Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Results 1 - 6 de 6
Filter
1.
Eur J Surg Oncol ; 48(6): 1264-1271, 2022 06.
Article in English | MEDLINE | ID: mdl-35367109

ABSTRACT

BACKGROUND: In order to avoid excessive treatment of thyroid nodules in the clinic, it is necessary to find a simple and practical analysis method to comprehensively and accurately reflect benign or malignant thyroid nodules. This study aimed to construct and validate a comprehensive and reliable network-based predictive model using a variety of imaging and laboratory criteria for thyroid nodules to stratify the risk of malignancy prior to surgery. METHODS: We retrospectively analyzed data from patients who underwent surgical treatment for thyroid nodules at the Thyroid and Breast Diagnosis and Treatment Center of Weifang Hospital of Traditional Chinese Medicine between January 2018 and December 2020. Binary logical regression analysis was performed to predict whether nodules were malignant or benign. The developmental dataset included 457 patients (January 2018-December 2020). The validation set included separate data points (n = 225, January 2018-December 2020). RESULTS: In this study, criteria that showed significant predictive value for malignant nodules included TI-RADS: 4b (p = 0.065); Bethesda IV, Bethesda V, Bethesda VI (P < 0.0001); BRAFV600E mutation (P < 0.0001); Calcitonin>5 pg/ml (p = 0.0037); and FNA-Tg>30 ng/ml (p = 0.0003). A 10-grade risk scoring system was developed. The risk of malignancy risk ranged from 2.06% to 100% and was positively associated with increasing risk grade. The areas under the receiver-operating characteristic curve of the development and validation sets were 0.972 and 0.946, respectively. CONCLUSION: A simple, comprehensive and reliable web-based predictive model was designed using a variety of imaging and laboratory criteria to stratify thyroid nodules by probability of malignancy.


Subject(s)
Thyroid Neoplasms , Thyroid Nodule , Humans , ROC Curve , Retrospective Studies , Thyroid Neoplasms/pathology , Thyroid Nodule/diagnostic imaging , Thyroid Nodule/surgery , Ultrasonography/methods
2.
Plant Dis ; 2022 Jan 24.
Article in English | MEDLINE | ID: mdl-35072496

ABSTRACT

Bupleurum chinensis is an important traditional medicine with anti-inflammatory and immunomodulatory effects in China (Navarro et al. 2001). So far, the diseases reported on B. chinensis were caused by fungi (rust and root rot) and virus (Cucumber mosaic virus and Broad bean wilt virus 2) (Zhang et al. 2009). However, no diseases caused by nematodes were reported previously. Root-knot nematodes (Meloidogyne spp.) are one of the most destructive plant-parasitic nematodes with strong adaptability and diversity, infecting more than 5,500 plant species (Azevedo de Oliveira et al. 2018). In October 2020, symptoms of dwarf, leaf yellowing and roots with numerous knots on B. chinensis in several fields were observed in Dingxi City, Gansu Province, Northwest China (N 35°19'42″; E 104°2'24″). Subsequently, hundreds of eggs, mature males and females were exuded from dissection of washed root-knots. Morphological characteristics of females, males and J2s were examined under the optical microscope. The perineal patterns of females (n=15) were oval-shaped with a slightly dorsal arches, and the lateral lines and punctations on anus were observed in some specimens. Measurements (mean ± SD, range) of females(n=20): L (body length) = (525.23 ± 59.88 µm, 439.72 to 659.93 µm), W (maximum body width) = (403.92 ± 57.17 µm, 311.01 to 513.34 µm), St (stylet length) = (11.28 ± 1.05 µm, 9.82 to 12.91 µm), MBW (width of the median bulb) = (31.13 ± 3.32 µm, 23.66 to 35.55 µm), MB (distance from anterior end to center of median oesophageal bulb valve) = (64.45 ± 3.44 µm, 58,62 to 71.92 µm), and DGO (dorsal gland orifice to stylet) = (3.79 ± 0.60 µm, 2.72 to 5.00 µm). Male (n=20): L= (1038.25 ± 90.34 µm, 877.28 to 1206.12 µm), St= (18.13 ± 1.48 µm, 15.10 to 20.12 µm), a (body length divided by greatest body width) = (31.77 ± 4.03 µm, 23.29 to 41.16µm), MBW= (10.97 ± 0.78 µm, 9.05 to 12.31 µm), MB= (64.81 ± 3.45 µm, 59.59 to 71.38 µm), DGO= (4.05 ± 0.47 µm, 3.11 to 5.08 µm), and Spic (spicule length) = (22.57 ± 1.91 µm, 19.26 to 26.43 µm). J2 (n=25): L= (381.73 ± 25.85µm, 336.96 to 419.98 µm), St= (10.52 ± 1.03 µm, 9.15 to 12.14 µm), a= (24.35 ± 2.10 µm, 20.45 to 28.29 µm), DGO= (3.02 ± 0.42 µm, 2.42 to 3.79 µm), c (body length divided by tail length) = (8.90 ± 0.86 µm, 7.71 to 10.48 µm), and c' (tail length divided by body width at anus) = (4.18 ± 0.50 µm, 3.47 to 5.04 µm). According to morphological characteristics, root-knot nematode infecting B. chinensis was preliminarily identified as Meloidogyne hapla Chitwood, 1949 (Whitehead 1968). To further verify this result, DNA was extracted from ten individual females, the ITS region and the D2-D3 region of 28S rDNA were amplified using the primer TW81/AB28(GTTTCCGTAGGTGAACCTGC/ ATATGCTTAAGTTCAGCGGGT) (Subbotin et al. 2000) D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/ TCGGAAGGAACCAGCTACTA) (De Ley et al. 1999), respectively. PCR products were purified and sequenced. The sizes of ITS region and D2-D3 region of 28S rDNA were 557 bp and 762 bp, respectively. The sequence of ITS region (GenBank accession number: OK030559) was 99.46%-99.82% identical to the M. hapla from China (MT490918), New Zealand (JX465560), Australia (AF516722) and Japan (LC030357). The sequence of D2-D3 region of 28S rDNA (GenBank accession number: OK030558) was 99.58%-100.00% identical to the M. hapla from Canada (MW182329), Ethiopia (KJ645432), USA (KP901086) and China (MN446015). Furthermore, fragments obtained using the specific primers of M. hapla (Mh-F/Mh-R) were 462 bp, which also was consistent with that of M. hapla (Feng et al. 2008). Through morpho-molecular characterization, the root-knot nematodes on B. chinensis in China were identified as M. hapla. Six seedlings of B. chinensis were planted in 16 cm diameter, 20 cm deep plastic pots with sterilized soil in the greenhouse at 20-25℃ for pathogenicity test. After planted 21 days, 2000 J2s/pot were inoculated, six seedling uninoculated were used as control. After 90 days, all inoculated plants showed similar symptoms observed in the field, and nematode reproduction factor (final population density/initial population density) was 1.47. Meanwhile, no symptoms were observed on control plants. These results proved that the nematode infecting B. chinensis is M. hapla. To our knowledge, this is the first report of B. chinensis as a new host of M. hapla in China. Bupleurum chinensis is widely planted in Gansu Province, the plant species cultivated across an area of about 19.1 million hectares, accounting for 40% of the China's total output (Wang et al. 2017). The root system of B. chinensis infected M. hapla is stunned and short, seriously affect the quality of medicinal materials, and restrict the development of the local Chinese herbal medicine industry.

3.
J Med Microbiol ; 69(6): 797-805, 2020 Jun.
Article in English | MEDLINE | ID: mdl-31778109

ABSTRACT

Introduction. Ankylosing spondylitis (AS) is a systemic progressive disease with an unknown etiology that may be related to the gut microbiome. Therefore, a more thorough understanding of its pathogenesis is necessary for directing future therapy.Aim. We aimed to determine the differences in intestinal microbial composition between healthy individuals and patients with AS who received and who did not receive treatment interventions. In parallel, the pathology of AS in each patient was analysed to better understand the link between AS treatment and the intestinal microbiota of the patients.Methodology. Sixty-six faecal DNA samples, including 37 from healthy controls (HCs), 11 from patients with untreated AS (NM), 7 from patients treated with nonsteroidal anti-inflammatory drugs (e.g. celecoxib; WM) and 11 from patients treated with Chinese herbal medicine (CHM), such as the Bushen-Qiangdu-Zhilv decoction, were collected and used in the drug effect analysis. All samples were sequenced using Illumina HiSeq 4000 and the microbial composition was determined.Results. Four species were enriched in the patients with AS: Flavonifractor plautii, Oscillibacter, Parabacteroides distasonis and Bacteroides nordii (HC vs. NM, P<0.05); only F. plautii was found to be significantly changed in the NM-HC comparison. No additional species were found in the HC vs. CHM analysis, which indicated a beneficial effect of CHM in removing the other three strains. F. plautii was found to be significantly increased in the comparison between the HC and WM groups, along with four other species (Clostridium bolteae, Clostridiales bacterium 1_7_47FAA, C. asparagiforme and C. hathewayi). The patients with AS harboured more bacterial species associated with carbohydrate metabolism and glycan biosynthesis in their faeces. They also had bacterial profiles less able to biodegrade xenobiotics or synthesize and transport vitamins.Conclusion. The gut microbiota of the patients with AS varied from that of the HCs, and the treatment had an impact on this divergence. Our data provide insight that could guide improvements in AS treatment.


Subject(s)
Drugs, Chinese Herbal/therapeutic use , Gastrointestinal Microbiome , Metagenome , Spondylitis, Ankylosing/microbiology , Adolescent , Adult , Dysbiosis , Humans , Middle Aged , Spondylitis, Ankylosing/drug therapy , Spondylitis, Ankylosing/metabolism , Young Adult
4.
Sci Data ; 6(1): 122, 2019 07 15.
Article in English | MEDLINE | ID: mdl-31308375

ABSTRACT

Tea is a globally consumed non-alcohol beverage with great economic importance. However, lack of the reference genome has largely hampered the utilization of precious tea plant genetic resources towards breeding. To address this issue, we previously generated a high-quality reference genome of tea plant using Illumina and PacBio sequencing technology, which produced a total of 2,124 Gb short and 125 Gb long read data, respectively. A hybrid strategy was employed to assemble the tea genome that has been publicly released. We here described the data framework used to generate, annotate and validate the genome assembly. Besides, we re-predicted the protein-coding genes and annotated their putative functions using more comprehensive omics datasets with improved training models. We reassessed the assembly and annotation quality using the latest version of BUSCO. These data can be utilized to develop new methodologies/tools for better assembly of complex genomes, aid in finding of novel genes, variations and evolutionary clues associated with tea quality, thus help to breed new varieties with high yield and better quality in the future.


Subject(s)
Camellia sinensis/genetics , Genome, Plant , Molecular Sequence Annotation , Sequence Analysis, DNA , Tea
5.
Proc Natl Acad Sci U S A ; 115(18): E4151-E4158, 2018 05 01.
Article in English | MEDLINE | ID: mdl-29678829

ABSTRACT

Tea, one of the world's most important beverage crops, provides numerous secondary metabolites that account for its rich taste and health benefits. Here we present a high-quality sequence of the genome of tea, Camellia sinensis var. sinensis (CSS), using both Illumina and PacBio sequencing technologies. At least 64% of the 3.1-Gb genome assembly consists of repetitive sequences, and the rest yields 33,932 high-confidence predictions of encoded proteins. Divergence between two major lineages, CSS and Camellia sinensis var. assamica (CSA), is calculated to ∼0.38 to 1.54 million years ago (Mya). Analysis of genic collinearity reveals that the tea genome is the product of two rounds of whole-genome duplications (WGDs) that occurred ∼30 to 40 and ∼90 to 100 Mya. We provide evidence that these WGD events, and subsequent paralogous duplications, had major impacts on the copy numbers of secondary metabolite genes, particularly genes critical to producing three key quality compounds: catechins, theanine, and caffeine. Analyses of transcriptome and phytochemistry data show that amplification and transcriptional divergence of genes encoding a large acyltransferase family and leucoanthocyanidin reductases are associated with the characteristic young leaf accumulation of monomeric galloylated catechins in tea, while functional divergence of a single member of the glutamine synthetase gene family yielded theanine synthetase. This genome sequence will facilitate understanding of tea genome evolution and tea metabolite pathways, and will promote germplasm utilization for breeding improved tea varieties.


Subject(s)
Camellia sinensis/genetics , Evolution, Molecular , Gene Duplication , Genome, Plant , Tea , Camellia sinensis/metabolism
6.
PLoS One ; 8(1): e53409, 2013.
Article in English | MEDLINE | ID: mdl-23326424

ABSTRACT

BACKGROUND: The Macleaya spp., including Macleaya cordata and Macleaya microcarpa, are traditional anti-virus, inflammation eliminating, and insecticide herb medicines for their isoquinoline alkaloids. They are also known as the basis of the popular natural animal food addictive in Europe. However, few studies especially at genomics level were conducted on them. Hence, we performed the Macleaya spp. transcriptome and integrated it with iTRAQ proteome analysis in order to identify potential genes involved in alkaloids biosynthesis. METHODOLOGY AND PRINCIPAL FINDINGS: We elaborately designed the transcriptome, proteome and metabolism profiling for 10 samples of both species to explore their alkaloids biosynthesis. From the transcriptome data, we obtained 69367 and 78255 unigenes for M. cordata and M. microcarpa, in which about two thirds of them were similar to sequences in public databases. By metabolism profiling, reverse patterns for alkaloids sanguinarine, chelerythrine, protopine, and allocryptopine were observed in different organs of two species. We characterized the expressions of enzymes in alkaloid biosynthesis pathways. We also identified more than 1000 proteins from iTRAQ proteome data. Our results strongly suggest that the root maybe the organ for major alkaloids biosynthesis of Macleaya spp. Except for biosynthesis, the alkaloids storage and transport were also important for their accumulation. The ultrastructure of laticifers by SEM helps us to prove the alkaloids maybe accumulated in the mature roots. CONCLUSIONS/SIGNIFICANCE: To our knowledge this is the first study to elucidate the genetic makeup of Macleaya spp. This work provides clues to the identification of the potential modulate genes involved in alkaloids biosynthesis in Macleaya spp., and sheds light on researches for non-model medicinal plants by integrating different high-throughput technologies.


Subject(s)
Alkaloids/biosynthesis , Metabolome/genetics , Papaveraceae/genetics , Papaveraceae/metabolism , Proteome/metabolism , Transcriptome/genetics , Alkaloids/chemistry , Biological Transport , Biosynthetic Pathways/genetics , Cytochrome P-450 Enzyme System/genetics , Databases, Protein , Gene Expression Profiling , Gene Expression Regulation, Plant , Genes, Plant/genetics , Isotope Labeling , Molecular Sequence Annotation , Molecular Sequence Data , Organ Specificity/genetics , Papaveraceae/ultrastructure , Plant Proteins/genetics , Plant Proteins/metabolism , Proteome/genetics , Real-Time Polymerase Chain Reaction , Reproducibility of Results , Signal Transduction/genetics
SELECTION OF CITATIONS
SEARCH DETAIL