hypotheses on the malaria dispersal. Recently, a set of slides with blood stains of malaria-affected people from the Ebro Delta (Spain), dated between 1942 and 1944, have been found in a local medical collection. We extracted DNA from three slides, two of them stained with Giemsa (on which Plasmodium parasites could still be seen under the microscope) and another one consisting of dried blood spots. We generated the data using Illumina sequencing after using several strategies aimed at increasing the Plasmodium DNA yield: depletion of the human genomic (g)DNA content through hybridization with human gDNA baits, and capture-enrichment using gDNA derived from P. falciparum Plasmodium mitochondrial genome sequences were subsequently reconstructed from the resulting data. Phylogenetic analysis of the eradicated European P. vivax mtDNA genome indicates that the European isolate is closely related to the most common present-day American haplotype and likely entered the American continent post-Columbian contact. Furthermore, the European P. falciparum mtDNA indicates a link with current Indian strains that is in agreement with historical accounts.


Asunto(s)
ADN Mitocondrial/genética , Erradicación de la Enfermedad , Plasmodium falciparum/genética , Plasmodium vivax/genética , ADN Protozoario/genética , Haplotipos/genética , Funciones de Verosimilitud , Filogenia , Análisis de Secuencia de ADN , España
12.
Mol Ecol ; 25(9): 1911-24, 2016 05.
Artículo en Inglés | MEDLINE | ID: mdl-26880113

RESUMEN

Molecular dating of phylogenetic trees is a growing discipline using sequence data to co-estimate the timing of evolutionary events and rates of molecular evolution. All molecular-dating methods require converting genetic divergence between sequences into absolute time. Historically, this could only be achieved by associating externally derived dates obtained from fossil or biogeographical evidence to internal nodes of the tree. In some cases, notably for fast-evolving genomes such as viruses and some bacteria, the time span over which samples were collected may cover a significant proportion of the time since they last shared a common ancestor. This situation allows phylogenetic trees to be calibrated by associating sampling dates directly to the sequences representing the tips (terminal nodes) of the tree. The increasing availability of genomic data from ancient DNA extends the applicability of such tip-based calibration to a variety of taxa including humans, extinct megafauna and various microorganisms which typically have a scarce fossil record. The development of statistical models accounting for heterogeneity in different aspects of the evolutionary process while accommodating very large data sets (e.g. whole genomes) has allowed using tip-dating methods to reach inferences on divergence times, substitution rates, past demography or the age of specific mutations on a variety of spatiotemporal scales. In this review, we summarize the current state of the art of tip dating, discuss some recent applications, highlight common pitfalls and provide a 'how to' guide to thoroughly perform such analyses.


Asunto(s)
Evolución Molecular , Modelos Genéticos , Filogenia , Teorema de Bayes , Calibración , ADN Antiguo , Fósiles , Funciones de Verosimilitud , Modelos Estadísticos , Programas Informáticos
13.
Mol Biol Evol ; 31(10): 2780-92, 2014 Oct.
Artículo en Inglés | MEDLINE | ID: mdl-25100861

RESUMEN

Reliable estimates of the rate at which DNA accumulates mutations (the substitution rate) are crucial for our understanding of the evolution and past demography of virtually any species. In humans, there are considerable uncertainties around these rates, with substantial variation among recent published estimates. Substitution rates have traditionally been estimated by associating dated events to the root (e.g., the divergence between humans and chimpanzees) or to internal nodes in a phylogenetic tree (e.g., first entry into the Americas). The recent availability of ancient mitochondrial DNA sequences allows for a more direct calibration by assigning the age of the sequenced samples to the tips within the human phylogenetic tree. But studies also vary greatly in the methodology employed and in the sequence panels analyzed, making it difficult to tease apart the causes for the differences between previous estimates. To clarify this issue, we compiled a comprehensive data set of 350 ancient and modern human complete mitochondrial DNA genomes, among which 146 were generated for the purpose of this study and estimated substitution rates using calibrations based both on dated nodes and tips. Our results demonstrate that, for the same data set, estimates based on individual dated tips are far more consistent with each other than those based on nodes and should thus be considered as more reliable.


Asunto(s)
Sustitución de Aminoácidos , Biología Computacional/métodos , Genoma Mitocondrial , Animales , Teorema de Bayes , Calibración , Evolución Molecular , Genoma Humano , Humanos , Tasa de Mutación , Filogenia
14.
Microbiol Spectr ; 12(4): e0382723, 2024 Apr 02.
Artículo en Inglés | MEDLINE | ID: mdl-38441471

RESUMEN

The classical lineage of Mycobacterium ulcerans is the most prevalent clonal group associated with Buruli ulcer in humans. Its reservoir is strongly associated with the environment. We analyzed together 1,045 isolates collected from 13 countries on two continents to define the evolutionary history and population dynamics of this lineage. We confirm that this lineage spread over 7,000 years from Australia to Africa with the emergence of outbreaks in distinct waves in the 18th and 19th centuries. In sharp contrast with its global spread over the last century, transmission chains are now mostly local, with little or no dissemination between endemic areas. This study provides new insights into the phylogeography and population dynamics of M. ulcerans, highlighting the importance of comparative genomic analyses to improve our understanding of pathogen transmission. IMPORTANCE: Mycobacterium ulcerans is an environmental mycobacterial pathogen that can cause Buruli ulcer, a severe cutaneous infection, mostly spread in Africa and Australia. We conducted a large genomic study of M. ulcerans, combining genomic and evolutionary approaches to decipher its evolutionary history and pattern of spread at different geographic scales. At the scale of villages in an endemic area of Benin, the circulating genotypes have been introduced in recent decades and are not randomly distributed along the river. On a global scale, M. ulcerans has been spreading for much longer, resulting in distinct and compartmentalized endemic foci across Africa and Australia.


Asunto(s)
Úlcera de Buruli , Mycobacterium ulcerans , Humanos , Mycobacterium ulcerans/genética , Úlcera de Buruli/epidemiología , Úlcera de Buruli/microbiología , Filogenia , Genómica , Evolución Biológica
15.
Mol Ecol ; 22(21): 5368-81, 2013 Nov.
Artículo en Inglés | MEDLINE | ID: mdl-24118290

RESUMEN

Dispersal is a key factor in invasion and in the persistence and evolution of species. Despite the importance of estimates of dispersal distance, dispersal measurement remains a real methodological challenge. In this study, we characterized dispersal by exploiting a specific case of biological invasion, in which multiple introductions in disconnected areas lead to secondary contact between two differentiated expanding outbreaks. By applying cline theory to this ecological setting, we estimated σ, the standard deviation of the parent-offspring distance distribution, of the western corn rootworm, Diabrotica virgifera virgifera, one of the most destructive pests of maize. This species is currently invading Europe, and the two largest invasive outbreaks, in northern Italy and Central Europe, have recently formed a secondary contact zone in northern Italy. We identified vanishing clines at 12 microsatellite loci throughout the contact zone. By analysing both the rate of change of cline slope and the spatial variation of linkage disequilibrium at these markers, we obtained two σ estimates of about 20 km/generation(1/2). Simulations indicated that these estimates were robust to changes in dispersal kernels and differences in population density between the two outbreaks, despite a systematic weak bias. These estimates are consistent with the results of direct methods for measuring dispersal applied to the same species. We conclude that secondary contact resulting from multiple introductions is very useful for the inference of dispersal parameters and should be more widely used in other species.


Asunto(s)
Distribución Animal , Escarabajos/genética , Modelos Genéticos , Animales , Simulación por Computador , Genotipo , Hungría , Especies Introducidas , Funciones de Verosimilitud , Desequilibrio de Ligamiento , Repeticiones de Microsatélite , Densidad de Población , Eslovenia , Zea mays
16.
Bioinform Adv ; 3(1): vbad026, 2023.
Artículo en Inglés | MEDLINE | ID: mdl-36936370

RESUMEN

Motivation: Molecular tip-dating of phylogenetic trees is a growing discipline that uses DNA sequences sampled at different points in time to co-estimate the timing of evolutionary events with rates of molecular evolution. Importantly, such inferences should only be performed on datasets displaying sufficient temporal signal, a feature important to test prior to any tip-dating inference. For this purpose, the most popular method considered to-date has been the 'root-to-tip regression' which consist in fitting a linear regression of the number of substitutions accumulated from the root to the tips of a phylogenetic tree as a function of sampling times. The main limitation of the regression method, in its current implementation, relies in the fact that the temporal signal can only be tested at the whole-tree scale (i.e. its root). Results: To overcome this limitation we introduce Phylostems, a new graphical user-friendly tool developed to investigate temporal signal within every clade of a phylogenetic tree. We provide a 'how to' guide by running Phylostems on an empirical dataset and supply guidance for results interpretation. Availability and implementation: Phylostems is freely available at https://pvbmt-apps.cirad.fr/apps/phylostems.

17.
Nat Commun ; 14(1): 4306, 2023 07 20.
Artículo en Inglés | MEDLINE | ID: mdl-37474518

RESUMEN

Herbarium collections are an important source of dated, identified and preserved DNA, whose use in comparative genomics and phylogeography can shed light on the emergence and evolutionary history of plant pathogens. Here, we reconstruct 13 historical genomes of the bacterial crop pathogen Xanthomonas citri pv. citri (Xci) from infected Citrus herbarium specimens. Following authentication based on ancient DNA damage patterns, we compare them with a large set of modern genomes to estimate their phylogenetic relationships, pathogenicity-associated gene content and several evolutionary parameters. Our results indicate that Xci originated in Southern Asia ~11,500 years ago (perhaps in relation to Neolithic climate change and the development of agriculture) and diversified during the beginning of the 13th century, after Citrus diversification and before spreading to the rest of the world (probably via human-driven expansion of citriculture through early East-West trade and colonization).


Asunto(s)
Citrus , Xanthomonas , Humanos , Filogenia , Xanthomonas/genética , Genómica , Citrus/microbiología , Enfermedades de las Plantas/microbiología
18.
Commun Biol ; 6(1): 103, 2023 01 27.
Artículo en Inglés | MEDLINE | ID: mdl-36707697

RESUMEN

Of American origin, a wide diversity of Xylella fastidiosa strains belonging to different subspecies have been reported in Europe since 2013 and its discovery in Italian olive groves. Strains from the subspecies multiplex (ST6 and ST7) were first identified in France in 2015 in urban and natural areas. To trace back the most probable scenario of introduction in France, the molecular evolution rate of this subspecies was estimated at 3.2165 × 10-7 substitutions per site per year, based on heterochronous genome sequences collected worldwide. This rate allowed the dating of the divergence between French and American strains in 1987 for ST6 and in 1971 for ST7. The development of a new VNTR-13 scheme allowed tracing the spread of the bacterium in France, hypothesizing an American origin. Our results suggest that both sequence types were initially introduced and spread in Provence-Alpes-Côte d'Azur (PACA); then they were introduced in Corsica in two waves from the PACA bridgehead populations.


Asunto(s)
Xylella , Francia , Europa (Continente) , Italia , Xylella/genética
19.
Sci Rep ; 11(1): 21280, 2021 10 28.
Artículo en Inglés | MEDLINE | ID: mdl-34711837

RESUMEN

Emerging viral diseases of plants are recognised as a growing threat to global food security. However, little is known about the evolutionary processes and ecological factors underlying the emergence and success of viruses that have caused past epidemics. With technological advances in the field of ancient genomics, it is now possible to sequence historical genomes to provide a better understanding of viral plant disease emergence and pathogen evolutionary history. In this context, herbarium specimens represent a valuable source of dated and preserved material. We report here the first historical genome of a crop pathogen DNA virus, a 90-year-old African cassava mosaic virus (ACMV), reconstructed from small RNA sequences bearing hallmarks of small interfering RNAs. Relative to tip-calibrated dating inferences using only modern data, those performed with the historical genome yielded both molecular evolution rate estimates that were significantly lower, and lineage divergence times that were significantly older. Crucially, divergence times estimated without the historical genome appeared in discordance with both historical disease reports and the existence of the historical genome itself. In conclusion, our study reports an updated time-frame for the history and evolution of ACMV and illustrates how the study of crop viral diseases could benefit from natural history collections.


Asunto(s)
Begomovirus/genética , Evolución Molecular , Manihot/virología , Enfermedades de las Plantas/genética , Enfermedades de las Plantas/virología , ARN de Planta/genética , Teorema de Bayes , Begomovirus/clasificación , Genoma Viral , Genómica/métodos , Secuenciación de Nucleótidos de Alto Rendimiento , Interacciones Huésped-Patógeno , Filogenia , Análisis de Secuencia de ADN
20.
Microbiol Resour Announc ; 10(1)2021 Jan 07.
Artículo en Inglés | MEDLINE | ID: mdl-33414287

RESUMEN

High-quality Illumina assemblies were produced from 284 Xanthomonas citri pv. citri pathotype A strains mostly originating from the Southwest Indian Ocean region, a subset of which was also sequenced using MinION technology. Some strains hosted chromosomally encoded transcription activator-like effector (TALE) genes, an atypical feature for this bacterium.

SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA