Nep1-like proteins as a target for plant pathogen control.

The lack of efficient methods to control the major diseases of crops most important to agriculture leads to huge economic losses and seriously threatens global food security. Many of the most important microbial plant pathogens, including bacteria, fungi, and oomycetes, secrete necrosis- and ethylene-inducing peptide 1 (Nep1)-like proteins (NLPs), which critically contribute to the virulence and spread of the disease. NLPs are cytotoxic to eudicot plants, as they disturb the plant plasma membrane by binding to specific plant membrane sphingolipid receptors. Their pivotal role in plant infection and broad taxonomic distribution makes NLPs a promising target for the development of novel phytopharmaceutical compounds. To identify compounds that bind to NLPs from the oomycetes Pythium aphanidermatum and Phytophthora parasitica, a library of 587 small molecules, most of which are commercially unavailable, was screened by surface plasmon resonance. Importantly, compounds that exhibited the highest affinity to NLPs were also found to inhibit NLP-mediated necrosis in tobacco leaves and Phytophthora infestans growth on potato leaves. Saturation transfer difference-nuclear magnetic resonance and molecular modelling of the most promising compound, anthranilic acid derivative, confirmed stable binding to the NLP protein, which resulted in decreased necrotic activity and reduced ion leakage from tobacco leaves. We, therefore, confirmed that NLPs are an appealing target for the development of novel phytopharmaceutical agents and strategies, which aim to directly interfere with the function of these major microbial virulence factors. The compounds identified in this study represent lead structures for further optimization and antimicrobial product development.

Two-quartet kit* G-quadruplex is formed via double-stranded pre-folded structure.

In the promoter of c-KIT proto-oncogene, whose deregulation has been implicated in many cancers, three G-rich regions (kit1, kit* and kit2) are able to fold into G-quadruplexes. While kit1 and kit2 have been studied in depth, little information is available on kit* folding behavior despite its key role in regulation of c-KIT transcription. Notably, kit* contains consensus sites for SP1 and AP2 transcription factors. Herein, a set of complementary spectroscopic and biophysical methods reveals that kit*, d[GGCGAGGAGGGGCGTGGCCGGC], adopts a chair type antiparallel G-quadruplex with two G-quartets at physiological relevant concentrations of KCl. Heterogeneous ensemble of structures is observed in the presence of Na+ and NH4+ ions, which however stabilize pre-folded structure. In the presence of K+ ions stacking interactions of adenine and thymine residues on the top G-quartet contribute to structural stability together with a G10•C18 base pair and a fold-back motif of the five residues at the 3'-terminal under the bottom G-quartet. The 3'-tail enables formation of a bimolecular pre-folded structure that drives folding of kit* into a single G-quadruplex. Intriguingly, kinetics of kit* G-quadruplex formation matches timescale of transcriptional processes and might demonstrate interplay of kinetic and thermodynamic factors for understanding regulation of c-KIT proto-oncogene expression.

Methylation of selenocysteine catalysed by thiopurine S-methyltransferase.

BACKGROUND: Methylation driven by thiopurine S-methylatransferase (TPMT) is crucial for deactivation of cytostatic and immunosuppressant thiopurines. Despite its remarkable integration into clinical practice, the endogenous function of TPMT is unknown. METHODS: To address the role of TPMT in methylation of selenium compounds, we established the research on saturation transfer difference (STD) and 77Se NMR spectroscopy, fluorescence measurements, as well as computational molecular docking simulations. RESULTS: Using STD NMR spectroscopy and fluorescence measurements of tryptophan residues in TPMT, we determined the binding of selenocysteine (Sec) to human recombinant TPMT. By comparing binding characteristics of Sec in the absence and in the presence of methyl donor, we confirmed S-adenosylmethionine (SAM)-induced conformational changes in TPMT. Molecular docking analysis positioned Sec into the active site of TPMT with orientation relevant for methylation reaction. Se-methylselenocysteine (MeSec), produced in the enzymatic reaction, was detected by 77Se NMR spectroscopy. A direct interaction between Sec and SAM in the active site of rTPMT and the formation of both products, MeSec and S-adenosylhomocysteine, was demonstrated using NMR spectroscopy. CONCLUSIONS: The present study provides evidence on in vitro methylation of Sec by rTPMT in a SAM-dependant manner. GENERAL SIGNIFICANCE: Our results suggest novel role of TPMT and demonstrate new insights into enzymatic modifications of the 21st amino acid.

Pursuing origins of (poly)ethylene glycol-induced G-quadruplex structural modulations.

Molecular crowding conditions provided by high concentration of cosolutes are utilized for characterization of biomolecules in cell-mimicking environment and development of drug-delivery systems. In this context, (poly)ethylene glycols are often used for studying non-canonical DNA structures termed G-quadruplexes, which came into focus by emerging structural biology findings and new therapeutic drug design approaches. Recently, several reports were made arguing against using (poly)ethylene glycols in role of molecular crowding agents due to their direct impact on DNA G-quadruplex stability and topology. However, the available data on structural details underlying DNA interaction is very scarce and thus limits in-depth comprehension. Herein, structural and thermodynamic analyses were strategically combined to assess G-quadruplex-cosolute interactions and address previously reported variances regarding the driving forces of G-rich DNA structural transformations under molecular crowding conditions. With the use of complementary (CD, NMR and UV) spectroscopic methods and model approach we characterized DNA G-quadruplex in the presence of the smallest and one of the largest typically used (poly)ethylene glycols. Dehydration effect is the key contributor to ethylene-glycol-induced increased stability of the G-quadruplex, which is in the case of the large cosolute mainly guided by the subtle direct interactions between PEG 8000 and the outer G-quartet regions.

Synergistic complex from plants Solanaceae exhibits cytotoxicity for the human hepatocellular carcinoma cell line HepG2.

BACKGROUND: It had been demonstrated that sugars from various plants can act as potent agents, which induce apoptosis of cancer cells. METHODS: Using HPLC, we fractionated a mixture of two plant extracts from the plant family Solanaceae, namely Capsicum chinense and the plant family Amaryllidaceae namely Allium sativum. We evaluated the effect of different fractions on apoptosis of HepG2 cell line. The most effective fraction was further studied to determine its molecular composition using mass spectrometry (MS) and NMR. We further evaluated the effect of determined molecular composition found in the selected fraction by using a mixture of commercially available substances, which were found in the fraction and tested its pro-apoptotic effect on HepG2 cells. To get some insight into potential apoptotic mechanisms we studied caspase-3 activity and mitochondrial integrity in treated cells. RESULTS: Out of 93 fractions obtained by HPLC from the plant extract we found HPLC fraction 10 (10 min elution) was the most effective. MS and NMR studies revealed high presence of cellobiose together with vitamin C, sulphur (S) and trace amounts of selenium (Se). HPLC fraction 10 triggered apoptosis of HepG2 within 3 h in the 0.01-1.0 mg/mL concentration range. Furthermore, a mixture of pure cellobiose, vitamin C, S and Se (complex cellobiose/C/S/Se) had a very similar capacity in inducing apoptosis of HepG2 cells compared to HPLC fraction 10. Complex cellobiose/C/S/Se was capable of inducing caspase-3 activity and led to loss of mitochondrial integrity. The capacity of cellobiose alone to induce apoptosis of HepG2 was approximately 1000-fold lower compared to complex cellobiose/C/S/Se. CONCLUSION: In this study we present the highly synergistic effect of a unique complex consisting of cellobiose, vitamin C, sulphur and selenium on triggering the apoptosis of human hepatocellular carcinoma (HepG2) cell line.

Isolation, analysis and structures of phototoxic fagopyrins from buckwheat.

Buckwheat products are commonly used in health foods and food supplements. However, public awareness regarding the presence of photodynamic naphthodianthrones fagopyrins that can cause photosensitization is low. At least two additional compounds with structures similar to that of fagopyrin are known to exist; however, the structures of these compounds have never been determined. In this work, we improved the extraction procedure and the chromatographic analysis of fagopyrins by developing a simple, sensitive and high-resolution high performance liquid chromatography (HPLC) analytical method using fluorescence detection. We observed at least six fagopyrin derivatives, which were isolated and characterized via UV-Vis absorption, NMR spectroscopy and mass spectrometry. We determined the structures of two new derivatives (fagopyrin A and fagopyrin E) and proved the existence of protofagopyrins that can transform into fagopyrins upon light exposure. Our methods complement the existing knowledge regarding fagopyrins and will allow for their further analysis, isolation and investigation of their biological activity.

Novel 1,2,4-triazole and imidazole derivatives of L-ascorbic and imino-ascorbic acid: synthesis, anti-HCV and antitumor activity evaluations.

Several novel 1,2,4-triazole and imidazole L-ascorbic acid (1, 2, 3, 5, 6 and 9) and imino-ascorbic acid (4, 7 and 8) derivatives were prepared and evaluated for their inhibitory activity against hepatitis C virus (HCV) replication and human tumour cell proliferation. Compounds 6 and 9 exerted the most pronounced cytostatic effects in all tumour cell lines tested, and were highly selective for human T-cell acute lymphoblastic leukaemia cells (CEM/0) with IC(50)s of 10 ± 4 and 7.3 ± 0.1 µM, respectively. Unlike compound 9, compound 6 showed no toxicity in human diploid fibroblasts. One of the possible mechanisms of action of compound 6 accounting for observed cytostatic activity towards haematological malignancies might be inhibition of inosine monophosphate dehydrogenase (IMPDH) activity, a key enzyme of de novo purine nucleotide biosynthesis providing the cells with precursors for DNA and RNA synthesis indispensable for cell growth and division, which has emerged as an important target for antileukemic therapy. In addition, this compound proved to be the most potent inhibitor of the hepatitis C virus replication as well. However, observed antiviral effect was most likely associated with the effect that the compound exerted on the host cell rather than with selective effect on the replication of the virus itself. In conclusion, results of this study put forward compound 6 as a potential novel antitumor agent (IMPDH inhibitor) for treating leukaemia. Its significant biological activity and low toxicity in human diploid fibroblasts encourage further development of this compound as a lead.

The novel pyrimidine and purine derivatives of l-ascorbic acid: synthesis, one- and two-dimensional 1H and 13C NMR study, cytostatic and antiviral evaluation.

The syntheses of the novel C-5 substituted pyrimidine derivatives of l-ascorbic acid containing free hydroxy groups at C-2' (6-10) or C-2' and C-3' (11-15) positions of the lactone ring are described. Debenzylation of the 6-chloro- and 6-(N-pyrrolyl)purine derivatives of 2,3-O,O-dibenzyl-l-ascorbic acid (16 and 17) gave the new compounds containing hydroxy groups at C-2' (18) and C-2' and C-3' (19 and 20). Z- and E-configuration of the C4'C5' double bond and position of the lactone ring of the compounds 6-9 were deduced from their one- and two-dimensional (1)H and (13)C NMR spectra and connectivities in NOESY and HMBC spectra. Compounds 15 and 18 showed the best inhibitory activities of all evaluated compounds in the series. The compound 15 containing 5-(trifluoromethyl)uracil showed marked inhibitory activity against all human malignant cell lines (IC(50): 5.6-12.8 microM) except on human T-lymphocytes. Besides, this compound influenced the cell cycle by increasing the cell population in G2/M phase and induced apoptosis in SW 620 and MiaPaCa-2 cells. The compound 18 containing 6-chloropurine ring expressed the most pronounced inhibitory activities against HeLa (IC(50): 6.8 microM) and MiaPaCa-2 cells (IC(50): 6.5 microM). The compound 20 with 6-(N-pyrrolyl)purine moiety showed the best differential inhibitory effect against MCF-7 cells (IC(50): 35.9 microM).