Differential usage of transcriptional repressor Zeb2 enhancers distinguishes adult and embryonic hematopoiesis.

The transcriptional repressor ZEB2 regulates development of many cell fates among somatic, neural, and hematopoietic lineages, but the basis for its requirement in these diverse lineages is unclear. Here, we identified a 400-basepair (bp) region located 165 kilobases (kb) upstream of the Zeb2 transcriptional start site (TSS) that binds the E proteins at several E-box motifs and was active in hematopoietic lineages. Germline deletion of this 400-bp region (Zeb2Δ-165mice) specifically prevented Zeb2 expression in hematopoietic stem cell (HSC)-derived lineages. Zeb2Δ-165 mice lacked development of plasmacytoid dendritic cells (pDCs), monocytes, and B cells. All macrophages in Zeb2Δ-165 mice were exclusively of embryonic origin. Using single-cell chromatin profiling, we identified a second Zeb2 enhancer located at +164-kb that was selectively active in embryonically derived lineages, but not HSC-derived ones. Thus, Zeb2 expression in adult, but not embryonic, hematopoiesis is selectively controlled by the -165-kb Zeb2 enhancer.

Paeonol inhibits human lung cancer cell viability and metastasis in vitro via miR-126-5p/ZEB2 axis.

Paeonol exerted an effect in lung cancer, but the underlying mechanism remained vague. In this research, we assessed the effects of Paeonol and microRNA (miR)-126-5p on the viability, migration, invasion, and epithelial-mesenchymal transition (EMT) of lung cancer cells. Lung cancer cells and BEAS-2B cells were treated with Paeonol, and viability was detected by 3-(4,5)-dimethylthiahiazo (-z-y1)-3,5-di- phenytetrazoliumromide (MTT) assay. The migration and invasion of lung cancer cells after treatment with Paeonol at 40 µg/mL or 80 µg/mL were detected by wound healing assay and Transwell assay, respectively. The effects of Paeonol on transforming growth factor-ß1 (TGF-ß1)-induced EMT and relative expressions of EMT-related proteins were determined using Western blot. The target gene of miR-126-5p and the binding sites between them were predicted by TargetScan, and confirmed using dual-luciferase reporter assay. Relative expressions of miR-126-5p, its target gene and EMT-related proteins were determined by quantitative real-time polymerase chain reaction (qRT-PCR) and Western blot. Rescue assay was performed to analyze the relation between Paeonol and miR-126-5p. Paeonol down-regulated cell viability and inhibited migration, invasion and TGF-ß1-induced EMT while up-regulating miR-126-5p expression in lung cancer cells as the dose increased. However, miR-126-5p inhibitor could reverse the effect of Paeonol. ZEB2 was the target gene of miR-126-5p, and silencing ZEB2 expression reversed the effects of miR-126-5p downregulation. Paeonol also regulated the expression of ZEB2 in lung cancer cells, and this regulation depends on the regulation of miR-126-5p. Paeonol inhibits human lung cancer cell viability and metastasis via the miR-126-5p/ZEB2 axis, and could be adopted as a potential agent for lung cancer treatment.

The Role of ZEB2 in Human CD8 T Lymphocytes: Clinical and Cellular Immune Profiling in Mowat-Wilson Syndrome.

The Zeb2 gene encodes a transcription factor (ZEB2) that acts as an important immune mediator in mice, where it is expressed in early-activated effector CD8 T cells, and limits effector differentiation. Zeb2 homozygous knockout mice have deficits in CD8 T cells and NK cells. Mowat-Wilson syndrome (MWS) is a rare genetic disease resulting from heterozygous mutations in ZEB2 causing disease by haploinsufficiency. Whether ZEB2 exhibits similar expression patterns in human CD8 T cells is unknown, and MWS patients have not been comprehensively studied to identify changes in CD8 lymphocytes and NK cells, or manifestations of immunodeficiency. By using transcriptomic assessment, we demonstrated that ZEB2 is expressed in early-activated effector CD8 T cells of healthy human volunteers following vaccinia inoculation and found evidence of a role for TGFß-1/SMAD signaling in these cells. A broad immunological assessment of six genetically diagnosed MWS patients identified two patients with a history of recurrent sinopulmonary infections, one of whom had recurrent oral candidiasis, one with lymphopenia, two with thrombocytopenia and three with detectable anti-nuclear antibodies. Immunoglobulin levels, including functional antibody responses to protein and polysaccharide vaccination, were normal. The MWS patients had a significantly lower CD8 T cell subset as % of lymphocytes, compared to healthy controls (median 16.4% vs. 25%, p = 0.0048), and resulting increased CD4:CD8 ratio (2.6 vs. 1.8; p = 0.038). CD8 T cells responded normally to mitogen stimulation in vitro and memory CD8 T cells exhibited normal proportions of subsets with important tissue-specific homing markers and cytotoxic effector molecules. There was a trend towards a decrease in the CD8 T effector memory subset (3.3% vs. 5.9%; p = 0.19). NK cell subsets were normal. This is the first evidence that ZEB2 is expressed in early-activated human effector CD8 T cells, and that haploinsufficiency of ZEB2 in MWS patients had a slight effect on immune function, skewing T cells away from CD8 differentiation. To date there is insufficient evidence to support an immunodeficiency occurring in MWS patients.

Zeb2 Regulates Myogenic Differentiation in Pluripotent Stem Cells.

Skeletal muscle differentiation is triggered by a unique family of myogenic basic helix-loop-helix transcription factors, including MyoD, MRF-4, Myf-5, and Myogenin. These transcription factors bind promoters and distant regulatory regions, including E-box elements, of genes whose expression is restricted to muscle cells. Other E-box binding zinc finger proteins target the same DNA response elements, however, their function in muscle development and regeneration is still unknown. Here, we show that the transcription factor zinc finger E-box-binding homeobox 2 (Zeb2, Sip-1, Zfhx1b) is present in skeletal muscle tissues. We investigate the role of Zeb2 in skeletal muscle differentiation using genetic tools and transgenic mouse embryonic stem cells, together with single-cell RNA-sequencing and in vivo muscle engraftment capability. We show that Zeb2 over-expression has a positive impact on skeletal muscle differentiation in pluripotent stem cells and adult myogenic progenitors. We therefore propose that Zeb2 is a novel myogenic regulator and a possible target for improving skeletal muscle regeneration. The non-neural roles of Zeb2 are poorly understood.

ETS1 is coexpressed with ZEB2 and mediates ZEB2-induced epithelial-mesenchymal transition in human tumors.

Epithelial-mesenchymal transition (EMT) is an embryonic program that is reactivated in cancer and regulates the invasion and metastasis of tumor cells. Zinc finger E-box binding homeobox 2 (ZEB2) induces EMT by upregulating matrix metalloproteinases (MMP), yet MMP genes lack ZEB2 binding motif in their promoters. Recently, expression of MMPs was associated to the activation of ETS1 transcription factor; however, a link between ZEB2 and ETS proto-oncogene 1, transcription factor (ETS1) remains to be elucidated. Hence, we investigated the transcriptional regulation of ETS1 by ZEB2 after our initial observation that ZEB2 and ETS1 are coexpressed in hepatocellular carcinoma cells (HCCs). Chromatin immunoprecipitation and luciferase reporter assays clearly showed that ZEB2 binds to E-box sequences on the promoter of ETS1. Elevated expression of ETS1 was found in DLD-ZEB2 and A431-ZEB2 inducible systems, and knockdown of ZEB2 caused an explicit downregulation of ETS1 in shZEB2-SNU398 and shZEB2-SK-HEP-1 cells. Repression of ETS1 expression in ZEB2-induced conditions substantially impaired the migration and invasive capacities of DLD1 cells. Mechanistically, knockdown of ETS1 in ZEB2-expressing cells resulted in the downregulation of established ZEB2 targets TWIST and MMP9. Correlation analyses in HCC lines, cancer complementary DNA arrays, and The Cancer Genome Atlas RNA-sequencing data set revealed that ZEB2 and ETS1 are coexpressed, and their expressions in human tumors show a highly significant positive correlation. Our results demonstrated that ZEB2 acts as an upstream regulator of ETS1 and, in turn, ETS1 maintains ZEB2-induced EMT. These findings add another level of complexity to the understanding of ZEB2 in the invasion and metastasis of cancer cells, and put ZEB2/ETS1 axis as a novel therapeutic target in human malignancies.

LncRNA DLX6-AS1 promoted cancer cell proliferation and invasion by attenuating the endogenous function of miR-181b in pancreatic cancer.

BACKGROUND: Pancreatic cancer, one of the most aggressive malignancies, ranks the fourth cause of cancer-related death worldwide. Aberrantly expressed long non-coding RNAs (lncRNAs) functioned as oncogenes or tumor suppressors in pancreatic cancer. This study aimed to determine the expression of lncRNA DLX6 antisense RNA 1 (DLX6-AS1) in pancreatic cancer tissues and to explore the DLX6-AS1-related pathway in pancreatic cancer. MATERIALS AND METHODS: The gene expression levels were determined by quantitative real-time PCR, and protein expression levels were determined by western blot assay. CCK-8 assay, colony formation assay and Transwell migration and invasion assays were used to examine cell proliferation, migration and invasion. Luciferase reporter assay was used to confirm the binding between DLX6-AS1and its potential targets. In vivo study used the mouse xenograft model to test the anti-tumor effect of DLX6-AS1 knockdown. RESULTS: The high expression of DLX6-AS1 was observed in pancreatic cancer tissues, and high expression of DLX6-AS1 was positively correlated with larger tumor size, advanced TNM stage and lymph node metastasis. Knockdown of DLX6-AS1 dramatically impaired cancer cell proliferation, migration and invasion. MiR-181b was the downstream target of DLX6-AS1. Knockdown of miR-181b reversed the suppression of cell viability, migration and invasion abilities caused by DLX6-AS1 knockdown. MiR-181b was found to target Zinc finger E-box-binding homeobox 2 and to modulate epithelial-mesenchymal transition. Furthermore, DLX6-AS1 knockdown inhibited tumor growth and tumor metastasis in vivo. CONCLUSION: Collectively, our data suggested that DLX6-AS1 promotes cancer cell proliferation and invasion by attenuating the endogenous function of miR-181b in pancreatic cancer.

Src promotes EGF-induced epithelial-to-mesenchymal transition and migration in gastric cancer cells by upregulating ZEB1 and ZEB2 through AKT.

Epithelial-to-mesenchymal transition (EMT) plays important roles in the migration, invasion, and metastasis of cancer cells. However, the role of Src in epidermal growth factor (EGF)-induced EMT and migration in gastric cancer cells remains to be clarified. In the current study, the effect of Src on EGF-stimulated EMT and migration was explored in gastric cancer cells. EGF induced EMT in gastric cancer cells and increased their migratory ability, which was accompanied by the phosphorylation of Src. PP2, the Src inhibitor, markedly suppressed EGF-mediated EMT and migration in gastric cancer cells. Additionally, EGF-stimulated upregulation of zinc finger E-box binding homeobox 1 (ZEB1) and zinc finger E-box binding homeobox 2 (ZEB2) was significantly repressed by PP2. Further analysis showed that EGF-stimulated phosphorylation of protein kinase B (AKT) was almost completely abolished by PP2, whereas that of extracellular signal-regulated kinase (ERK), signal transducer and activator of transcription 3 (STAT3) was only mildly suppressed. Moreover, LY294002, the AKT inhibitor, significantly inhibited EGF-induced upregulation of ZEB1 and ZEB2 as well as EMT and migration stimulated by EGF in gastric cancer cells. However, neither ERK inhibitor nor STAT3 inhibitor repressed EGF-induced EMT-related changes. Taken together, these results suggest that Src promotes EGF-stimulated EMT and migration by upregulation of ZEB1 and ZEB2 through AKT signaling pathway in gastric cancer cells.

Title Prognosis Significance of ZEB2 and TGF-ß1 as well as Other Clinical Characteristics in Epithelial Ovarian Cancer.

OBJECTIVE: This study aimed to evaluate the prognosis significance of zinc-finger E-box binding homeobox 2 (ZEB2) and transforming growth factor ß1 (TGF-ß1) as well as other clinical characteristics in epithelial ovarian cancer (EOC). METHODS: This retrospective study examined the expressions of ZEB2 and TGF-ß1 in 64 EOC specimens, 36 benign ovarian tumor specimens, and 28 normal ovarian specimens by immunohistochemistry. The correlation of the expressions of ZEB2 and TGF-ß1 was analyzed by the Spearman rank correlation analysis. The Kaplan-Meier method was used to construct crude survival curves, and the prognostic roles of ZEB2 and TGF-ß1 as well as clinical characteristics were evaluated by Cox proportional hazards regression analysis. RESULTS: The positive expression rates of ZEB2 and TGF-ß1 were increased in EOC specimens compared with benign ovarian tumor and normal ovary specimens (P < 0.05), and ZEB2 expression was positively correlated with TGF-ß1 expression (r = 0.538, P = 0.000). In addition, the overall survival rate of EOC patients was associated with the expressions of ZEB2 and TGF-ß1, age, differentiated grade, International Federation of Gynecology and Obstetrics (FIGO) stage, preoperative serum CA125 level, postoperative start time of chemotherapy, and treatment course (all P < 0.05). Multivariate Cox regression demonstrated that FIGO stage (P = 0.033), TGF-ß1 expression (P = 0.043), postoperative start time of chemotherapy (P = 0.009), and treatment course (P = 0.000) were prognostic factors for EOC. CONCLUSIONS: ZEB2 and TGF-ß1 may promote EOC progression, and FIGO stage, TGF-ß1 expression, postoperative start time of chemotherapy, and treatment course may be associated with the prognosis of EOC.

ZEB2 promotes vasculogenic mimicry by TGF-ß1 induced epithelial-to-mesenchymal transition in hepatocellular carcinoma.

AIMS: Zinc finger E-box binding homeobox 2 (ZEB2), an epithelial-mesenchymal transition (EMT) regulator, has been involved in invasion and metastasis of human tumor. Although EMT may be involved in vasculogenic mimicry (VM) formation, no reports describing the relation between ZEB2 and VM are available. We hypothesize that ZEB2 may promote VM formation in hepatocellular carcinoma (HCC). METHODS AND RESULTS: Paraffin-embedded tumor tissue samples from 92 patients were immunostained with anti-ZEB2 antibody. We found that the ZEB2 nuclear expression was significantly associated with VM formation and metastasis. Patients with VM and ZEB2 nuclear expression had a shorter survival period than those without expression. In vitro, ZEB2 overexpression significantly enhanced cell motility, invasiveness, and VM formation of HepG2 cells. ZEB2 upregulation also increased VE-cadherin, Flt-1, and Flk-1 expression and activated MMPs. ZEB2 knockdown inhibited cell motility, invasiveness, and VM formation in Bel7402 cells. ZEB2 knockdown also decreased VE-cadherin, Flt-1, and Flk-1 expression and MMP activity. In addition, EMT in HepG2 cells was induced by TGF-ß1 treatment, and the kinetics of expression of EMT markers and regulators were assessed by Western blot analysis. The expression of ZEB2 increased significantly, and VM formation was promoted. CONCLUSION: ZEB2 can promote VM formation through the EMT pathway. Our findings may represent a novel therapeutic target in HCC.

Zinc finger E-box-binding homeobox 2 (ZEB2) regulated by miR-200b contributes to multi-drug resistance of small cell lung cancer.

Zinc finger E-box-binding homeobox 2 (ZEB2) was closely related to the oncogenesis, development and response to chemotherapy of cancer. However, its biological functions in small cell lung cancer (SCLC) remain unknown. The aim of this study is to investigate the roles of ZEB2 in chemoresistance of SCLC and its possible molecular mechanism. Expression of ZEB2 was examined in sixty-eight cases of SCLC tissues by immunohistochemistry. Knockdown of ZEB2 was carried out in SCLC multidrug resistant cells (H69AR) to assess its influence on chemoresistance. The results showed that ZEB2 was expressed in 23.5% (16/68) of SCLC. Overexpression of ZEB2 was associated with the poor pathologic stage of SCLC (P < 0.001 by the Fisher's Exact Test) and the shorter survival time (by the Kaplan-Meier method). Inhibition of ZEB2 expression using small interfering RNA in H69AR cells sensitized cancer cells to chemotherapeutic drugs through increasing drug-induced cell apoptosis accompanied with S phase arrest. In silico analysis demonstrated that there are complementary binding sites between miR-200b and ZEB2 3'-UTR, and identified miR-200b as a potential regulator of ZEB2. We found that miR-200b was down-regulated in the resistant cells and enforced expression of miR-200b by miRNA mimics increased cell sensitivity. Overexpression of miR-200b led to the downregulation of ZEB2 at protein level. Luciferase reporter gene assay showed that 3'UTR ZEB2 activity was regulated by miR-200b. Our results suggest that ZEB2 modulates drug resistance and is regulated by miR-200b. All findings provide insight into the ZEB2 signaling mechanism and ZEB2 may be a potentially novel target for multi-drug resistance in SCLC.

Circ-10720 as a ceRNA adsorbs microRNA-1238 and modulates ZEB2 to boost NSCLC development by activating EMT.

BACKGROUND: Circular RNAs (circRNAs) are critical regulators in the progression of tumors. This experimental design aimed to explore the mechanism of circ-10720 in non-small cell lung cancer (NSCLC). METHODS: We used RT-qPCR to measure circ-10720 expression in clinical samples and analyzed its relationship with the clinicopathological characteristics of NSCLC patients. The expression levels of microRNA-1238 (miR-1238) and Zinc Finger E-box-binding Homeobox 2 (ZEB2) in clinical samples were detected by RT-qPCR. NSCLC cells were transfected with relevant plasmids or sequences. Circ-10720, miR-1238, and ZEB2 expressions in cells were analyzed via RT-qPCR or western blot. Cell proliferation, apoptosis, migration, and invasion were assessed with CCK-8, flow cytometry, and transwell assay, respectively. The protein expression of ZEB2 and epithelial-mesenchymal transition (EMT)-related markers (E-cadherin, Vimentin, N-cadherin) were detected via western blot. Xenograft assay was used to determine the effect of circ-10720 on NSCLC in vivo. Circ-10720 and ZEB2 expressions in tumors were detected using RT-qPCR or Western blot. Immunohistochemistry was used to evaluate E-cadherin and N-cadherin expression in tumors. Finally, the binding relationship between miR-1238 with circ-10720 or ZEB2 was verified by the bioinformatics website, dual luciferase reporter assay, RNA pull-down assay, and RIP assay. RESULTS: Circ-10720 was upregulated in NSCLC and correlated with TNM stage of NSCLC patients. MiR-1238 was lowly expressed but ZEB2 was highly expressed in NSCLC. Circ-10720 silencing suppressed the proliferation, metastasis, and EMT of NSCLC cells. Mechanically, circ-10720 was a competitive endogenous RNA (ceRNA) for miR-1238, and ZEB2 was a target of miR-1238. circ-10720-modulated ZEB2 via competitively binding with miR-1238 to control NSCLC progression. In addition, circ-10720 knockdown suppressed tumor growth in vivo. CONCLUSIONS: Circ-10720 acts as a ceRNA to adsorb miR-1238 and modulate ZEB2 to facilitate the proliferation, migration, invasion, and EMT of NSCLC cells.

Pathogenicity evaluation of variants of uncertain significance at exon-intron junction by splicing assay in patients with Mowat-Wilson syndrome.

High-throughput sequencing has identified vast numbers of variants in genetic disorders. However, the significance of variants at the exon-intron junction remains controversial. Even though most cases of Mowat-Wilson syndrome (MOWS) are caused by heterozygous loss-of-function variants in ZEB2, the pathogenicity of variants at exon-intron junction is often indeterminable. We identified four intronic variants in 5/173 patients with clinical suspicion for MOWS, and evaluated their pathogenicity by in vitro analyses. The minigene analysis showed that c.73+2T>G caused most of the transcripts skipping exon 2, while c.916+6T>G led to partial skipping of exon 7. No splicing abnormalities were detected in both c.917-21T>C and c.3067+6A>T. The minigene analysis reproduced the splicing observed in the blood cells of the patient with c.73+2T>G. The degree of the exon skipping was concordant with the severity of MOWS; while the patient with c.73+2T>G was typical MOWS, the patient with c.916+6T>G showed milder phenotype which has been seldom reported. Our results demonstrate that mRNA splicing assays using the minigenes are valuable for determining the clinical significance of intronic variants in patients with not only MOWS but also other genetic diseases with splicing aberrations and may explain atypical or milder cases, such as the current patient.

Stem cell-based modeling and single-cell multiomics reveal gene-regulatory mechanisms underlying human skeletal development.

Although the skeleton is essential for locomotion, endocrine functions, and hematopoiesis, the molecular mechanisms of human skeletal development remain to be elucidated. Here, we introduce an integrative method to model human skeletal development by combining in vitro sclerotome induction from human pluripotent stem cells and in vivo endochondral bone formation by implanting the sclerotome beneath the renal capsules of immunodeficient mice. Histological and scRNA-seq analyses reveal that the induced bones recapitulate endochondral ossification and are composed of human skeletal cells and mouse circulatory cells. The skeletal cell types and their trajectories are similar to those of human embryos. Single-cell multiome analysis reveals dynamic changes in chromatin accessibility associated with multiple transcription factors constituting cell-type-specific gene-regulatory networks (GRNs). We further identify ZEB2, which may regulate the GRNs in human osteogenesis. Collectively, these results identify components of GRNs in human skeletal development and provide a valuable model for its investigation.

LINC01615 activates ZEB2 through competitively binding with miR-3653-3p to promote the carcinogenesis of colon cancer cells.

As a newly discovered cancer-related molecule, we explored the unreported mechanism of LINC01615 intervention in colon cancer.LINC01615 expression in clinical samples and cells were detected. Effects of LINC01615 silencing/overexpression on the malignant development of colon cancer cells were analyzed through cell function experiments. Changes at the level of molecular biology were detected by quantitative real-time polymerase chain reaction and Western blot. Bioinformatics analysis and dual luciferase reporter assay were involved in the display and verification of targeted binding sequences. The rescue tests and correlation analysis examined the relationship among LINC01615, miR-3653-3p and zinc finger E-box binding homeobox 2 (ZEB2) in colon cancer cells. The xenograft experiment and immunohistochemistry were performed to verify these results.TCGA suggested that LINC01615 was high-expressed in colon cancer, as verified in clinical and cell samples, and patients with LINC01615 overexpression suffered from a poor prognosis. Silent LINC01615 blocked the malignant development of colon cancer cells through regulating related genes expressions, while overexpressed LINC01615 had the opposite effect. LINC01615, which was targeted by miR-3653-3p, partially offset the inhibitory effect of miR-3653-3p on colon cancer cells. The downstream target gene ZEB2 of miR-3653-3p was high-expressed in colon cancer. MiR-3653-3p was negatively correlated with LINC01615 or ZEB2, while LINC01615 was positively correlated with ZEB2. Therefore, LINC01615 induced ZEB2 up-regulation, while miR-3653-3p reduced ZEB2 level. The results of in vivo studies were consistent with cell experiments.LINC01615 competitively binds with miR-3653-3p to regulate ZEB2 and promote canceration of colon cancer cells.

Overexpression of miR-651-5p inhibits ultraviolet radiation-induced malignant biological behaviors of sebaceous gland carcinoma cells by targeting ZEB2.

Background: Ultraviolet (UV) exposure is the most essential etiological factor in sebaceous gland carcinoma (SGC). The abnormal expression of microRNAs (miRNAs) is also involved in SGC. However, the function of miRNAs in UV-induced SGC is still unclear. Methods: In this study, the expression levels of miR-651-5p and zinc finger E-box binding homeobox 2 (ZEB2) in SGC tissues and cells were measured by real-time quantitative polymerase chain reaction (RT-qPCR) and western blotting. Then, the effects of miR-651-5p on the apoptosis, migration, invasion, and epithelial-mesenchymal transition (EMT) of UV-induced SGC cells were determined. The interactions between miR-651-5p and ZEB2 were verified by a dual-luciferase reporter assay. An in vivo tumor growth assay was performed to assess tumorigenicity. Results: The results showed that there was abnormal expression of miR-651-5p and ZEB2 in SGC tissues and cells compared with the control tissues and cells. Overexpression of miR-651-5p and knockdown of ZEB2 inhibited the malignant biological behaviors of SGC cells. Moreover, ZEB2 is one of the target genes of miR-651-5p, and the expression of ZEB2 was negatively regulated by miR-651-5p in SGC cells. Further studies showed that overexpression of miR-651-5p promoted cell apoptosis and inhibited the cell invasion and migration ability and EMT of UV-induced SGC cells by downregulating the expression of ZEB2 in vitro and in vivo. Conclusions: This study revealed that overexpression of miR-651-5p inhibited UV-induced SGC growth and metastasis by suppressing ZEB2, which may be a potential target for SGC prevention and therapy.

The Role of ZEB2 Expression in Pediatric and Adult Glioblastomas.

BACKGROUND/AIM: Both pediatric glioblastoma (pGB) and adult glioblastoma (aGB) are clinically devastating, and are known to have different molecular pathogenesis. Here, we focused on the role of ZEB2 in pGB and aGB. MATERIALS AND METHODS: Following transfection with ZEB2 siRNA into pGB cells (KNS42) and aGB cells (U87 and U373), cell proliferation, migration and invasion, and cell cycle progression were evaluated. RESULTS: Targeted inhibition of ZEB2 induced up-regulation of E-cadherin expression and down-regulation of vimentin expression. Furthermore, it reduced invasion and migration of both pGB and aGB cells. Interestingly, in pGB cells, but not in aGB cells, silencing of ZEB2 reduced cell proliferation and viability, and affected the cell cycle progression of tumor cells. CONCLUSION: Inhibition of ZEB2 altered the mesenchymal features and reduced the migration and invasive ability of both pGB and aGB cells. ZEB2 effects were different in pGB and aGB cells regarding proliferation and cell cycle progression, suggesting that different underlying molecular mechanisms drive progression in these two types of tumors.

ZEB2 Knock-down Induces Apoptosis in Human Myeloid Leukemia HL-60 Cells.

INTRODUCTION: Acute myeloid leukemia (AML) is the most prevalent type of cancer in the adult hematopoietic system. Conventional therapies are associated with unfavorable side effects in individuals diagnosed with AML. These after-effects with partial remission reflect the urgent need for novel therapeutic approaches for inducing apoptosis, specifically in malignant cells, without affecting other cells. As a transcription factor (TF), ZEB2 (Zinc Finger E-Box Binding Homeobox 2) regulates the expression of specific genes in normal conditions. However, increased expression of ZEB2 is reported in various cancers, especially in AML, which is related to a higher degree of apoptosis inhibition of malignant cells. In this work, the role of ZEB2 in apoptosis inhibition is surveyed through ZEB2 specific knocking-down in human myeloid leukemia HL-60 cells. MATERIALS AND METHODS: Transfection of HL-60 cells was conducted using ZEB2-siRNA at concentrations of 20, 40, 60, and 80 pmol within 24, 48, and 72 h. After determining the optimum dose and time, flow cytometry was used to measure the apoptosis rate. The MTT assay was also utilized to evaluate the cytotoxic impact of transfection on the cells. The expression of candidate genes was measured before and after transfection using qRT-PCR. RESULTS: According to obtained results, suppression of ZEB2 expression through siRNA was associated with the induction of apoptosis, increased pro-apoptotic, and decreased anti-apoptotic gene expression. Transfection of ZEB2-siRNA was also associated with reduced cell proliferation and viability. CONCLUSION: Our study results suggest that ZEB2 suppression in myeloid leukemia cells through apoptosis induction could be a proper therapeutic method.

Targeting the miR-6734-3p/ZEB2 axis hampers development of non-small cell lung cancer (NSCLC) and increases susceptibility of cancer cells to cisplatin treatment.

The unclear pathogenesis mechanisms and resistance of cancer cells to chemical drugs serious limits the development of effective treatment strategies for non-small cell lung cancer (NSCLC). In this study, we managed to investigate this issue, and identify potential cancer associated biomarkers for NSCLC diagnosis, prognosis and treatment. This study found that miR-6734-3p was downregulated in both NSCLC clinical specimens (tissues and serum) and cells, compared to the normal tissues and cells. Next, upregulation of miR-6734-3p inhibited cancer formation and progression in NSCLC cells in vitro and in vivo. Conversely, miR-6734-3p ablation had opposite effects and facilitated NSCLC development. In addition, miR-6734-3p bound to the 3' untranslated region (3'UTR) of zinc finger E-box binding homeobox 2 (ZEB2) mRNA to suppress its expressions in NSCLC cells. Interestingly, the inhibiting effects of miR-6734-3p overexpression on NSCLC progression were abrogated by upregulating ZEB2. Furthermore, both upregulated miR-6734-3p and silencing of ZEB2 increased cisplatin-sensitivity in cisplatin-resistant NSCLC (CR-NSCLC) cells. Taken together, miR-6734-3p played an anti-tumor role to hinder cancer development and enhanced the cytotoxic effects of cisplatin treatment on NSCLC cells by downregulating ZEB2.

[Retracted] MicroRNA-200c inhibits the metastasis of non-small cell lung cancer cells by targeting ZEB2, an epithelial-mesenchymal transition regulator.

Following the publication of this paper, it was drawn to the Editors' attention by a concerned reader that certain of the cell Transwell assay data in the article (featured in Figs. 2C and 4C) were strikingly similar to data appearing in different form in other articles by different authors at different research institutions, which were already under consideration for publication or had already been published elsewhere at the time of the present article's submission [C. Lai et al, 'MicroRNA­133a inhibits proliferation and invasion, and induces apoptosis in gastric carcinoma cells via targeting fascin actin­bundling protein 1', Mol Med Rep 12: 1473­1478, 2015; and Y. Shi et al, 'MicroRNA­204 inhibits proliferation, migration, invasion and epithelial­mesenchymal transition in osteosarcoma cells via targeting Sirtuin 1', Oncol Rep 34: 399­406, 2015]. Owing to the fact that the contentious data in the above article had already appeared in different form in other articles prior to its submission to Molecular Medicine Reports, the Editor has decided that this paper should be retracted from the Journal. The authors did not reply to indicate whether or not they agreed with the retraction of the paper. The Editor apologizes to the readership for any inconvenience caused. [the original article was published in Molecular Medicine Reports 13: 3349-3355, 2016; DOI: 10.3892/mmr.2016.4901].

The antitumor effect of miR-448 in epithelial ovarian cancer.

BACKGROUND: Ovarian cancer (OC) is the seventh most commonly diagnosed cancer in the world and the tenth most common in China. Target agents such as bevacizumab and poly (ADP-ribose) polymerase (PARP) inhibitors show efficacy only in the early stages of some cases; therefore, more effective molecular targeting agents need to be developed. microRNAs (miRNA) have emerged as new biomarkers in the clinical diagnosis and treatment of OC. Among these, miRNA-448 has been shown to exert a tumor-suppressor role in numerous cancer types. However, the function of miR-448 in OC remains poorly understood. METHODS: The miR-448 in cancer tissues and cell lines was tested by quantitative real-time polymerase chain (qRT-PCR). The miR-448 levels were altered by miR-448 mimics (UUGCAUAUGUAGGAUGUCCCAU) or miR-448 antisense oligonucleotide transfection (miR20001532-1-5). Cell growth was evaluated by MTT assay, and cell apoptosis was assayed by annexin V-FITC (detecting apoptotic cells by binding to phosphatidylserine) and propidium iodide (PI, detecting death cells by binding to DNA) (Cat. No. ab54775, Abacam). The target gene of miR-448 was confirmed by dual-luciferase reporter assays. RESULTS: In this study, we found that miR-448 showed low expression in epithelial ovarian cancer (EOC) tissues and that the low expression of miR-448 was related to low survival rate. miR-448 may thus inhibit cellular proliferation and promote apoptosis by binding the 3'UTR of zinc finger E-box-binding homeobox 2 (ZEB2) and inhibiting the expression of ZEB2. CONCLUSIONS: Our study suggests that miR-448 has an inhibitory role in OC.