Nep1-like proteins as a target for plant pathogen control.

The lack of efficient methods to control the major diseases of crops most important to agriculture leads to huge economic losses and seriously threatens global food security. Many of the most important microbial plant pathogens, including bacteria, fungi, and oomycetes, secrete necrosis- and ethylene-inducing peptide 1 (Nep1)-like proteins (NLPs), which critically contribute to the virulence and spread of the disease. NLPs are cytotoxic to eudicot plants, as they disturb the plant plasma membrane by binding to specific plant membrane sphingolipid receptors. Their pivotal role in plant infection and broad taxonomic distribution makes NLPs a promising target for the development of novel phytopharmaceutical compounds. To identify compounds that bind to NLPs from the oomycetes Pythium aphanidermatum and Phytophthora parasitica, a library of 587 small molecules, most of which are commercially unavailable, was screened by surface plasmon resonance. Importantly, compounds that exhibited the highest affinity to NLPs were also found to inhibit NLP-mediated necrosis in tobacco leaves and Phytophthora infestans growth on potato leaves. Saturation transfer difference-nuclear magnetic resonance and molecular modelling of the most promising compound, anthranilic acid derivative, confirmed stable binding to the NLP protein, which resulted in decreased necrotic activity and reduced ion leakage from tobacco leaves. We, therefore, confirmed that NLPs are an appealing target for the development of novel phytopharmaceutical agents and strategies, which aim to directly interfere with the function of these major microbial virulence factors. The compounds identified in this study represent lead structures for further optimization and antimicrobial product development.

Two-quartet kit* G-quadruplex is formed via double-stranded pre-folded structure.

In the promoter of c-KIT proto-oncogene, whose deregulation has been implicated in many cancers, three G-rich regions (kit1, kit* and kit2) are able to fold into G-quadruplexes. While kit1 and kit2 have been studied in depth, little information is available on kit* folding behavior despite its key role in regulation of c-KIT transcription. Notably, kit* contains consensus sites for SP1 and AP2 transcription factors. Herein, a set of complementary spectroscopic and biophysical methods reveals that kit*, d[GGCGAGGAGGGGCGTGGCCGGC], adopts a chair type antiparallel G-quadruplex with two G-quartets at physiological relevant concentrations of KCl. Heterogeneous ensemble of structures is observed in the presence of Na+ and NH4+ ions, which however stabilize pre-folded structure. In the presence of K+ ions stacking interactions of adenine and thymine residues on the top G-quartet contribute to structural stability together with a G10•C18 base pair and a fold-back motif of the five residues at the 3'-terminal under the bottom G-quartet. The 3'-tail enables formation of a bimolecular pre-folded structure that drives folding of kit* into a single G-quadruplex. Intriguingly, kinetics of kit* G-quadruplex formation matches timescale of transcriptional processes and might demonstrate interplay of kinetic and thermodynamic factors for understanding regulation of c-KIT proto-oncogene expression.

Methylation of selenocysteine catalysed by thiopurine S-methyltransferase.

BACKGROUND: Methylation driven by thiopurine S-methylatransferase (TPMT) is crucial for deactivation of cytostatic and immunosuppressant thiopurines. Despite its remarkable integration into clinical practice, the endogenous function of TPMT is unknown. METHODS: To address the role of TPMT in methylation of selenium compounds, we established the research on saturation transfer difference (STD) and 77Se NMR spectroscopy, fluorescence measurements, as well as computational molecular docking simulations. RESULTS: Using STD NMR spectroscopy and fluorescence measurements of tryptophan residues in TPMT, we determined the binding of selenocysteine (Sec) to human recombinant TPMT. By comparing binding characteristics of Sec in the absence and in the presence of methyl donor, we confirmed S-adenosylmethionine (SAM)-induced conformational changes in TPMT. Molecular docking analysis positioned Sec into the active site of TPMT with orientation relevant for methylation reaction. Se-methylselenocysteine (MeSec), produced in the enzymatic reaction, was detected by 77Se NMR spectroscopy. A direct interaction between Sec and SAM in the active site of rTPMT and the formation of both products, MeSec and S-adenosylhomocysteine, was demonstrated using NMR spectroscopy. CONCLUSIONS: The present study provides evidence on in vitro methylation of Sec by rTPMT in a SAM-dependant manner. GENERAL SIGNIFICANCE: Our results suggest novel role of TPMT and demonstrate new insights into enzymatic modifications of the 21st amino acid.