Response of antioxidant activity, active constituent and rhizosphere microorganisms of Salvia miltiorrhiza to combined application of microbial inoculant, microalgae and biochar under Cu stress.

Salvia miltiorrhiza, a widely used medicinal herb renowned for its properties in promoting blood circulation, removing blood stasis and alleviating pain, is currently facing quality degradation due to excessive heavy metal levels, posing a threat to medication safety. In order to investigate the effects of microbial inoculant, microalgae and biochar on the growth of Salvia miltiorrhiza under copper (Cu) stress, as well as its Cu absorption, antioxidant activity, active component contents and rhizosphere microbial community, a pot experiment was conducted. Salvia miltiorrhiza plants were cultivated in the soil containing 400 mg/kg of Cu for six months and treated with microbial inoculant, microalgae and biochar, either individually or in combination. Almost all soil amendment treatments led to an increase in root biomass. Notably, co-application of microbial inoculant and microalgae had the optimal effect with a 63.07 % increase compared to the group treated solely with Cu. Moreover, when microbial inoculant was applied alone or in combination with microalgae, the Cu content in plant roots was reduced by 19.29 % and 25.37 %, respectively, whereas other treatments failed to show a decreasing trend. Intriguingly, Cu stress increased the active component contents in plant roots, and they could also be enhanced beyond non-stress levels when microbial inoculant and microalgae were applied together or in combination with biochar. Analyses of plant antioxidant activity, soil properties and rhizosphere microorganisms indicated that these amendments may alleviate Cu stress by enhancing peroxidase activity, facilitating plant nutrient absorption, and enriching beneficial microorganisms capable of promoting plant growth and mitigating heavy metal-induced damage. This study suggests that the combined application of microbial inoculant and microalgae can reduce Cu levels in Salvia miltiorrhiza while enhancing its quality under Cu stress.

DNA Metabarcoding Reveals the Fungal Community on the Surface of Lonicerae Japonicae Flos, an Edible and Medicinal Herb.

Lonicerae Japonicae Flos (LJF) has been globally applied as an herbal medicine and tea. A number of reports recently revealed fungal and mycotoxin contamination in medicinal herbs. It is essential to analyze the fungal community in LJF to provide an early warning for supervision. In this study, the fungal community in LJF samples was identified through DNA metabarcoding. A total of 18 LJF samples were collected and divided based on the collection areas and processing methods. The results indicated that Ascomycota was the dominant phylum. At the genus level, Rhizopus was the most abundant, followed by Erysiphe and Fusarium. Ten pathogenic fungi were detected among the 41 identified species. Moreover, Rhizopus, Fusarium, and Aspergillus had lower relative abundances in LJF samples under oven drying than under other processing methods. This work is expected to provide comprehensive knowledge of the fungal community in LJF and a theoretical reference for enhanced processing methods in practical manufacturing.

DNA barcoding in herbal medicine: Retrospective and prospective.

DNA barcoding has been widely used for herb identification in recent decades, enabling safety and innovation in the field of herbal medicine. In this article, we summarize recent progress in DNA barcoding for herbal medicine to provide ideas for the further development and application of this technology. Most importantly, the standard DNA barcode has been extended in two ways. First, while conventional DNA barcodes have been widely promoted for their versatility in the identification of fresh or well-preserved samples, super-barcodes based on plastid genomes have rapidly developed and have shown advantages in species identification at low taxonomic levels. Second, mini-barcodes are attractive because they perform better in cases of degraded DNA from herbal materials. In addition, some molecular techniques, such as high-throughput sequencing and isothermal amplification, are combined with DNA barcodes for species identification, which has expanded the applications of herb identification based on DNA barcoding and brought about the post-DNA-barcoding era. Furthermore, standard and high-species coverage DNA barcode reference libraries have been constructed to provide reference sequences for species identification, which increases the accuracy and credibility of species discrimination based on DNA barcodes. In summary, DNA barcoding should play a key role in the quality control of traditional herbal medicine and in the international herb trade.

Contributions of Beneficial Microorganisms in Soil Remediation and Quality Improvement of Medicinal Plants.

Medicinal plants (MPs) are important resources widely used in the treatment and prevention of diseases and have attracted much attention owing to their significant antiviral, anti-inflammatory, antioxidant and other activities. However, soil degradation, caused by continuous cropping, excessive chemical fertilizers and pesticide residues and heavy metal contamination, seriously restricts the growth and quality formation of MPs. Microorganisms, as the major biota in soil, play a critical role in the restoration of the land ecosystem. Rhizosphere microecology directly or indirectly affects the growth and development, metabolic regulation and active ingredient accumulation of MPs. Microbial resources, with the advantages of economic efficiency, harmless to environment and non-toxic to organisms, have been recommended as a promising alternative to conventional fertilizers and pesticides. The introduction of beneficial microbes promotes the adaptability of MPs to adversity stress by enhancing soil fertility, inhibiting pathogens and inducing systemic resistance. On the other hand, it can improve the medicinal quality by removing soil pollutants, reducing the absorption and accumulation of harmful substances and regulating the synthesis of secondary metabolites. The ecological and economic benefits of the soil microbiome in agricultural practices are increasingly recognized, but the current understanding of the interaction between soil conditions, root exudates and microbial communities and the mechanism of rhizosphere microecology affecting the secondary metabolism of MPs is still quite limited. More research is needed to investigate the effects of the microbiome on the growth and quality of different medicinal species. Therefore, the present review summarizes the main soil issues in medicinal plant cultivation, the functions of microbes in soil remediation and plant growth promotion and the potential mechanism to further guide the use of microbial resources to promote the ecological cultivation and sustainable development of MPs.

Detection of Highly Poisonous Nerium oleander Using Quantitative Real-Time PCR with Specific Primers.

Nerium oleander is one of the most poisonous plants, and its accidental ingestion has frequently occurred in humans and livestock. It is vital to develop a rapid and accurate identification method for the timely rescue of oleander-poisoned patients and the investigation of poisoning cases. In this study, a specific and highly sensitive quantitative real-time PCR (qPCR)-based method was developed to identify oleander in mixture systems and simulated forensic specimens (SFS). First, a new pair of oleander-specific primers, JZT-BF/BR, was designed and validated. Then, a qPCR method was developed using the primers, and its detective sensitivity was examined. The results showed that JZT-BF/BR could specifically identify oleander in forage and food mixtures, and qPCR was capable of accurate authentication even at a low DNA concentration of 0.001 ng/µL. This method was further applied to the analysis of SFS containing different ratios of N. oleander. The method was confirmed to be applicable to digested samples, and the detection limit reached 0.1% (w/w) oleander in mixture systems. Thus, this study undoubtedly provides strong support for the detection of highly toxic oleander and the diagnosis of food poisoning in humans and animals.

Detection of Adulteration and Pesticide Residues in Chinese Patent Medicine Qipi Pill Using KASP Technology and GC-MS/MS.

Chinese patent medicines (CPMs) are of great value for the prevention and treatment of diseases. However, adulterants and pesticide residues in CPMs have become the "bottleneck" impeding the globalization of traditional Chinese medicine. In this study, 12 batches of commercially available Qipi pill (a famous CPM recorded in Chinese Pharmacopeia) from different manufacturers were investigated to evaluate their authenticity and quality safety. Considering the severely degraded DNA in CPMs, kompetitive allele specific PCR (KASP) technology combined with DNA mini-barcodes was proposed for the quality regulation of a large number of products in CPM market. The residues of four kinds of pesticides including pentachloronitrobenzene (PCNB), hexachlorocyclohexane (HCH), aldrin, and dichlorodiphenyltrichloroethane (DDT) were quantified using gas chromatography and tandem mass spectrometry (GC-MS/MS). The results indicated that in two of the 12 batches of Qipi pill, the main herbal ingredient Panax ginseng was completely substituted by P. quinquefolius, and one sample was partially adulterated with P. quinquefolius. The PCNB residue was detected in 11 batches of Qipi pill, ranging from 0.11 to 0.46 mg/kg, and the prohibited pesticide HCH was present in four samples. Both adulteration and banned pesticides were found in two CPMs. This study suggests that KASP technology combined with DNA mini-barcodes can be used for the quality supervision of large sample size CPMs with higher efficiency but lower cost. Our findings also provide the insight that pesticide residues in CPMs should be paid more attention in the future.

Development of a Genus-Universal Nucleotide Signature for the Identification and Supervision of Ephedra-Containing Products.

Ephedra plants generally contain ephedrine alkaloids, which are the critical precursor compounds of methamphetamine (METH). METH could cause serious physical and mental damage, and therefore Ephedra materials are strictly in supervision internationally. However, unlawful utilization of Ephedra herbs and its products still exist. Thus, it is imperative to establish a universal method for monitoring Ephedra ingredients in complex mixtures and processed products. In this study, 224 ITS2 sequences representing 59 taxa within Ephedra were collected, and a 23-bp genus-level nucleotide signature (GTCCGGTCCGCCTCGGCGGTGCG) was developed for the identification of the whole genus. The specific primers MH-1F/1R were designed, and 125 individuals of twelve Ephedra species/varieties were gathered for applicability verification of the nucleotide signature. Additionally, seven batches of Chinese patent medicines containing Ephedra herbs were used to test the application of the nucleotide signature in complex and highly processed materials. The results demonstrated that the 23-bp molecular marker was unique to Ephedra and conserved within the genus. It can be successfully utilized for the detection of Ephedra components in complex preparations and processed products with severe DNA degradation. The method developed in this study could undoubtedly serve as a strong support for the supervision of illegal circulation of Ephedra-containing products.

The complete chloroplast genome of Asarum pulchellum Hemsl. (Aristolochiaceae: Asarum L.).

Asarum pulchellum Hemsley 1890, belonging to Aristolochiaceae family, is a kind of folk herb resource with certain toxicity. In this study, we acquired the complete chloroplast genome of A. pulchellum for its accurate species identification and phylogenetic analysis. The genome is 177,905 bp in size with a typical circular quadripartite structure, consisting of a large single-copy region, a small single-copy region and a pair of inverted repeats. In total, 136 genes were annotated, including 92 protein-coding genes, 36 tRNA genes and eight rRNA genes. In the phylogenetic analysis, A. pulchellum and A. sieboldii formed a sister clade. The chloroplast genome helps further studies of taxonomy and genetic evolution of Aristolochiaceae family.

CuO, ZnO, and γ-Fe2O3 nanoparticles modified the underground biomass and rhizosphere microbial community of Salvia miltiorrhiza (Bge.) after 165-day exposure.

To investigate whether metal oxide nanoparticles exhibit toxicity or positive effects on medicinal plants, CuO, ZnO, and γ-Fe2O3 nanoparticles (NPs), at concentrations of 100 and 700 mg kg-1, were introduced into the cultivation of Salvia miltiorrhiza (Bge.). Metal elemental contents, chemical constituents, biomass and the structure of the rhizosphere microbial community was used to estimate this effect. The results indicated CuO NPs increased the Cu content and ZnO NPs increased the Zn content significantly as exposure increased, γ-Fe2O3 NPs had no significant effect on Fe content in S. miltiorrhiza roots, while 100 mg kg-1 ZnO and CuO NPs significantly decreased the Fe content in roots. Additionally, ZnO and γ-Fe2O3 NPs increased the underground biomass, and diameter of S. miltiorrhiza roots. However, these three metal oxide nanoparticles had no significant effect on total tanshinones, while the 700 mg kg-1 γ-Fe2O3 NPs treatment increased salvianolic acid B content by 36.46%. High-throughput sequencing indicated at 700 mg kg-1 ZnO NPs, the relative abundance of Humicola (Zn superoxide dismutase producer), was notably increased by 97.46%, and that of Arenimonas, Thiobacillus and Methylobacillus (taxa related to heavy metal tolerance) was significantly increased by 297.14%, 220.26% and 107.00%. The 700 mg kg-1 CuO NPs exposure caused a significant increase in the relative abundances of Sphingomonas (a copper-resistant and N2-fixing genus) and Flavisolibacter (stripe rust biocontrol bacteria) by 127.32% and 118.33%. To our best knowledge, this is the first study to examine the potential impact of NPs on the growth and rhizosphere microorganisms of S. miltiorrhiza.

How to improve CHMs quality: Enlighten from CHMs ecological cultivation.

Chinese herbal medicines (CHMs) are one of the important bioresources of medicine, which works by unlocking nature's ability to prevent diseases and recover from illnesses. Recently, it has ascended to the world stage and become a global icon. Nowadays, a considerable of researches have focused on the quality evaluation of CHMs. However, it is difficult to meet the reasonable needs of human beings for safe drug use to evaluate the quality of a huge number of inferior goods for the CHMs contaminated by pesticides and heavy metals. Hence to explore an eligible medicinal plant cultivation pattern, which can provide high quality CHMs sustainably, is most promising. This review analyzed the situation and characteristics of medicinal plant resources in different periods, including wild-harvested and cultivated resources during different stages, putting forward that ecological cultivation must be the way to develop medicinal plant cultivation and to obtain high quality CHMs.

Molecular Mechanism Underlying Mechanical Wounding-Induced Flavonoid Accumulation in Dalbergia odorifera T. Chen, an Endangered Tree That Produces Chinese Rosewood.

Dalbergia odorifera, a critically endangered tree species, produces heartwood containing a vast variety of flavonoids. This heartwood, also known as Chinese rosewood, has high economic and medicinal value, but its formation takes several decades. In this study, we showed that discolored wood induced by pruning displays similar color, structure, and flavonoids content to those of natural heartwood, suggesting that wounding is an efficient method for inducing flavonoid production in D. odorifera. Transcriptome analysis was performed to investigate the mechanism underlying wounding-induced flavonoids production in D. odorifera heartwood. Wounding upregulated the expression of 90 unigenes, which covered 19 gene families of the phenylpropanoid and flavonoid pathways, including PAL, C4H, 4CL, CHS, CHI, 6DCS, F3'5'H, F3H, FMO, GT, PMAT, CHOMT, IFS, HI4'OMT, HID, IOMT, I2'H, IFR, and I3'H. Furthermore, 47 upregulated unigenes were mapped to the biosynthesis pathways for five signal molecules (ET, JA, ABA, ROS, and SA). Exogenous application of these signal molecules resulted in the accumulation of flavonoids in cell suspensions of D. odorifera, supporting their role in wounding-induced flavonoid production. Insights from this study will help develop new methods for rapidly inducing the formation of heartwood with enhanced medicinal value.

Microbial Community Changes in the Rhizosphere Soil of Healthy and Rusty Panax ginseng and Discovery of Pivotal Fungal Genera Associated with Rusty Roots.

Panax ginseng Meyer, a valuable medicinal plant, is severely threatened by rusty root, a condition that greatly affects its yield and quality. Studies investigating the relationship between soil microbial community composition and rusty roots are vital for the production of high-quality ginseng. Here, high-throughput sequencing was employed to systematically characterize changes in the soil microbial community associated with rusty roots. Fungal diversity was lower in the soils of rusty root-affected P. ginseng than in those of healthy plants. Importantly, principal coordinate analysis separated the fungal communities in the rhizosphere soils of rusty root-affected ginseng from those of healthy plants. The dominant bacterial and fungal genera differed significantly between rhizosphere soils of healthy and rusty root-affected P. ginseng, and linear discriminant analysis effect size (LEfSe) further indicated a strong imbalance in the soil microbial community of diseased plants. Significantly enriched bacterial genera (including Rhodomicrobium, Knoellia, Nakamurella, Asticcacaulis, and Actinomadura) were mainly detected in the soil of rusty root-affected P. ginseng, whereas significantly enriched fungal genera (including Xenopolyscytalum, Arthrobotrys, Chalara, Cryptococcus, and Scutellinia) were primarily detected in the soil of healthy plants. Importantly, five fungal genera (Cylindrocarpon, Acrophialophora, Alternaria, Doratomyces, and Fusarium) were significantly enriched in the soil of rusty root-affected plants compared with that of healthy plants, suggesting that an increase in the relative abundance of these pathogenic fungi (Cylindrocarpon, Alternaria, and Fusarium) may be associated with ginseng rusty roots. Additionally, this study is the first to report that an increase in the relative abundances of Acrophialophora and Doratomyces in the rhizosphere of P. ginseng may be associated with the onset of rusty root symptoms in this plant. Our findings provide potentially useful information for developing biological control strategies against rusty root, as well as scope for future screening of fungal pathogens in rusty roots of P. ginseng.

DNA Mini-Barcoding: A Derived Barcoding Method for Herbal Molecular Identification.

In recent years, the demand for natural herbal products (NHP) has increased; however, the quality of these products is difficult to confirm due to the lack of a comprehensive quality control system. Traditional methods are not effective in detecting processed ingredients. DNA barcoding is an established technique that has been used for more than 10 years. This technique uses short standard sequences (generally 200-600 bp) to identify species. While a complete DNA barcode is difficult to obtain from NHP due to DNA degradation, mini-barcoding is a complementary tool to identify species in NHP. DNA mini-barcoding uses smaller DNA segments for polymerase chain reaction amplification and can be applied to identify species rapidly. The present review summarizes the development and application of DNA mini-barcodes over recent years and discusses the limitations of this technique. This review also compares mini-barcoding and meta-barcoding, a technique using universal polymerase chain reaction primers to simultaneously amplify multiple DNA barcodes and identify many species in a single environmental sample. Additionally, other detection methods that can be combined with mini-barcodes, such as nucleotide signatures, high-resolution DNA melting analysis, and gold nanoparticles, are discussed. DNA mini-barcoding can fill the gaps left by other methods in the field of herbal molecular identification.

Glycine tabacina ethanol extract ameliorates collagen-induced arthritis in rats via inhibiting pro-inflammatory cytokines and oxidation.

ETHNOPHARMACOLOGICAL RELEVANCE: The whole plant of Glycine tabacina (Labill.) Benth has been used as a traditional herbal medicine to treat rheumatism, ostealgia and nephritis in China. It is also one of the sources of the renowned native herbal medicine 'I-Tiao-Gung' in Taiwan. AIM OF THE STUDY: This study aimed to investigate the anti-arthritic effect of ethanol extract of G. tabacina (GTE) in a collagen-induced arthritis (CIA) rat model. MATERIALS AND METHODS: The chemical profile of GTE was analyzed by HPLC-UV. The CIA was induced in male Wistar rats by intradermal injection of bovine type II collagen at tail root, back and ankle joints. The rats were orally administrated daily with GTE (1.11, 2.22 and 4.44 g dry weight of herb powder per kg body weight) from day 0 and continued for 30 days. Swelling volume and thickness of paw, arthritis index, X-radiographs and histopathological changes were examined to assess the severity of arthritis. Furthermore, the levels of pro-inflammatory cytokines, such as interleukin1ß (IL-1ß), IL-6 and tumor necrosis factor α (TNF-α), total superoxide dismutase (T-SOD) activity and malonaldehyde (MDA) level were measured to preliminarily explore the possible mechanisms. RESULTS: Oral administration of GTE significantly ameliorated the arthritic symptoms in CIA rat model, as indicated by the effects on paws swelling and arthritis index. X-radiographic analysis and histopathological examinations demonstrated that GTE effectively protected the bone and cartilage of joints from erosion, lesion and deformation. The efficacy of GTE treatment on CIA was comparable to that of indomethacin (positive drug). Besides, the overproduction of IL-1ß, IL-6 and TNF-α was remarkably inhibited in the serum of all GTE treatment groups. The restoration of serum T-SOD activity and MDA level proved that GTE administration alleviated the oxidative stress in CIA rats. CONCLUSIONS: GTE exhibited strong anti-CIA activity through inhibiting pro-inflammatory cytokines and oxidation in rats, suggesting its potential preventive and therapeutic effects on rheumatoid arthritis (RA).

Detection of Cistanches Herba (Rou Cong Rong) Medicinal Products Using Species-Specific Nucleotide Signatures.

Cistanches Herba is a medicinal plant that has tonification properties and is commonly used in Asia. Owing to the imbalance between supply and demand, adulterants are frequently added for profit. However, there is no regulatory oversight because quality control tools are not sufficient for identifying heavily processed products. Thus, a novel molecular tool based on nucleotide signatures and species-specific primers was developed. The ITS2 regions from 251 Cistanches Herba and adulterant samples were sequenced. On the basis of SNP sites, four nucleotide signatures within 30~37 bp and six species-specific primers were developed, and they were validated by artificial experimental mixtures consisting of six different species and different ratios. This method was also applied to detect 66 Cistanches Herba products on the market, including extracts and Chinese patent medicines. The results demonstrated the utility of nucleotide signatures in identifying adulterants in mixtures. The market study revealed 36.4% adulteration: 19.7% involved adulteration with Cynomorium songaricum or Cistanche sinensis, and 16.7% involved substitution with Cy. songaricum, Ci. sinensis, or Boschniakia rossica. The results also revealed that Cy. songaricum was the most common adulterant in the market. Thus, we recommend the use of species-specific nucleotide signatures for regulating adulteration and verifying the quality assurance of medicinal product supply chains, especially for processed products whose DNA is degraded.

Rapid Authentication of Ginkgo biloba Herbal Products Using the Recombinase Polymerase Amplification Assay.

Species adulteration in herbal products (HPs) exposes consumers to health risks. Chemical and morphological methods have their own deficiencies when dealing with the detection of species containing the same active compounds in HPs. In this study, we developed a rapid identification method using the recombinase polymerase amplification (RPA) assay to detect two species, Ginkgo biloba and Sophora japonica (as adulteration), in Ginkgo biloba HPs. Among 36 Ginkgo biloba HP samples, 34 were found to have Ginkgo biloba sequences, and 9 were found to have Sophora japonica sequences. During the authentication process, the RPA-LFS assay showed a higher specificity, sensitivity and efficiency than PCR-based methods. We initially applied the RPA-LSF technique to detect plant species in HPs, demonstrating that this assay can be developed into an efficient tool for the rapid on-site authentication of plant species in Ginkgo biloba HPs.

Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines.

Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.

Identification of crude drugs in the Japanese pharmacopoeia using a DNA barcoding system.

Kampo is the general designation for traditional Japanese herbal medicines, which are recognized as official medicines and listed in the Japanese pharmacopoeia (JP). In most cases, it is difficult to identify the crude drug materials to species level using only traditional identification methods. We report the first online DNA barcode identification system, which includes standard barcode sequences from approximately 95% of the species recorded in the JP (16th edition). This tool provides users with basic information on each crude drug recorded in the JP, DNA barcoding identification of herbal material, and the standard operating procedure (SOP) from sampling to data analysis. ITS2 sequences (psbA-trnH was an alternative when ITS2 could not be amplified) were generated from a total of 576 samples to establish the database. An additional 100 samples (from different medicinal parts, from both single origin and multiple origins and from both retailers and the planting base) were identified using the system. A total of 78% of the test samples were identified as the species listed on their label. This system establishes a model platform for other pharmacopeias from countries like China, Korea, the US and the European Union, for the safe and effective utilization of traditional herbal medicines.

BOKP: A DNA Barcode Reference Library for Monitoring Herbal Drugs in the Korean Pharmacopeia.

Herbal drug authentication is an important task in traditional medicine; however, it is challenged by the limitations of traditional authentication methods and the lack of trained experts. DNA barcoding is conspicuous in almost all areas of the biological sciences and has already been added to the British pharmacopeia and Chinese pharmacopeia for routine herbal drug authentication. However, DNA barcoding for the Korean pharmacopeia still requires significant improvements. Here, we present a DNA barcode reference library for herbal drugs in the Korean pharmacopeia and developed a species identification engine named KP-IDE to facilitate the adoption of this DNA reference library for the herbal drug authentication. Using taxonomy records, specimen records, sequence records, and reference records, KP-IDE can identify an unknown specimen. Currently, there are 6,777 taxonomy records, 1,054 specimen records, 30,744 sequence records (ITS2 and psbA-trnH) and 285 reference records. Moreover, 27 herbal drug materials were collected from the Seoul Yangnyeongsi herbal medicine market to give an example for real herbal drugs authentications. Our study demonstrates the prospects of the DNA barcode reference library for the Korean pharmacopeia and provides future directions for the use of DNA barcoding for authenticating herbal drugs listed in other modern pharmacopeias.

A Nucleotide Signature for the Identification of Angelicae Sinensis Radix (Danggui) and Its Products.

It is very difficult to identify Angelicae sinensis radix (Danggui) when it is processed into Chinese patent medicines. The proposed internal transcribed spacer 2 (ITS2) is not sufficient to resolve heavily processed materials. Therefore, a short barcode for the identification of processed materials is urgently needed. In this study, 265 samples of Angelicae sinensis radix and adulterants were collected. The ITS2 region was sequenced, and based on one single nucleotide polymorphism(SNP) site unique to Angelica sinensis, a nucleotide signature consisting of 37-bp (5'-aatccgcgtc atcttagtga gctcaaggac ccttagg-3') was developed. It is highly conserved and specific within Angelica sinensis while divergent among other species. Then, we designed primers (DG01F/DG01R) to amplify the nucleotide signature region from processed materials. 15 samples procured online were analysed. By seeking the signature, we found that 7 of them were counterfeits. 28 batches of Chinese patent medicines containing Danggui were amplified. 19 of them were found to contain the signature, and adulterants such as Ligusticum sinense, Notopterygium incisum, Angelica decursiva and Angelica gigas were detected in other batches. Thus, this nucleotide signature, with only 37-bp, will broaden the application of DNA barcoding to identify the components in decoctions, Chinese patent medicines and other products with degraded DNA.