Transcriptome analysis of Citrus limon infected with Citrus yellow vein clearing virus.

BACKGROUND: Citrus yellow vein clearing virus (CYVCV) is the causative agent of citrus yellow vein clearing disease, and poses a serious threat to the lemon industry in Asia. The common symptoms of CYVCV-infected lemon plants are leaf crinkling, leaf chlorotic mottling, and yellow vein clearing. However, the molecular mechanisms underlying CYVCV-citrus interaction that responsible for symptom occurrence is still unclarified. In this study, RNA-seq was performed to analyze the gene expression patterns of 'Eureka' lemon (Citrus limon Burm. f.) plants in response to CYVCV infection. RESULTS: There were 3691 differentially expressed genes (DEGs) identified by comparison between mock and CYVCV-infected lemon plants through RNA-seq. Bioinformatics analyses revealed that these DEGs were components of different pathways involved in phenylpropanoid biosynthesis, brassinosteroid biosynthesis, flavonoid biosynthesis and photosynthesis. Among these, the DEGs related to phytohormone metabolism and photosynthesis pathways were further enriched and analyzed. This study showed that different phytohormone-related genes had different responses toward CYVCV infection, however almost all of the photosynthesis-related DEGs were down-regulated in the CYVCV-infected lemon plants. The obtained RNA-seq data were validated by RT-qPCR using 12 randomly chosen genes, and the results of mRNA expression analysis were consistent with those of RNA-seq. CONCLUSIONS: The phytohormone biosynthesis, signaling and photosynthesis-related genes of lemon plants were probably involved in systemic infection and symptom occurrence of CYVCV. Notably, CYVCV infection had regulatory effects on the biosynthesis and signaling of phytohormone, which likely improve systemic infection of CYVCV. Additionally, CYVCV infection could cause structural changes in chloroplast and inhibition of photosynthesis pathway, which probably contribute to the appearance of leaf chlorotic mottling and yellow vein clearing in CYVCV-infected lemon plants. This study illustrates the dynamic nature of the citrus-CYVCV interaction at the transcriptome level and provides new insights into the molecular mechanism underlying the pathogenesis of CYVCV in lemon plants.

Promoter characterization of a citrus linalool synthase gene mediating interspecific variation in resistance to a bacterial pathogen.

BACKGROUND: Terpenoids play essential roles in plant defense against biotic stresses. In Citrus species, the monoterpene linalool mediates resistance against citrus canker disease caused by the gram-negative bacteria Xanthomonas citri subsp. citri (Xcc). Previous work had associated linalool contents with resistance; here we characterize transcriptional responses of linalool synthase genes. RESULTS: Leaf linalool contents are highly variable among different Citrus species. "Dongfang" tangerine (Citrus reticulata), a species with high linalool levels was more resistant to Xcc than "Shatian" pummelo (C. grandis) which accumulates only small amounts of linalool. The coding sequences of the major leaf-expressed linalool synthase gene (STS4) are highly conserved, while transcript levels differ between the two Citrus species. To understand this apparent differential transcription, we isolated the promoters of STS4 from the two species, fused them to a GUS reporter and expressed them in Arabidopsis. This reporter system revealed that the two promoters have different constitutive activities, mainly in trichomes. Interestingly, both linalool contents and STS4 transcript levels are insensitive to Xcc infestation in citrus plants, but in these transgenic Arabidopsis plants, the promoters are activated by challenge of a bacterial pathogen Pseudomonas syringae, as well as wounding and external jasmonic acid treatment. CONCLUSIONS: Our study reveals variation in linalool and resistance to Xcc in citrus plants, which may be mediated by different promoter activities of a terpene synthase gene in different Citrus species.

Viromics unveils extraordinary genetic diversity of the family Closteroviridae in wild citrus.

Our knowledge of citrus viruses is largely skewed toward virus pathology in cultivated orchards. Little is known about the virus diversity in wild citrus species. Here, we used a metatranscriptomics approach to characterize the virus diversity in a wild citrus habitat within the proposed center of the origin of citrus plants. We discovered a total of 44 virus isolates that could be classified into species Citrus tristeza virus and putative species citrus associated ampelovirus 1, citrus associated ampelovirus 2, and citrus virus B within the family Closteroviridae, providing important information to explore the factors facilitating outbreaks of citrus viruses and the evolutionary history of the family Closteroviridae. We found that frequent horizontal gene transfer, gene duplication, and alteration of expression strategy have shaped the genome complexity and diversification of the family Closteroviridae. Recombination frequently occurred among distinct Closteroviridae members, thereby facilitating the evolution of Closteroviridae. Given the potential emergence of similar wild-citrus-originated novel viruses as pathogens, the need for surveillance of their pathogenic and epidemiological characteristics is of utmost priority for global citrus production.

An effector of 'Candidatus Liberibacter asiaticus' manipulates autophagy to promote bacterial infection.

Autophagy functions in plant host immunity responses to pathogen infection. The molecular mechanisms and functions used by the citrus Huanglongbing (HLB)-associated intracellular bacterium 'Candidatus Liberibacter asiaticus' (CLas) to manipulate autophagy are unknown. We identified a CLas effector, SDE4405 (CLIBASIA_04405), which contributes to HLB progression. 'Wanjincheng' orange (Citrus sinensis) transgenic plants expressing SDE4405 promotes CLas proliferation and symptom expression via suppressing host immunity responses. SDE4405 interacts with the ATG8-family of proteins (ATG8s), and their interactions activate autophagy in Nicotiana benthamiana. The occurrence of autophagy is also significantly enhanced in SDE4405-transgenic citrus plants. Interrupting NbATG8s-SDE4405 interaction by silencing of NbATG8c reduces Pseudomonas syringae pv. tomato strain DC3000ΔhopQ1-1 (Pst DC3000ΔhopQ1-1) proliferation in N. benthamiana, and transient overexpression of CsATG8c and SDE4405 in citrus promotes Xanthomonas citri subsp. citri (Xcc) multiplication, suggesting that SDE4405-ATG8s interaction negatively regulates plant defense. These results demonstrate the role of the CLas effector protein in manipulating autophagy, and provide new molecular insights into the interaction between CLas and citrus hosts.

First Report of citrus virus A infecting citrus (Citrus reticulata Blanco) in China.

Citrus is one of the most popular fruit crops in the world. Citrus virus A (CiVA, species Coguvirus eburi, genus Coguvirus) is a newly identified virus (Navarro et al. 2018) with two negative-sense single-stranded RNAs (RNA1 and RNA2). To date, CiVA has been detected on different citrus species in South Africa, U.S.A. and Greece (Bester et al. 2021; Park et al. 2021; Beris et al. 2021). CiVA has not been reported in China. In Sept. 2018, virus-like symptoms of leaf mottling, leaf flecking, and oak leaf patterns were observed on 'Orah' mandarin (Or) and 'Harumi' tangor (Ht) trees grown in Neijiang (NJ, Sichuan Province) and on Citrus reticulata cv.'Jinqiushatangju' (Jq) trees in Guizhou Province (GZ). Two mixed leaf samples (HY-NJ: 1 Or and 1 Ht and GZ-1: 2 Jq) were collected from symptomatic trees and then subjected to high-throughput sequencing (HTS). Total RNA was extracted by TRIzol. The cDNA library was constructed after depleting ribosomal RNA using a TruSeq RNA Sample Prep Kit and sequenced by Illumina HiSeq X-ten platform with paired-end reads length of 150 bp. After removing adaptors, low-quality reads, and reads homologous to citrus hosts by CLC Genomics Workbench 11 (Qiagen, U.S.A.), 917,547 and 1,508,134 clean reads were obtained from 56,239,772 and 81,535,900 total reads for HY-NJ and GZ-1, respectively. De novo assembly of the clean reads by CLC Genomics Workbench 11 resulted in 2,181 contigs for HY-NJ and 3,718 contigs for GZ-1. BLASTX searches of the contigs against local virus (taxid:10239) and viroid datasets (taxid:2559587) downloaded from NCBI allowed identification of several viruses and viroids. CiVA, citrus leaf blotch virus, citrus yellow vein clearing virus (CYVCV), and citrus psorosis virus (CPsV) were detected in HY-NJ. CiVA, hop stunt viroid, citrus viroid VI, citrus viroid V, citrus exocortis viroid, citrus dwarfing viroid, citrus bent leaf viroid, citrus bark cracking viroid, CYVCV, citrus tristeza virus, apple stem grooving virus, and CPsV were also detected in GZ-1. The lengths of the CiVA contigs were 6,682-nt and 6,670-nt matching RNA1 and 2,728-nt and 2,715-nt matching RNA2, respectively. The average coverage depth of clean reads mapped to CiVA-related contigs in HY-NJ was 64.90 and 156.54 for RNA1 and RNA2, respectively, and 26.50 and 558.08 in GZ-1. The full-length genomes of CiVA in HY-NJ and GZ-1 were determined by Sanger sequencing of six overlapping cDNA fragments obtained by RT-PCR and 5' and 3' RACE. At least 5 molecular clones were randomly selected for each fragment. The NJ isolate had a 6,690 nt RNA1 (GenBank accession no. MZ436805) and a 2,740 nt RNA2 (MZ436807). The GZ isolate had a 6,688 nt RNA1 (MZ436804) and a 2,734 nt RNA2 (MZ436806). BLASTN showed that the NJ and GZ isolates have 99.31 to 99.60% sequence identity to the isolate CG301 (MT922052; MT9220523). A phylogenetic tree constructed from nucleotide sequences indicated that the NJ and GZ isolates are closely related to the CG301 isolate. Among 105 citrus samples (35 Or and 30 Ht from NJ and 50 Jq from GZ) randomly collected, 11 samples (4 Or, 2 Ht and 5 Jq) with similar symptoms tested positive by RT-PCR using generic primers designed from conservative regions of RNA2 (F: TTGCAGTAGTGAGAAGGGAGT; R: TCAAAAGAGGCAGTGGTAGGA). To our knowledge, this is the first report of CiVA infecting citrus trees in China. The results will help facilitate further research to assess the threat of CiVA to citrus growing areas in China.

Population Diversity of 'Candidatus Liberibacter asiaticus' and Diaphorina citri in Sichuan: A Case Study for Huanglongbing Monitoring and Interception.

Citrus huanglongbing (HLB) is present in 10 provinces in China and is associated with 'Candidatus Liberibacter asiaticus' (CLas), which is transmitted by the Asian citrus psyllid (Diaphorina citri, ACP). To date, HLB and ACP have expanded to Yibin city of Sichuan Province, posing an imminent threat to the citrus belt of the upper and middle reaches of the Yangtze River, an important late-maturing citrus-producing area in China. To understand the epidemiological route of CLas and ACP in newly invaded regions of Sichuan and thereby better establish an HLB interception zone ranging from Leibo to Yibin, we evaluated the molecular variability of 19 CLas draft genomes from citrus or dodder (Cuscuta campestris). They include three type-specific prophage loci, three variable number tandem repeat loci, a miniature inverted-repeat transposable element, and population diversity of 44 ACP mitochondrial genomes. The results indicated that CLas isolates in the newly invaded area (Pingshan) were more diverse than those in the HLB endemic areas (Leibo and Ningnan). Phylogenetic analysis based on mitochondrial genomes demonstrated that ACPs in Leibo, Pingshan, and Xuzhou (rural areas) represent a new mitochondrial group (MG4), distinguished by the three unique single-nucleotide polymorphisms in cox1, nad4, and cytb. However, the ACPs sampled from the urban areas of Cuiping and Xuzhou belonged to the southeastern China group (MG2-1). Altogether, our study revealed multiple sources of ACP and CLas in the HLB interception zone and proposed their transmission route. This study contributes to the formulation of precise HLB prevention and control strategies in the HLB interception zone in Sichuan and could be useful for HLB management efforts in other regions.

The Titer of Citrus Yellow Vein Clearing Virus Is Positively Associated with the Severity of Symptoms in Infected Citrus Seedlings.

Citrus yellow vein clearing virus (CYVCV), a new member of the genus Mandarivirus in the family Alphaflexiviridae, is the causal agent of citrus yellow vein clearing disease. CYVCV is transmitted to citrus by Dialeurodes citri, grafting, and contaminated knife blades, threatening citrus production. In this study, four infectious full-length complementary DNA clones of CYVCV (namely AY112, AY132, AY212, and AY221) derived from CYVCV isolate AY were obtained through yeast homologous recombination and inoculated to 'Eureka' lemon (Citrus limon Burm. f.) by Agrobacterium-mediated vacuum infiltration. Pathogenicity analysis indicated that the clones AY212 and AY221 caused more severe symptoms than AY112 and AY132. Northern blot and quantitative reverse transcription PCR analyses showed that the titers of virulent clones (AY212 and AY221) were significantly higher than those of attenuated clones (AY112 and AY132) in the infected 'Eureka' lemon seedlings. Subsequent comparative studies of viral infectivity, accumulation, and symptoms induced by AY221 in nine citrus cultivars indicated that the infectivity of AY221 varied from 25 to 100% between cultivars; 'Oota' ponkan (C. reticulata L.) showed the lowest infection rate, with mild symptoms, which might be a useful resource for CYVCY-resistance genes; and CYVCV titer was positively associated with the symptom development in infected citrus seedlings. In general, this report revealed the biological properties of CYVCV, thus laying a foundation for further investigation of pathogenic mechanisms in this virus.

Complete genome sequence of camellia virus A, a tentative new member of the genus Waikavirus.

A new positive-strand RNA virus genome was discovered in Camellia japonica plants. The complete genome of the virus is 12,570 nt in size, excluding the poly(A) tail, and contains one large open reading frame (ORF1) and two small open reading frames (ORF2, ORF3). ORF1 and ORF2 are homologous to sequences of waikaviruses, while ORF3 has no relatives in the databases. ORF1 encodes a putative polyprotein precursor that is putatively processed into eight smaller proteins, as in typical waikaviruses. Comprehensive analysis, including BLAST searches, genome organization and pairwise sequence comparisons, and phylogeny reconstructions, invariably placed the virus with the waikaviruses. Furthermore, due to lower amino acid sequence identity to known waikaviruses than the threshold species demarcation cutoff, this virus may represent a new species in the genus Waikavirus, family Secoviridae, and we have tentatively named it "camellia virus A" (CamVA). Finally, a field survey was conducted to assess the occurrence of CamVA in camellias and its associated symptoms.

Two Unique Prophages of 'Candidatus Liberibacter asiaticus' Strains from Pakistan.

'Candidatus Liberibacter asiaticus' (CLas) is a pathogen causing Huanglongbing (HLB, yellow shoot disease), which is highly destructive to citrus production. The CLas strains harbor prophages. We identified two unique prophages, designated as P-PA19-1 and P-PA19-2, in CLas strain PA19 from Pakistan using next-generation sequencing analysis. P-PA19-1 prophage has high sequence similarity (identity: 78.23%) at the early-gene region of prophage SC1 (Type 1), but it is significantly divergent in the late-gene region (identity: 62.03%). P-PA19-2 was highly similar to SC2 (Type 2) in the late gene region (identity: 97.96%), and also in the early gene region except for a deletion of a 7,179-bp nucleotide sequence that contains a CRISPR/cas system in SC2. Both P-PA19-1 and P-PA19-2 had circular plasmid forms, and only P-PA19-2 was found integrated in the PA19 chromosome. The two new prophages were only found in Pakistani samples. Identification of prophages enhances our understanding of CLas genomic diversity and also the biology and evolution of CLas prophages.

Natural Defect of a Plant Rhabdovirus Glycoprotein Gene: A Case Study of Virus-Plant Coevolution.

Seven isolates of a putative cytorhabdovirus (family Rhabdoviridae, order Mononegavirales) designated as citrus-associated rhabdovirus (CiaRV) were identified in citrus, passion fruit, and paper bush from the same geographical area in China. CiaRV, bean-associated cytorhabdovirus (Brazil), and papaya virus E (Ecuador) should be taxonomically classified in the species Papaya cytorhabdovirus. Due to natural mutations, the glycoprotein (G) and P4 genes were impaired in citrus-infecting isolates of CiaRV, resulting in an atypical rhabdovirus genome organization of 3' leader-N-P-P3-M-L-5' trailer. The P3 protein of CiaRV shared a common origin with begomoviral movement proteins (family Geminiviridae). Secondary structure analysis and trans-complementation of movement-deficient tomato mosaic virus and potato virus X mutants by CiaRV P3 supported its function in viral cell-to-cell trafficking. The wide geographical dispersal of CiaRV and related viruses suggests an efficient transmission mechanism, as well as an underlying risk to global agriculture. Both the natural phenomenon and experimental analyses demonstrated presence of the "degraded" type of CiaRV in citrus, in parallel to "undegraded" types in other host plant species. This case study shows a plant virus losing the function of an important but nonessential gene, likely due to host shift and adaption, which deepened our understanding of course of natural viral diversification.

An atherosclerotic plaque-targeted single-chain antibody for MR/NIR-II imaging of atherosclerosis and anti-atherosclerosis therapy.

BACKGROUND: Oxidation-specific epitopes (OSEs) are rich in atherosclerotic plaques. Innate and adaptive immune responses to OSEs play an important role in atherosclerosis. The purpose of this study was to develop novel human single-chain variable fragment (scFv) antibody specific to OSEs to image and inhibit atherosclerosis. RESULTS: Here, we screened a novel scFv antibody, named as ASA6, from phage-displayed human scFv library. ASA6 can bind to oxidized LDL (Ox-LDL) and atherosclerotic plaques. Meanwhile, ASA6 can also inhibit the uptake of Ox-LDL into macrophage to reduce macrophage apoptosis. The atherosclerotic lesion area of ApoE-/- mice administrated with ASA6 antibody was significantly reduced. Transcriptome analysis reveals the anti-atherosclerosis effect of ASA6 is related to the regulation of fatty acid metabolism and inhibition of M1 macrophage polarization. Moreover, we conjugated ASA6 antibody to NaNdF4@NaGdF4 nanoparticles for noninvasive imaging of atherosclerotic plaques by magnetic resonance (MR) and near-infrared window II (NIR-II) imaging. CONCLUSIONS: Together, these data demonstrate the potential of ASA6 antibody in targeted therapy and noninvasive imaging for atherosclerosis.

Complete genome sequence of citrus yellow spot virus, a newly discovered member of the family Betaflexiviridae.

A novel plant virus with a positive single-stranded (+ss) RNA genome was detected in Taibei pomelo (Citrus grandis (L.) Osbeck cv. Taibeiyou) in China by high-throughput sequencing (HTS). Tentatively named "citrus yellow spot virus" (CiYSV), it has 8,061 nucleotides (nt) excluding the poly(A) tail and contains three open reading frames (ORFs). ORF1 is predicted to encode a replicase polyprotein (RP) with conserved domains typical of members of the family Betaflexiviridae. ORF2 encodes a protein sharing the highest sequence identity with the putative movement protein (MP) found in the negative-stranded RNA virus Trifolium pratense virus B (TpVB, MH982249, genus Cytorhabdovirus). ORF3 overlaps ORF2 by 137 nt and encodes a predicted coat protein (CP) that is distantly related to those of betaflexiviruses. Phylogenetic analysis based on the MP amino acid sequence showed that the CiYSV clustered with cytorhabdoviruses rather than betaflexiviruses, whilst trees based on the whole genome, RP, and CP showed it to belong to the family Betaflexiviridae but to be distinct from any other known betaflexiviruses. These results suggest that the CiYSV should be considered the first member of a tentative new genus in the family Betaflexiviridae.

Complete nucleotide sequence of loquat virus A, a member of the family Betaflexiviridae with a novel genome organization.

Analysis of a loquat tree with leaf curl symptoms by deep sequencing revealed a novel virus with a single-stranded RNA genome, for which the name "loquat virus A" (LoVA) was proposed. The complete genome sequence comprised 7553 nucleotides (nt) and an additional poly(A) tail at the 3' terminus. Sequence comparisons of LoVA showed moderate similarity to cherry virus A (CVA), currant virus A (CuVA), and mume virus A (MuVA), which are members of the genus Capillovirus in the family Betaflexiviridae. Phylogenetic analysis of the full-genome nt sequence and replicase-like protein supported the placement of LoVA within the genus Capillovirus. However, it has a distinct genome organization, differing from recognized capilloviruses, as it contains three open reading frames (ORFs), with the coat protein (CP) expressed separately from the replication-associated protein (RP) rather than being encoded in the same ORF. This indicates that LoVA is a novel member of the genus Capillovirus in the family Betaflexiviridae with a distinct genomic organization.

Genome Sequence Resources of Two 'Candidatus Liberibacter asiaticus' Strains from Pakistan.

'Candidatus Liberibacter asiaticus' (CLas) is an unculturable, phloem-restricted αProteobacteria, associated with citrus Huanglongbing (HLB), which is one of the most destructive diseases in citrus production worldwide. Here, we present the genome sequences of CLas strains PA19 and PA20 from HLB-affected kinnow trees in Multan, Punjab Province, Pakistan. The CLas genomes of PA19 and PA20 comprise 1,224,156 bp and 1,226,225 bp, respectively, with an average GC content of 36.4%. Both harbored the Type 2 prophage. In this study, we report two CLas genomes from Pakistan, which extends the sequence database of CLas and will contribute to CLas biology and HLB management.

Discovery and Survey of a New Mandarivirus Associated with Leaf Yellow Mottle Disease of Citrus in Pakistan.

During biological indexing for viruses in citrus trees, in a collection of Symons sweet orange (SSO) (Citrus sinensis L. Osbeck) graft inoculated with bark tissues of citrus trees from the Punjab Province in Pakistan, several SSO trees exhibited leaf symptoms of vein yellowing and mottle. High-throughput sequencing by Illumina of RNA preparation depleted of ribosomal RNAs from one symptomatic tree, followed by BLAST analyses, allowed identification of a novel virus, tentatively named citrus yellow mottle-associated virus (CiYMaV). Genome features of CiYMaV are typical of members of the genus Mandarivirus (family Alphaflexiviridae). Virus particles with elongated flexuous shape and size resembling those of mandariviruses were observed by transmission electron microscopy. The proteins encoded by CiYMaV share high sequence identity, conserved motifs, and phylogenetic relationships with the corresponding proteins encoded by Indian citrus ringspot virus (ICRSV) and citrus yellow vein clearing virus (CYVCV), the two current members of the genus Mandarivirus. Although CYVCV is the virus most closely related to CiYMaV, the two viruses can be serologically and biologically discriminated from each other. A reverse-transcription PCR method designed to specifically detect CiYMaV revealed high prevalence (62%) of this virus in 120 citrus trees from the Punjab Province, Pakistan, where the novel virus was found mainly in mixed infection with CYVCV and citrus tristeza virus. However, a preliminary survey on samples from 200 citrus trees from the Yunnan Province, China failed to detect CiYMaV in this region, suggesting that the molecular, serological, and biological data provided here are timely and can help to prevent the spread of this virus in citrus-producing countries.

Transcriptomic analyses reveal physiological changes in sweet orange roots affected by citrus blight.

BACKGROUND: Citrus blight is a very important progressive decline disease of commercial citrus. The etiology is unknown, although the disease can be transmitted by root grafts, suggesting a viral etiology. Diagnosis is made by demonstrating physical blockage of xylem cells that prevents the movement of water. This test was used to identify symptomatic trees from four commercial groves in Florida. Total RNA extracts of phloem-enriched scaffold root tissues were prepared from seven trees that failed to take up water and from one healthy tree. These RNA extracts were used for transcriptomic analyses using paired end RNA-Seq from an Illumina 2500 system. The expression of transcripts annotated as polyprotein of citrus endogenous pararetrovirus were estimated by both RT-qPCR and RNA-Seq. RESULTS: Transcripts from seven RNA-Seq libraries from trees affected by citrus blight were compared to a control tree. 129-148 million RNA fragments (two paired-end reads/fragment) were generated per library and were mapped to the sweet orange reference genome. In response to citrus blight stress, genes encoding aquaporins, proteins with water channel activity and several cellulose synthase genes were down-regulated, whereas genes involved in lignin and glucosinolate biosynthesis were up-regulated. Transcripts encoding proteins in pathways of carbohydrate metabolism, nucleotide synthesis, signaling, hormone metabolism, secondary metabolism, transport, and biotic stress pathways were overwhelmingly down regulated in all libraries. CONCLUSION: Reduced water intake and xylem plugging were observed in the trees tested and the changes in their transcriptome were analyzed. Plants adapted to reduced water flow by regulating primary and secondary metabolism, nuclear transport and hormone associated pathways. The patterns of energy generation, transcription, translation and protein degradation were consistent with irreversible decline. The down regulation of cellulose synthase transcripts and up regulation of transcripts related to lignin production likely lead to an imbalance in the pathways leading to wood formation, and may lead to the blockage of the xylem vessels seen as the cardinal symptom of citrus blight. Transcripts of a pararetrovirus were elevated in the transcriptome of roots used in this study.

LncRNA LEF1-AS1 regulates the migration and proliferation of vascular smooth muscle cells by targeting miR-544a/PTEN axis.

Long noncoding RNAs (lncRNAs) play important roles in endothelium development. A lncRNA, LEF1-AS1, is recently emerging as a potent mediator of the proliferation and migration of a number of cells, including smooth muscle cells. However, the effects of LEF1-AS1 in atherosclerosis remains largely unknown. Specimens from patients with coronary artery atherosclerosis were collected. The quantitative real-time polymerase chain reaction was used to analyze levels of LEF1-AS1 and microRNA-544a (miR-544a). Western blot analysis was used to assess PTEN, P-Akt, and T-Akt protein expression. Proliferation, migration, and invasion of cells were analyzed by cell counting kit-8 assay, scratch wound assay, and transwell assay, respectively. The interaction between LEF1-AS1, miR-544a, and PTEN was probed using bioinformatical analysis and dual-luciferase assay. In plasma and tissue of patients with coronary artery atherosclerosis, LEF1-AS1 was upregulated and miR-544a was downregulated. A negative correlation was found between LEF1-AS1 and miR-544a. miR-544a overexpression reversed the inhibition of LEF1-AS1 in smooth muscle cell proliferation and invasion, which were mediated through the PTEN pathway. LEF1-AS1 regulates smooth muscle cell proliferation and migration through the miR-544a/PTEN axis, indicating that LEF1-AS1 may be a potential therapeutic target in atherosclerosis.

Biological and transcriptomic studies reveal hfq is required for swimming, biofilm formation and stress response in Xanthomonas axonpodis pv. citri.

BACKGROUND: Hfq is a widely conserved bacterial RNA-binding protein which generally mediates the global regulatory activities involv ed in physiological process and virulence. The goal of this study was to characterize the biological function of hfq gene in Xanthomonas axonpodis pv. citri (Xac), the causal agent of citrus canker disease. RESULTS: An hfq mutant in Xac was generated by plasmid integration. The loss of hfq resulted in attenuation of bacterial growth, motility and biofilm formation. In addition, the hfq mutation impaired Xac resistance to H2O2 and both high and low pH environments, but did not affect the virulence to citrus. RNA-Seq analyses indicated that Hfq played roles in regulating the expression of 746 genes. In hfq mutant, gene expression related to chemotaxis, secretion system, two-component system, quorum sensing and flagellar assembly were repressed, whereas expression of ribosomal genes were significantly up-regulated. The down-regulated expression of three bacterial chemotaxis related genes and seven flagella genes, which involved in cell growth and biofilm formation, were further validated by RT-qPCR. CONCLUSIONS: The study demonstrated that hfq was involved in multiple biological processes in Xac. The results could serve as initiate points for identifying regulatory sRNAs and genes controlled by Hfq-sRNA interactions in Xac.

Development of a sensitive and reliable reverse transcription droplet digital PCR assay for the detection of citrus yellow vein clearing virus.

In 2009, a new viral disease of citrus caused by citrus yellow vein clearing virus (CYVCV) was first discovered in China. CYVCV is considered to be the most serious pathogen affecting lemon production. In this study, a sensitive and reliable reverse transcription droplet digital polymerase chain reaction (RT-ddPCR) assay was developed to detect and quantify CYVCV without references. The specificity of the assay was demonstrated by its failure to amplify other relevant citrus viruses. The quantitative linearity, sensitivity and accuracy of RT-ddPCR for detecting CYVCV were compared to those of real-time RT-PCR. The results showed that both methods had a high degree of linearity (R2 = 0.9776) and quantitative correlation. Furthermore, RT-ddPCR was found to be 100 times more sensitive than real-time RT-PCR, and it can therefore be used to detect CYVCV in individual arthropods. In summary, the results demonstrated that the RT-ddPCR assay is a promising approach for quantitative detection of CYVCV with high precision and accuracy.