Interweaving of reactive oxygen species and major neurological and psychiatric disorders.

Reactive oxygen species are found to be having a wide range of biological effects ranging from regulating functions in normal physiology to alteration and damaging various processes and cell components causing a number of diseases. Mitochondria are an important organelle responsible for energy production and in many signalling mechanisms. The electron transport chain in mitochondria, where oxidative phosphorylation takes place, is also coupled with the generation of reactive oxygen species (ROS). Changes in normal homeostasis and overproduction of reactive oxygen species by various sources are found to be involved in multiple neurological and major neurodegenerative diseases. This review summarises the role of reactive oxygen species and the mechanism of neuronal loss in major neuronal disorders such as Alzheimer's disease, Parkinson's disease, Huntington's disease, depression, and schizophrenia.

3D printing in pharmaceuticals: An emerging technology full of challenges.

Although in its infancy, when compared with the other sectors, year 2005 marked the rapid evolution of 3 Dimensional printing (3DP) technologies in pharma sector with a huge potential in the dosage form designing and personalisation of the medication. 3DP is an innovative and highly promising way for the instant manufacturing in contrast with the tailored made conventional manufacturing. Various 3DP technologies are categorized into the various areas on the basis of the type of material used, deposition techniques and the solidification/fusion techniques. 3DP technologies have multiple pharmaceutical applications including formulation of the precise and unique dosage forms, medical research, personalization of medicine, tissues engineering and surgical application. In the present article, we have accentuated the comparative merits and demerits of various 3DP technologies used in the pharmaceutical sector. An insight in to the challenges, apropos availability and the choice of the excipients, as well as the printer, regulatory and safety concern of the product is provided.

Spinal navigation for minimally invasive thoracic and lumbosacral spine fixation: implications for radiation exposure, operative time, and accuracy of pedicle screw placement.

PURPOSE: Navigation is emerging as a useful adjunct in percutaneous, minimally invasive spinal surgery (MIS). The aim of this study was to compare C-Arm navigated, O-Arm navigated and conventional 2D-fluoroscopy assisted MIS thoracic and lumbosacral spine fixation techniques in terms of operating time, radiation exposure and accuracy of pedicle screw (PS) placement. METHODS: Retrospective observational study of 152 consecutive adults who underwent MIS fixations for spinal instability: 96 2D-fluoroscopy assisted, 39 3D-C-Arm navigated and 27 using O-Arm navigated. RESULTS: O-Arm navigation significantly reduced PS misplacement (1.23%, p) compared to 3D-C-Arm navigation (7.29%, p = 0.0082) and 2D-fluoro guided placement (5.16%, p = 0379). 3D-C-Arm navigation was associated with lower procedural radiation exposure of the patient (0.4 mSv) than O-Arm navigation (3.24 mSv) or 2D-fluoro guidance (1.5 mSv). Operative time was comparable between three modalities. CONCLUSIONS: O-Arm navigation provides greater accuracy of percutaneous instrumentation placement with an acceptable procedural radiation dose delivered to the patients and comparable operative times. These slides can be retrieved under Electronic Supplementary material.

Spatiotemporal dynamics of oscillatory cellular patterns in three-dimensional directional solidification.

We report results of directional solidification experiments conducted on board the International Space Station and quantitative phase-field modeling of those experiments. The experiments image for the first time in situ the spatially extended dynamics of three-dimensional cellular array patterns formed under microgravity conditions where fluid flow is suppressed. Experiments and phase-field simulations reveal the existence of oscillatory breathing modes with time periods of several 10's of minutes. Oscillating cells are usually noncoherent due to array disorder, with the exception of small areas where the array structure is regular and stable.

Intrathecal morphine in combination with bupivacaine as pre-emptive analgesia in posterior lumbar fusion surgery: a retrospective cohort study.

BACKGROUND: The purpose of this study was to evaluate the efficacy of intrathecal morphine (ITM) in combination with bupivacaine as pre-emptive analgesia in patients undergoing posterior lumbar fusion surgery. This is in comparison with traditional opioid analgesics such as intravenous (IV) morphine. METHODS: Two groups were identified retrospectively. The first (ITM group) included patients who had general anaesthesia (GA) with low-dose spinal anaesthesia prior to induction using 1-4 mls of 0.25% bupivacaine and 0.2 mg ITM. 1 ml of 0.25% bupivacaine was administered per hour of predicted surgery time, up to a maximum of 4 ml. The insertion level for the spinal anaesthetic corresponded to the spinal level of the iliac crest line and the level at which the spinal cord terminated. The control group had GA without any spinal anaesthesia. Patients were instead administered opioid analgesia in the form of IV morphine or diamorphine. The primary outcome was the consumption of opioids administered intraoperatively and in recovery, and over the first 48 h following discharge from the post-anaesthesia care unit (PACU). Total opioid dose was measured, and a morphine equivalent dose was calculated. Secondary outcomes included visual analogue scale (VAS) pain scores in recovery and at day two postoperatively, and the length of stay in hospital. RESULTS: For the ITM group, the median total amount of IV morphine equivalent administered intraoperatively and in recovery, was 0 mg versus 17 mg. The median total amount morphine equivalent, administered over the first 48 h following discharge from PACU was 20 mg versus 80 mg. Both are in comparison with the control group. The median length of stay was over 1 day less and the median VAS for pain in recovery was 6 points lower. No evidence was found for a difference in the worst VAS for pain at day two postoperatively. CONCLUSION: ITM in combination with bupivacaine results in a significantly decreased use of perioperative opioids. In addition, length of hospital stay is reduced and so too is patient perceived pain intensity. Trial registration The study was approved by the ethics committee at The Robert Jones and Agnes Hunt Orthopaedic Hospital as a service improvement project (Approval no. 1617_004).

First Report of Alternaria carotiincultae on Carrot Seed Produced in New Zealand.

Carrot (Daucus carota L.) seed lots produced in Canterbury, New Zealand are commonly infected by the fungal pathogen Alternaria radicina, which can cause abnormal seedlings and decayed seeds. In 2008, samples of 400 seeds from each of three carrot seed crops were tested for germination on moistened paper towels. On average, 30% of the seeds developed into abnormal seedlings or were decayed and were plated onto A. radicina selective agar (2) and acidified potato dextrose agar media and grown for 15 days at 22°C (10 h/14 h light/dark cycle) to confirm the presence of this pathogen (3). However, another fungus was isolated from an average of 8% of the seeds sampled. Colonies of the latter fungus grew faster than those of A. radicina, had smoother margins, and did not produce dendritic crystals or yellow pigment in the agar media. Although conidial size (30 to 59 × 18 to 20 µm), shape (long and ellipsoid), and color (dark olive-brown) were similar for the two fungi, conidia of this novel fungus had more transverse septa (average 3.6 cf. 3.0 per conidium) than those of A. radicina. On the basis of these morphological characteristics, the isolated fungus was identified as A. carotiincultae and the identity was confirmed by sequence analysis. PCR amplification of the ß-tubulin gene from three isolates, using primers Bt1a (5' TTCCCCCGTCTCCACTTCTTCATG 3') and Bt1b (5' GACGAGATCGTTCATGTTGAACTC 3') (1), produced a 420-bp product for each isolate that was sequenced and compared with ß-tubulin sequences present in GenBank. Sequences of all three New Zealand isolates (Accession Nos. HM208752, HM208753, and HM208754) were identical to each other and to six sequences in GenBank (Accession Nos. EU139354/57/58/59/61/62). There was a 2- to 4-bp difference between these sequences and those of A. radicina present in GenBank. Pathogenicity of the three New Zealand isolates of A. carotiincultae was verified on leaves and roots of 3-month-old carrot plants grown in a greenhouse (three plants per pot with 10 replicate pots per isolate). For each isolate, intact leaves of each plant were inoculated with 0.5 ml of a suspension of 106 conidia/ml and the tap root of each plant was inoculated with a 7-mm agar plug colonized by the isolate. Ten pots of control plants were treated similarly with sterile water and noncolonized agar plugs. Each pot was covered with a plastic bag for 12 h and then placed in a mist chamber in a greenhouse with automatic misting every 30 min. At 72 h after inoculation, symptoms comprising medium brown-to-black lesions on the leaves and dark brown-to-black sunken lesions on the roots were clearly visible on inoculated plants but not on the control plants. Reisolation attempts from roots and leaves demonstrated A. carotiincultae to be present in symptomatic leaves and roots of all inoculated plants but not in leaves or roots of the control plants. Symptoms produced by the isolates of A. carotiincultae were similar to those attributed to A. radicina in infected carrot seed fields in Canterbury. The former species may have caused field infections in carrot seed crops in Canterbury. A. carotiincultae was described as a new taxon in Ohio in 1995 (4), and pathogenicity of the species on carrot was reported in California (3). To our knowledge, this is the first report of A. carotiincultae in New Zealand. References: (1) M. S. Park et al. Mycologia 100:511, 2008. (2) B. M. Pryor et al. Plant Dis. 78:452, 1994. (3) B. M. Pryor and R. L. Gilbertson. Mycologia 94:49, 2002. (4) E. G. Simmons. Mycotaxon 55:55, 1995.

Experimental characterization and theoretical analysis of cell tip oscillations in directional solidification.

Experiments performed in DECLIC-DSI on board the International Space Station evidenced oscillatory modes during the directional solidification of a bulk sample of succinonitrile-based transparent alloy. The interferometric data acquired during a reference experiment, V_{p}=1 µm/s and G=19 K/cm, allowed us to reconstruct the cell shape and thus measure the cell tip position, radius, and growth velocity evolution, in order to quantify the dynamics of the oscillating cells. This study completes our previous reports [Bergeon et al., Phys. Rev. Lett. 110, 226102 (2013)10.1103/PhysRevLett.110.226102; Tourret et al., Phys. Rev. E 92, 042401 (2015)10.1103/PhysRevE.92.042401; Pereda et al., Phys. Rev. E 95, 012803 (2017)10.1103/PhysRevE.95.012803] with, to our knowledge, the first complete monitoring of the geometric cell tip characteristics variations in bulk samples. The evolution of the shape, velocity, and position of the tip of the oscillating cells is associated with an evolution of the concentration field, inaccessible experimentally but mediating the diffusive interactions between the cells. The experimental results are supported by 3D phase-field simulations which evidence the existence of transversal solute fluxes between neighboring cells that play a fundamental role in the oscillation dynamics. The dynamics of oscillation of an individual cell is analyzed using a theoretical model based on classical equations of solidification through the calculation of the phase relationships between oscillation of the different tip characteristics.

Arteriovenous malformations.

Arteriovenous malformations (AVMs) represent one of the most complex lesions encountered by the vascular neurosurgeon. They are thought to arise by a developmental aberration early in fetal life leading to structurally abnormal vessels, characterised by arteriovenous shunting. AVMs may present in a number of ways, the most devastating being hemorrhage. Their natural history, particularly hemorrhage risk, has been extensively studied and is crucial in informing management decisions. The primary goal of treatment is to eliminate hemorrhage risk. Success in treating these lesions involves comprehensive evaluation of the lesions to balance the risk of haemorrhage against the risk of treatment. Thus, first the decision whether to treat is made followed by selecting the optimum modality of treatment. Successful surgical treatment of AVMs requires extensive preoperative planning and meticulous microsurgical technique.

Characterisation of carotid atheroma in symptomatic and asymptomatic patients using high resolution MRI.

BACKGROUND AND PURPOSE: To prospectively evaluate differences in carotid plaque characteristics in symptomatic and asymptomatic patients using high resolution MRI. METHODS: 20 symptomatic and 20 asymptomatic patients, with at least 50% carotid stenosis as determined by Doppler ultrasound, underwent preoperative in vivo multispectral MRI of the carotid arteries. Studies were analysed both qualitatively and quantitatively in a randomised manner by two experienced readers in consensus, blinded to clinical status, and plaques were classified according to the modified American Heart Association (AHA) criteria. RESULTS: After exclusion of poor quality images, 109 MRI sections in 18 symptomatic and 19 asymptomatic patients were available for analysis. There were no significant differences in mean luminal stenosis severity (72.9% vs 67.6%; p = 0.09) or plaque burden (median plaque areas 50 mm(2) vs 50 mm(2); p = 0.858) between the symptomatic and asymptomatic groups. However, symptomatic lesions had a higher incidence of ruptured fibrous caps (36.5% vs 8.7%; p = 0.004), haemorrhage or thrombus (46.5% vs 14.0%; p<0.001), large necrotic lipid cores (63.8% vs 28.0%; p = 0.002) and complicated type VI AHA lesions (61.5% vs 28.1%; p = 0.001) compared with asymptomatic lesions. The MRI findings of plaque haemorrhage or thrombus had an odds ratio of 5.25 (95% CI 2.08 to 13.24) while thin or ruptured fibrous cap (as opposed to a thick fibrous cap) had an odds ratio of 7.94 (95% CI 2.93 to 21.51) for prediction of symptomatic clinical status. CONCLUSIONS: There are significant differences in plaque characteristics between symptomatic and asymptomatic carotid atheroma and these can be detected in vivo by high resolution MRI.

Municipal solid waste management in Indian cities - A review.

Municipal solid waste management (MSWM) is one of the major environmental problems of Indian cities. Improper management of municipal solid waste (MSW) causes hazards to inhabitants. Various studies reveal that about 90% of MSW is disposed of unscientifically in open dumps and landfills, creating problems to public health and the environment. In the present study, an attempt has been made to provide a comprehensive review of the characteristics, generation, collection and transportation, disposal and treatment technologies of MSW practiced in India. The study pertaining to MSWM for Indian cities has been carried out to evaluate the current status and identify the major problems. Various adopted treatment technologies for MSW are critically reviewed, along with their advantages and limitations. The study is concluded with a few fruitful suggestions, which may be beneficial to encourage the competent authorities/researchers to work towards further improvement of the present system.

Deep vein thrombosis associated with osteomyelitis.

Three children developed deep vein thrombosis (DVT) along with osteomyelitis of the femur. Although DVT was recognized early, the diagnosis of associated osteomyelitis was delayed due to overlapping clinical signs and the absence of radiological changes in the initial X-rays.

Allele frequency distribution at 15 autosomal STR loci in Panggi, Komkar and Padam sub tribes of Adi, a Tibeto-Burman speaking population of Arunachal Pradesh, India.

Fifteen autosomal STR loci were analyzed in 223 healthy individuals belonging to three remote, isolated Tibeto-Burman speaking sub tribes namely, Panggi, Komkar and Padam of Adi tribe of Arunachal Pradesh, India. The analyzed markers exhibited a high degree of polymorphism in the studied populations. Statistical parameters of forensic interest; observed heterozygosity, probability of homozygosity, exact test, likelihood ratio test, power of discrimination, power of exclusion, match probability and typical paternity index were determined for all loci. The average heterozygosity values were found to be low in the three populations (Panggi: 0.7747; Komkar: 0.7742 and Padam: 0.7663). The combined power of discrimination and power of exclusion were 0.9999 in the studied populations thereby revealing the high forensic significance of the chosen markers. The study indicates the utility of the tested microsatellite markers in forensic human identification, paternity testing and human population genetic studies.

Allele frequencies of 20 Y-chromosomal short tandem repeat loci in a tribal population of Deccan Plateau, India.

POPULATION: Eighty male individuals from a nomadic tribal population belonging to Dravidian and Indo-Caucasian ethnicities from Deccan Plateau, Andhra Pradesh, India, were analyzed in the present study.

Experimental observation of oscillatory cellular patterns in three-dimensional directional solidification.

We present a detailed analysis of oscillatory modes during three-dimensional cellular growth in a diffusive transport regime. We ground our analysis primarily on in situ observations of directional solidification experiments of a transparent succinonitrile 0.24wt% camphor alloy performed in microgravity conditions onboard the International Space Station. This study completes our previous reports [Bergeon et al., Phys. Rev. Lett. 110, 226102 (2013)10.1103/PhysRevLett.110.226102; Tourret et al., Phys. Rev. E 92, 042401 (2015)10.1103/PhysRevE.92.042401] from an experimental perspective, and results are supported by additional phase-field simulations. We analyze the influence of growth parameters, crystal orientation, and sample history on promoting oscillations, and on their spatiotemporal characteristics. Cellular patterns display a remarkably uniform oscillation period throughout the entire array, despite a high array disorder and a wide distribution of primary spacing. Oscillation inhibition may be associated to crystalline disorientation, which stems from polygonization and is manifested as pattern drifting. We determine a drifting velocity threshold above which oscillations are inhibited, thereby demonstrating that inhibition is due to cell drifting and not directly to disorientation, and also explaining the suppression of oscillations when the pulling velocity history favors drifting. Furthermore, we show that the array disorder prevents long-range coherence of oscillations, but not short-range coherence in localized ordered regions. For regions of a few cells exhibiting hexagonal (square) ordering, three (two) subarrays oscillate with a phase shift of approximately ±120^{∘} (180^{∘}), with square ordering occurring preferentially near subgrain boundaries.

Advanced magnetic resonance imaging and neuropsychological assessment for detecting brain injury in a prospective cohort of university amateur boxers.

BACKGROUND/AIM: The safety of amateur and professional boxing is a contentious issue. We hypothesised that advanced magnetic resonance imaging and neuropsychological testing could provide evidence of acute and early brain injury in amateur boxers. METHODS: We recruited 30 participants from a university amateur boxing club in a prospective cohort study. Magnetic resonance imaging (MRI) and neuropsychological testing was performed at three time points: prior to starting training; within 48 h following a first major competition to detect acute brain injury; and one year follow-up. A single MRI acquisition was made from control participants. Imaging analysis included cortical thickness measurements with Advanced Normalization Tools (ANTS) and FreeSurfer, voxel based morphometry (VBM), and Tract Based Spatial Statistics (TBSS). A computerized battery of neuropsychological tests was performed assessing attention, learning, memory and impulsivity. RESULTS: During the study period, one boxer developed seizures controlled with medication while another developed a chronic subdural hematoma requiring neurosurgical drainage. A total of 10 boxers contributed data at to the longitudinal assessment protocol. Reasons for withdrawal were: logistics (10), stopping boxing (7), withdrawal of consent (2), and development of a chronic subdural hematoma (1). No significant changes were detected using VBM, TBSS, cortical thickness measured with FreeSurfer or ANTS, either cross-sectionally at baseline, or longitudinally. Neuropsychological assessment of boxers found attention/concentration improved over time while planning and problem solving ability latency decreased after a bout but recovered after one year. CONCLUSION: While this neuroimaging and neuropsychological assessment protocol could not detect any evidence of brain injury, one boxer developed seizures and another developed a chronic sub-dural haematoma.

Deletions in the Y-derived amelogenin gene fragment in the Indian population.

BACKGROUND: Rare failures in amelogenin-based gender typing of individuals have been observed globally. In this study, we report the deletion of a large fragment of the amelogenin gene in 10 individuals out of 4,257 male samples analyzed from 104 different endogamous populations of India. METHODS: Samples were analyzed using commercial genetic profiling kits. Those that exhibited failures in amelogenin-based gender identification were further analyzed with published as well as newly designed primers to ascertain the nature and extent of mutation. RESULTS: The failure rate among Indian males was 0.23 %. Though the exact size and nature of the deletion (single point mutations at a number of positions or a single large deletion) could not be determined in the present study, it is inferred that the deletion spans a region downstream of the reverse primer-binding site of commercially available amelogenin primer sets. Deletions were conspicuously absent among the Mongoloid tribes of Northeast India, while both caste and tribal groups harbored these mutations, which was predominantly among the Y-chromosomes belonging to J2 lineage. CONCLUSION: Our study indicates that the different amelogenin primer sets currently included in genetic profiling multiplex kits may result in erroneous interpretations due to mutations undetectable during routine testing. Further there are indications that these mutations could possibly be lineage-specific, inherited deletions.

Genetic structure of Indian populations based on fifteen autosomal microsatellite loci.

BACKGROUND: Indian populations endowed with unparalleled genetic complexity have received a great deal of attention from scientists world over. However, the fundamental question over their ancestry, whether they are all genetically similar or do exhibit differences attributable to ethnicity, language, geography or socio-cultural affiliation is still unresolved. In order to decipher their underlying genetic structure, we undertook a study on 3522 individuals belonging to 54 endogamous Indian populations representing all major ethnic, linguistic and geographic groups and assessed the genetic variation using autosomal microsatellite markers. RESULTS: The distribution of the most frequent allele was uniform across populations, revealing an underlying genetic similarity. Patterns of allele distribution suggestive of ethnic or geographic propinquity were discernible only in a few of the populations and was not applicable to the entire dataset while a number of the populations exhibited distinct identities evident from the occurrence of unique alleles in them. Genetic substructuring was detected among populations originating from northeastern and southern India reflective of their migrational histories and genetic isolation respectively. CONCLUSION: Our analyses based on autosomal microsatellite markers detected no evidence of general clustering of population groups based on ethnic, linguistic, geographic or socio-cultural affiliations. The existence of substructuring in populations from northeastern and southern India has notable implications for population genetic studies and forensic databases where broad grouping of populations based on such affiliations are frequently employed.

Assessment of white matter damage in subacute sclerosing panencephalitis using quantitative diffusion tensor MR imaging.

BACKGROUND AND PURPOSE: Subacute sclerosing panencephalitis (SSPE), a rare progressive degenerative disease, is caused by persistent infection with a defective measles virus. The correlation between the clinical staging and MR imaging is usually poor. The aim of the study was to investigate the role of diffusion tensor imaging (DTI) in the early detection of white matter damage in SSPE in the presence of normal findings on conventional imaging. METHODS: DTI was performed in 21 patients in stage II SSPE and 10 age/sex-matched healthy controls. Fractional anisotropy (FA) and mean diffusivity (MD) values were calculated in the periventricular white matter, corpus callosum, and posterior limb of the internal capsule in patients with normal and abnormal findings on conventional imaging as well as healthy controls. RESULTS: The patients were grouped into those with normal (n = 11) and abnormal (n = 10) findings on conventional imaging for the purpose of quantitative DTI analysis. Abnormal- and normal-appearing white matter on T2-weighted images showed significantly decreased FA values in all the regions compared with those in healthy controls. MD values were significantly increased in the periventricular white matter region of the frontal and parietooccipital lobe in patients with normal as well as abnormal findings on conventional imaging compared with those in healthy controls. CONCLUSION: DTI detects early white matter abnormalities that may have significant therapeutic implication, even in the presence of normal findings on conventional imaging, in patients with SSPE.

Polymorphisms at fifteen tetrameric short tandem repeat loci in three ethnic populations of Bengal, India.

The study presents allele frequency data at 15 tetrameric short tandem repeat (STR) loci (D3S1358, THO1, D21S11, D18S51, D5S818, D13S317, D7S820, D16S539, CSF1PO, vWA, D8S1179, TPOX, D2S1338, D19S433 and FGA) in three ethnic populations--Mahishya, Bauri and Namasudra of Bengal to evaluate their utility in Forensic testing and understanding population structure and dynamics. A total of 169 individuals were studied from the selected populations. On an average the combined power of discrimination and power of exclusion in these groups was found 0.97 and 0.99, respectively. The allele distribution pattern shows possible genetic admixture between these ethnic groups which could be attributed to their close geographical proximity and occupying almost similar position in the social hierarchy. This study suggests that the 13 Combined DNA Index System (CODIS) markers and two added markers named D2S1338, D19S433 are highly informative and therefore suitable in matching biological specimen in human identification and population genetic study.

Genetic polymorphism at 15 tetrameric short tandem repeat loci in four aboriginal tribal populations of Bengal.

POPULATIONS: This study reports the genetic polymorphism observed at 15 short tandem repeat loci D3S1358, TH01, D21S11, D18S51, D5S818, D13S317, D7S820, D16S539, CSF1PO, vWA, D8S1179, TPOX, D2S1338, D19S433, and FGA in four aboriginal populations of Bengal. The analysis was performed to decipher the suitability of CODIS as well as six other highly polymorphic and unlinked markers in Forensic Testing. Studied populations include four tribes: Karmali, Kora, Maheli, and Lodha.