Alleviation potential of green-synthesized selenium nanoparticles for cadmium stress in Solanum lycopersicum L: modulation of secondary metabolites and physiochemical attributes.

KEY MESSAGE: Selenium nanoparticles reduce cadmium absorption in tomato roots, mitigating heavy metal effects. SeNPs can efficiently help to enhance growth, yield, and biomolecule markers in cadmium-stressed tomato plants. In the present study, the effects of selenium nanoparticles (SeNPs) were investigated on the tomato plants grown in cadmium-contaminated soil. Nanoparticles were synthesized using water extract of Nigella sativa and were characterized for their size and shape. Two application methods (foliar spray and soil drench) with nanoparticle concentrations of 0, 100, and 300 mg/L were used to observe their effects on cadmium-stressed plants. Growth, yield, biochemical, and stress parameters were studied. Results showed that SeNPs positively affected plant growth, mitigating the negative effects of cadmium stress. Shoot length (SL), root length (RL), number of branches (NB), number of leaves per plant (NL), and leaf area (LA) were significantly reduced by cadmium stress but enhanced by 45, 51, 506, 208, and 82%, respectively, by soil drench treatment of SeNPs. Similarly, SeNPs increased the fruit yield (> 100%) and fruit weight (> 100%), and decreased the days to fruit initiation in tomato plants. Pigments were also positively affected by the SeNPs, particularly in foliar treatment. Lycopene content was also enhanced by the addition of NPs (75%). Furthermore, the addition of SeNPs improved the ascorbic acid, protein, phenolic, flavonoid, and proline contents of the tomato plants under cadmium stress, whereas stress enzymes also showed enhanced activities under cadmium stress. It is concluded from the present study that the addition of selenium nanoparticles enhanced the growth and yield of Cd-stressed plants by reducing the absorption of cadmium and increasing the stress management of plants.

Interactions between Bacillus thuringiensis and selected plant extracts for sustainable management of Phthorimaea absoluta.

Phthorimaea absoluta is a global constraint to tomato production and can cause up to 100% yield loss. Farmers heavily rely on synthetic pesticides to manage this pest. However, these pesticides are detrimental to human, animal, and environmental health. Therefore, exploring eco-friendly, sustainable Integrated Pest Management approaches, including biopesticides as potential alternatives, is of paramount importance. In this context, the present study (i) evaluated the efficacy of 10 Bacillus thuringiensis isolates, neem, garlic, and fenugreek; (ii) assessed the interactions between the most potent plant extracts and B. thuringiensis isolates, and (iii) evaluated the gut microbial diversity due to the treatments for the development of novel formulations against P. absoluta. Neem recorded the highest mortality of 93.79 ± 3.12% with an LT50 value of 1.21 ± 0.24 days, Bt HD263 induced 91.3 ± 3.68% mortality with LT50 of 2.63 ± 0.11 days, compared to both Bt 43 and fenugreek that caused < 50% mortality. Larval mortality was further enhanced to 99 ± 1.04% when Bt HD263 and neem were combined. Furthermore, the microbiome analyses showed that Klebsiella, Escherichia and Enterobacter had the highest abundance in all treatments with Klebsiella being the most abundant. In addition, a shift in the abundance of the bacterial genera due to the treatments was observed. Our findings showed that neem, garlic, and Bt HD263 could effectively control P. absoluta and be integrated into IPM programs after validation by field efficacy trials.

Cell wall as a barrier for protein extraction from tomato leaves: A biochemical study.

Solanum lycopersicum (Tomato) leaves and stems are considered waste. Valorization of this waste can be achieved by for example the extraction of proteins. This prospect is promising but currently not feasible, since protein extraction yields from tomato leaves are low, amongst other due to the (physical) barrier formed by the plant cell walls. However, the molecular aspects of the relationship between cell wall properties and protein extractability from tomato leaves are currently not clear and thus objective of this study. To fill this knowledge gap the biochemical composition of plant cell walls was measured and related to protein extraction yields at different plant ages, leaf positions, and across different tomato accessions, including two Solanum lycopersicum cultivars and the wildtype species S. pimpinellifolium and S. pennellii. For all genotypes, protein extraction yields from tomato leaves were the highest in young tissues, with a decreasing trend towards older plant material. This decrease of protein extraction yield was accompanied by a significant increase of arabinose and galacturonic acid content and a decrease of galactose content in the cell walls of old-vs-young tissues. This resulted in strong negative correlations between protein extraction yield and the content of arabinose and galacturonic acid in the cell wall, and a positive correlation between the content of galactose and protein extraction yield. Overall, these results point to the importance of the pectin network on protein extractability, making pectin a potential breeding target for enhancing protein extractability from tomato leaves.

Knockout of SlDCL2b attenuates the resistance of tomato to potato spindle tuber viroid infection.

RNA interference, or RNA silencing, is an important defence mechanism against viroid infection in plants. Plants encode multiple DICER-LIKE (DCL) proteins that are key components of the RNA silencing pathway. However, the roles of different DCLs in defence responses against viroid infection remain unclear. Here, we determined the function of tomato DCL2b (SlDCL2b) in defence responses against potato spindle tuber viroid (PSTVd) infection using SlDCL2b loss-of-function tomato mutant plants. Compared with wild-type plants, mutant plants were more susceptible to PSTVd infection, developing more severe symptoms earlier and accumulating higher levels of PSTVd RNAs. Moreover, we verified the feedback mechanism for the regulation of SlDCL2b expression by miR6026. Functional blocking of tomato miR6026, by expressing its target mimics, can enhance resistance to PSTVd infection in tomato plants. These findings deepen the current understanding of RNAi-based resistance against viroid infection and provide a potentially new strategy for viroid control.

Growth performance, plasma metabolites, meat quality, and meat and lipid health indices of New Zealand White rabbits as affected by dietary dried tomato pomace powder supplementation during the summer season.

One hundred and twenty New Zealand White rabbits (NZW) (5-week-old; 735.27 ± 27.23 g) were kept in an open-sided house during the summer season. The experiment aims to evaluate the impacts of dried tomato pomace powder (DTPP) supplementation on rabbits' performance, blood metabolites, carcass traits, meat quality, and lipid and health indices of NZW rabbits during 5-13 weeks of age. The four treatments were a standard rabbit feed (control) and the control diet supplemented with 0.5, 1.0, and 1.5% DTPP, respectively. Rabbits fed a diet containing 1.5% DTPP showed the highest growth rate through weeks 9-13 of age despite having the lowest feed intake spanning 5-13 weeks. The best feed conversion ratio (FCR) was recorded in rabbits fed with 1.5% DTPP-supplemented diet for 5-13 weeks. Diets supplemented with 0.5 or 1.0% DTPP enhanced markedly dressing %, total edible flesh, saturated (SFAs), monounsaturated (MUFAs), and polyunsaturated fatty acid (PUFAs) contents, as well as the ∑n - 6/∑n - 3 ratio and the total n - 6 of meat. Dietary supplementation with DTPP decreased kidney, abdominal, and back fat. Diets supplemented with DTTP decreased total cholesterol, triglycerides, and very low-density lipoprotein (vLDL) concentrations. The greatest levels of linoleic acid, arachidonic and water-holding capacity in meat were observed in rabbits fed 1.5% DTPP-supplemented diets. Diets containing 1 and 1.5% DTPP improved meats' atherogenic and thrombogenic indices, meat lipid quality desired fatty acids/undesired fatty acids ratio, and meat health index. Conclusively, DTPP up to 1.5% maintained the growth performance of rabbits, boosted meat quality through increasing vitamin E, reduced fat deposition, modified fatty acid composition, and improved atherogenic, thrombogenic, and hypocholesterolemic indices of rabbit meat.

Use of ginger extract and bacterial inoculants for the suppression of Alternaria solani causing early blight disease in Tomato.

Early blight (EB), caused by Alternaria solani, is a serious problem in tomato production. Plant growth-promoting rhizobacteria promote plant growth and inhibit plant disease. The present study explored the bio-efficacy of synergistic effect of rhizobacterial isolates and ginger powder extract (GPE) against tomato EB disease, singly and in combination. Six fungal isolates from symptomatic tomato plants were identified as A. solani on the basis of morphological features i.e., horizontal septation (6.96 to 7.93 µm), vertical septation (1.50 to 2.22 µm), conidia length (174.2 to 187.6 µm), conidial width (14.09 to 16.52 µm), beak length (93.06 to 102.26 µm), and sporulation. Five of the twenty-three bacterial isolates recovered from tomato rhizosphere soil were nonpathogenic to tomato seedlings and were compatible with each other and with GPE. Out of five isolates tested individually, three isolates (St-149D, Hyd-13Z, and Gb-T23) showed maximum inhibition (56.3%, 48.3%, and 42.0% respectively) against mycelial growth of A. solani. Among combinations, St-149D + GPE had the highest mycelial growth inhibition (76.9%) over the untreated control. Bacterial strains molecularly characterized as Pseudomonas putida, Bacillus subtilis, and Bacillus cereus and were further tested in pot trials through seed bacterization for disease control. Seeds treated with bacterial consortia + GPE had the highest disease suppression percentage (78.1%), followed by St-149D + GPE (72.2%) and Hyd-13Z + GPE (67.5%). Maximum seed germination was obtained in the bacterial consortia + GPE (95.0 ± 2.04) followed by St-149D + GPE (92.5 ± 1.44) and Hyd-13Z + GPE (90.0 ± 2.04) over control (73.8 ± 2.39) and chemical control as standard treatment (90.0 ± 2). Ginger powder extracts also induce the activation of defence-related enzymes (TPC, PO, PPO, PAL, and CAT) activity in tomato plants. These were highly significant in the testing bacterial inoculants against A. solani infection in tomato crops.

A biocompatible NPK+Fe+Zn slow release fertilizer: synthesis and its evaluation in tomato plant growth improvement.

Slow-release fertilizers (SRFs) play an essential and necessary role in sustainable agriculture. Using slow-release and environment friendly fertilizers can increase the growth of plants and reduce the loss of nutrients. Considering the deficiency of iron (Fe) and zinc (Zn) in calcareous soils, a slow-release fertilizer was prepared based on the polymeric nanocomposite, which contains NPK, Fe, and Zn. Its potential was evaluated on tomato plant growth by conducting an experiment in a factorial completely randomized design with three replications. Two levels of salinity (2 and 5 ds m-1, two types of soil texture) clay loam and sandy loam) and five levels of fertilizers were examined in the experiment. To this, the graphene oxide-chitosan coated-humic acid@Fe3O4 nanoparticles (Fe3O4@HA@GO-Cs), and the graphene oxide-chitosan coated-ammonium zinc phosphate (AZP@GO-Cs) were used as Fe and Zn sources, respectively. Then, the optimal Fe and Zn fertilizers in the presence of urea, phosphorus, and potassium slow- release fertilizers (SRF) were investigated under greenhouse conditions. The results indicated that the best improvement in growth and nutrient uptake in plants was achieved by using the SRF. Notably, in the shoots of tomato plants, the nitrogen, phosphorus, potassium, Fe, and Zn concentration increased by 44, 66, 46, 75, and 74% compared to the control. The use of nanofertilizer can be an effective, biocompatible, and economical option to provide Fe and Zn demand in plants.

Efficacy of ergosterol peroxide obtained from the endophytic fungus Acrophialophora jodhpurensis against Rhizoctonia solani.

AIM: To investigate antifungal activity of the extract and major metabolite of the endophytic fungus Acrophialophora jodhpurensis (belonging to Chaetomiaceae) against crown and root rot caused by Rhizoctonia solani (teleomorph: Thanatephorus cucumeris), as an important pathogen of tomato. METHODS AND RESULTS: The endophytic fungus A. jodhpurensis, has high inhibitory effect against R. solani AG4-HG II in vitro and in vivo. The media conditions were optimized for production of the endophyte's metabolites. The highest amounts of secondary metabolites were produced at pH 7, 30°C temperature, and in the presence of 0.5% glucose, 0.033% sodium nitrate, and 1 gl-1 asparagine as the best carbon, nitrogen, and amino acid sources, respectively. The mycelia were extracted by methanol and the obtained extract was submitted to various chromatography techniques. Phytochemical analysis via thin-layer chromatography (TLC) and nuclear magnetic resonance (NMR) spectroscopy showed that ergosterol peroxide was the major component in the extract of this endophyte. Antifungal activities of the methanolic extract and ergosterol peroxide in the culture media were studied against R. solani. Minimum inhibitory concentrations of the extract and ergosterol peroxide against the pathogen were 600 and 150 µg ml-1, respectively. Ergosterol peroxide revealed destructive effects on the pathogen structures in microscopic analyses and induced sclerotia production. Histochemical analyses revealed that it induced apoptosis in the mycelia of R. solani via superoxide production and cell death. Application of ergosterol peroxide in the leaf disc assay reduced the disease severity in tomato leaves. CONCLUSIONS: Antifungal metabolites produced by A. jodhpurensis, such as ergosterol peroxide, are capable of controlling destructive Rhizoctonia diseases on tomato.

Reactive oxygen species are signaling molecules that modulate plant reproduction.

Reactive oxygen species (ROS) can serve as signaling molecules that are essential for plant growth and development but abiotic stress can lead to ROS increases to supraoptimal levels resulting in cellular damage. To ensure efficient ROS signaling, cells have machinery to locally synthesize ROS to initiate cellular responses and to scavenge ROS to prevent it from reaching damaging levels. This review summarizes experimental evidence revealing the role of ROS during multiple stages of plant reproduction. Localized ROS synthesis controls the formation of pollen grains, pollen-stigma interactions, pollen tube growth, ovule development, and fertilization. Plants utilize ROS-producing enzymes such as respiratory burst oxidase homologs and organelle metabolic pathways to generate ROS, while the presence of scavenging mechanisms, including synthesis of antioxidant proteins and small molecules, serves to prevent its escalation to harmful levels. In this review, we summarized the function of ROS and its synthesis and scavenging mechanisms in all reproductive stages from gametophyte development until completion of fertilization. Additionally, we further address the impact of elevated temperatures induced ROS on impairing these reproductive processes and of flavonol antioxidants in maintaining ROS homeostasis to minimize temperature stress to combat the impact of global climate change on agriculture.

Platelet hyperactivity: a comparison of water-soluble, bioactive compound levels in commercial tomato products and water-soluble tomato concentrate, a supplement with an approved EFSA antiplatelet health effect.

The aim of this study was to evaluate and compare the concentration of water-soluble bioactive compounds in tomato products (polyphenols profile, water-soluble vitamins and nucleophilic substances) with the concentration of the same bioactive molecules existing in a water-soluble patented tomato extract, water-soluble tomato extract (WSTC), commercially available as FruitFlow®. This patented tomato extract has been recognised by EFSA (European Food Safety Authority) in a specific Health Claim declaration as having an "Antiplatelet health effect". More than 100 commercial tomato samples, coming from 18 different processing tomato companies worldwide, were analysed and compared with the FruitFlow® supplement. According to the multivariate statistical analyses applied to the data matrix, it is possible to conclude that the commercial tomato products measured (pastes, purees, others) show a significantly higher concentration of water-soluble bioactive molecules (nucleosides/nucleotides and polyphenols) responsible for an anti-platelet aggregation effect than the FruitFlow® dietary supplement.

Fungicide potential of citronella and tea tree essential oils against tomato cultivation's phytopathogenic fungus Fusarium oxysporum f. sp. lycopersici and analysis of their chemical composition by GC/MS.

Tomato is one of the most produced and consumed fruits in the world. However, it is a crop that faces several phytosanitary problems, such as fusarium wilt, caused by Fusarium oxysporum. Thus, this study aimed to evaluate citronella and melaleuca essential oils in vitro potential in the fungus F. oxysporum management. The chemical identification of the components in the essential oils was performed by gas chromatography with flame ionization and mass spectrometer detectors. The IC50 and IC90 were determined by linear regression and the percentage of inhibition of the fungus by analysis of variance. The major compounds in citronella essential oil were citronellal, Geraniol, and citronellol; in melaleuca (tea tree) oil were terpinen-4-ol and α-terpinene. Both oils promoted more significant inhibition at concentrations of 1.5 and 2.5 µL/mL, besides not presenting significant differences with commercial fungicides, confirming the high potential for using this control method in agriculture.

Effect of microwave-vacuum drying on the physicochemical properties of a functional tomato snack bar.

BACKGROUND: Tomato is an indispensable ingredient of the Mediterranean diet. Reformulation of traditional Mediterranean products to increase the adherence of consumers is becoming popular. In this study, a tomato snack bar enriched with olive powder and pea protein was developed by using microwave-vacuum drying. Formulations also included tomato powder (TP) and low-methoxylated pectin (LMP) as a structuring agent. RESULTS: The moisture content of microwave-vacuum-dried samples varied in the range 13.6-19.8% and water activity (aw ) values were ~0.6. LMP and TP concentrations affected the color of microwave-vacuum-dried samples. However, the color mainly changed in conventionally dried samples due to browning. In microwave-vacuum-dried samples, lycopene content decreased with increasing LMP, but increased with increasing TP. Textural properties of microwave-vacuum-dried snack bars increased with increasing LMP and TP. CONCLUSION: Both texture and Fourier transform infrared spectroscopy results indicated that there was a network formation due to the contribution of protein and pectin; however, the type of interaction was highly dependent on the drying mechanism. Nuclear magnetic resonance relaxometry data showed that microwave-vacuum-dried samples had a more uniform water distribution. Besides its time and energy efficiency, microwave-vacuum drying improved the color and textural properties of tomato snack bars compared to conventionally dried ones. © 2023 The Authors. Journal of The Science of Food and Agriculture published by John Wiley & Sons Ltd on behalf of Society of Chemical Industry.

Steroidal Alkaloids from Food Waste of Tomato Processing Inhibit Neuroblastoma Cell Viability.

Nowadays, there is considerable attention toward the use of food waste from food processing as possible sources of compounds with health properties, such as anticancer activity. An example is tomato processing, which is responsible for generating a remarkable amount of waste (leaves, peel, seeds). Therefore, our goal was to evaluate the potential anticancer property of tomato extracts, in particular "Datterino" tomato (DT) and "Piccadilly" tomato (PT), and to study their phytochemical composition. Liquid chromatography with tandem mass spectrometry (LC/MS-MS) results showed that these extracts are rich in alkaloids, flavonoids, fatty acids, lipids, and terpenes. Furthermore, their potential anticancer activity was evaluated in vitro by MTT assay. In particular, the percentage of cell viability was assessed in olfactory ensheathing cells (OECs), a particular glial cell type of the olfactory system, and in SH-SY5Y, a neuroblastoma cell line. All extracts (aqueous and ethanolic) did not lead to any significant change in the percentage of cell viability on OECs when compared with the control. Instead, in SH-SY5Y we observed a significant decrease in the percentage of cell viability, confirming their potential anticancer activity; this was more evident for the ethanolic extracts. In conclusion, tomato leaves extracts could be regarded as a valuable source of bioactive compounds, suitable for various applications in the food, nutraceutical, and pharmaceutical fields.

BEL transcription factors in prominent Solanaceae crops: the missing pieces of the jigsaw in plant development.

MAIN CONCLUSION: Understanding BEL transcription factors roles in potato and tomato varies considerably with little overlap. The review suggests reciprocal use of gained results to proceed with the knowledge in both crops The proper development of organs that plants use for reproduction, like fruits or tubers, is crucial for the survival and competitiveness of the species and thus subject to strict regulations. Interestingly, the controls of potato (Solanum tuberosum) tuber and tomato (S. lycopersicum) fruit development use common mechanisms, including the action of the BEL transcription factors (TFs). Although more than ten BEL genes have been identified in either genome, only a few of them have been characterized. The review summarizes knowledge of BEL TFs' roles in these closely related Solanaceae species, focusing on those that are essential for tuberization in potato, namely StBEL5, StBEL11 and StBEL29, and for fruit development in tomato - SlBEL11, SlBL2 and SIBL4. Comprehension of the roles of individual BEL TFs, however, is not yet sufficient. Different levels of understanding of important characteristics are described, such as BEL transcript accumulation patterns, their mobility, BEL protein interaction with KNOX partners, subcellular localisation, and their target genes during initiation and development of the organs in question. A comparison of the knowledge on BEL TFs and their mechanisms of action in potato and tomato may provide inspiration for faster progress in the study of both models through the exchange of information and ideas. Both crops are extremely important for human nutrition. In addition, their production is likely to be threatened by the upcoming climate change, so there is a particular need for breeding using a deep knowledge of control mechanisms.

First report of tomato brown rugose fruit virus infecting Solanum lycopersicum in Northeast China.

Tomato (Solanum lycopersicum L.) is an important fruit and vegetable crop with high economic value due to its rich vitamins (Friedman. 2002). Over the past five years, due to tomato brown rugose fruit virus (ToBRFV) infection, the tomato production in many countries and regions in Asia, America and Europe have experienced declines in yield and quality (Salem et al. 2023). ToBRFV is a positive-sense single-stranded RNA virus of the genus Tobamovirus in the family Virgaviridae (Salem et al. 2016). In the field, ToBRFV mainly infects solanaceous crops, including tomato and pepper (Zhang et al. 2022). Symptoms on ToBRFV-infected tomato plants mainly include foliar mottle, vein necrosis, and brown mottled rugose fruit (Alfaro-Fernández et al. 2020, Hamborg et al. 2022, Ma et al. 2021). In April 2023, about 150 tomato plants showing leaf curl, brown patch, and rugose surface on fruits were found in a greenhouse grown with about 500 tomato plants in Huludao City, Liaoning province, China. Two leaves and eight fruits from each of 10 symptomatic tomato plants were sampled and subjected to dot enzyme-linked immunosorbent assay (Dot-ELISA) with an antibody against ToBRFV (LV BAO, Chengdu, China); and all samples tested positive. Sap inoculations were prepared from 0.1 g of ToBRFV-positive tomato leaves via homogenization with 0.01 mol·L-1 PBS (phosphate buffered saline, pH 7.2), which were then inoculated mechanically onto 10 tomato cv. Moneymaker and 10 Nicotiana benthamiana plants at four- to six-leaf stage, respectively. At 10 days post inoculation (dpi), the leaf curl symptoms of all tomato plants were shown, which were consistent with those on greenhouse-infected plants. At 5 dpi, the upper leaves of all N. benthamiana plants showed yellowing and curling symptoms. The results of Dot-ELISA assays revealed that these mechanically inoculated plants were positive for ToBRFV. Total RNAs of inoculated and greenhouse-collected samples were extracted using TRIzolTM reagent and analyzed by reverse-transcription (RT)-PCR with specific primers ToBRFV-FD (5' GTCCCGATGTCTGTAAGGCTTGC) and ToBRFV-RD (5' GCAGGTGCAGAGGACCATTGTAA) for ToBRFV detection, respectively. The results showed that a 680-bp fragment was obtained in all tested samples. Then, primers ToBRFV-F1 (5' GTGTATTTTTTACAACATATACC) and ToBRFV-R1 (5' AACCATTGACTCAGAACTC), ToBRFV-F2 (5' TAGCCAAGAATCACGCATG) and ToBRFV-R2 (5' AGCAGCAATAATCACCGTA), ToBRFV-F3 (GAAAGAGTGGGGACGTTACAACATTCATCGGTAAT) and ToBRFV-R3 (TGGGCCCCTACCGGGGGTTCCGGGGGAATTCGAAT) were used to amplify the full-length sequence of ToBRFV using field-collected samples. The methods of primer design are shown in supplemental file 1. The sequence obtained by Sanger sequencing showed 99.86% nucleotide (nt) identity with ToBRFV-SD isolate (accession no. MT018320.1) from Shandong province, China. The full-length sequence of ToBRFV was uploaded to GenBank database with the accession number OR437354. To our knowledge, this is the first report of ToBRFV infecting tomato in Northeast China.

Enhancing tomato plant growth in a saline environment through the eco-friendly synthesis and optimization of nanoparticles derived from halophytic sources.

Using green synthesis methods to produce halophytic nanoparticles presents a promising and cost-effective approach for enhancing plant growth in saline environments, offering agricultural resilience as an alternative to traditional chemical methods. This study focuses on synthesizing zinc oxide (ZnO) nanoparticles derived from the halophyte Withania somnifera, showcasing their potential in ameliorating tomato growth under salinity stress. The biosynthesis of ZnO nanoparticles was initially optimized (i.e., salt concentration, the amount of plant extract, pH, and temperature) using a central composite design (CCD) of response surface methodology (RSM) together with UV-Vis spectroscopy, Fourier transform infrared spectroscopy (FT-IR), field emission scanning electron microscopy (FESEM), energy dispersive spectroscopy (EDS), X-ray diffraction (XRD), and dynamic light scattering (DLS) to comprehensively characterize the biosynthesized ZnO NPs. The central composite design (CCD) based response surface methodology (RSM) was used to optimize the biosynthesis of ZnO nanoparticles (NPs) by adjusting salt concentration, plant extract, pH, and temperature. The ZnO NPs were characterized using UV-Vis spectroscopy, Fourier transform infrared spectroscopy (FT-IR), field emission scanning electron microscopy (FESEM), energy dispersive spectroscopy (EDS), X-ray diffraction (XRD), and dynamic light scattering (DLS). FT-IR showed an absorption peak of ZnO between 400 and 600 cm-1, while SEM showed irregular shapes ranging between 1.3 and 6 nm. The data of EDX showed the presence of Zn (77.52%) and O (22.48%) levels, which exhibited the high purity synthesized ZnO under saline conditions. Introducing ZnO nanoparticles to tomato plants resulted in a remarkable 2.3-fold increase in shoot length in T23 (100 mg/L ZnO nanoparticles + 50 mM NaCl). There was an observable increase in foliage at T2 (20 mg L-1 ZnO) and T23 (100 mg L-1 ZnO-NPs + 50 mM NaCl). Tomato plants treated with T2 (20 mg L-1 ZnO) and T23 (100 mg L-1 ZnO-NPs + 50 mM NaCl) improved root elongation compared to the control plant group. Both fresh and dry leaf masses were significantly improved in T1 (10 mg L-1 ZnO) by 7.1-fold and T12 (10 mg L-1 ZnO-NPs + 100 mM NaCl) by 0.8-fold. The concentration of Zn was higher in T12 (10 mg L-1 ZnO NPs + 100 mM NaCl) among all treatments. Our findings prove that utilizing ZnO nanoparticles under saline conditions effectively promotes tomato plants' growth, thereby mitigating the negative impacts of salt stress.

The ORGAN SIZE (ORG) locus modulates both vegetative and reproductive gigantism in domesticated tomato.

BACKGROUND AND AIMS: Gigantism is a key component of the domestication syndrome, a suite of traits that differentiates crops from their wild relatives. Allometric gigantism is strongly marked in horticultural crops, causing disproportionate increases in the size of edible parts such as stems, leaves or fruits. Tomato (Solanum lycopersicum) has attracted attention as a model for fruit gigantism, and many genes have been described controlling this trait. However, the genetic basis of a corresponding increase in size of vegetative organs contributing to isometric gigantism has remained relatively unexplored. METHODS: Here, we identified a 0.4-Mb region on chromosome 7 in introgression lines (ILs) from the wild species Solanum pennellii in two different tomato genetic backgrounds (cv. 'M82' and cv. 'Micro-Tom') that controls vegetative and reproductive organ size in tomato. The locus, named ORGAN SIZE (ORG), was fine-mapped using genotype-by-sequencing. A survey of the literature revealed that ORG overlaps with previously mapped quantitative trait loci controlling tomato fruit weight during domestication. KEY RESULTS: Alleles from the wild species led to lower cell number in different organs, which was partially compensated by greater cell expansion in leaves, but not in fruits. The result was a proportional reduction in leaf, flower and fruit size in the ILs harbouring the alleles from the wild species. CONCLUSIONS: Our findings suggest that selection for large fruit during domestication also tends to select for increases in leaf size by influencing cell division. Since leaf size is relevant for both source-sink balance and crop adaptation to different environments, the discovery of ORG could allow fine-tuning of these parameters.

Tomato lipidic extract plus selenium decrease prostatic hyperplasia, dihydrotestosterone and androgen receptor expression versus finasteride in rats.

PURPOSE: Evaluate the therapeutic effect of a tomato lipidic extract (STE) in combination with selenium (Se) on rats with prostatic hyperplasia (PH) and to observe its possible mechanisms of action and synergism versus finasteride. MATERIALS AND METHODS: 54 male Wistar rats of nine weeks old were divided in Control (C), PH, Finasteride (F), STE, Se, F + STE, F + Se, STE + Se and F + STE + Se with testosterone enanthate (except C). After 4 weeks of treatment administration, prostate weight, bladder weight, diuresis, prooxidant and antioxidant activity, dihydrotestosterone (DHT), androgen receptor (AR) expression and anatomopathological analysis were determined. RESULTS: STE + Se decreased prostate weight 53.8% versus 28% in F group, also STE + Se decreased significatively glandular hyperplasia, prooxidant activity, DHT and AR expression and increased diuresis and antioxidant activity versus finasteride which increased MDA in prostate. CONCLUSIONS: These results demonstrate a greater therapeutic and beneficial effect of tomato lipidic extract in combination with Se in young rats with PH with respect to finasteride without increase prooxidant activity.

Dually biofortified cisgenic tomatoes with increased flavonoids and branched-chain amino acids content.

Higher dietary intakes of flavonoids may have a beneficial role in cardiovascular disease prevention. Additionally, supplementation of branched-chain amino acids (BCAAs) in vegan diets can reduce risks associated to their deficiency, particularly in older adults, which can cause loss of skeletal muscle strength and mass. Most plant-derived foods contain only small amounts of BCAAs, and those plants with high levels of flavonoids are not eaten broadly. Here we describe the generation of metabolically engineered cisgenic tomatoes enriched in both flavonoids and BCAAs. In this approach, coding and regulatory DNA elements, all derived from the tomato genome, were combined to obtain a herbicide-resistant version of an acetolactate synthase (mSlALS) gene expressed broadly and a MYB12-like transcription factor (SlMYB12) expressed in a fruit-specific manner. The mSlALS played a dual role, as a selectable marker as well as being key enzyme in BCAA enrichment. The resulting cisgenic tomatoes were highly enriched in Leucine (21-fold compared to wild-type levels), Valine (ninefold) and Isoleucine (threefold) and concomitantly biofortified in several antioxidant flavonoids including kaempferol (64-fold) and quercetin (45-fold). Comprehensive metabolomic and transcriptomic analysis of the biofortified cisgenic tomatoes revealed marked differences to wild type and could serve to evaluate the safety of these biofortified fruits for human consumption.

Helichrysum stoechas (L.) Moench Inflorescence Extract for Tomato Disease Management.

Helichrysum stoechas is a singular halophyte that has been shown to have anti-inflammatory, antioxidant, and allelopathic properties. In the work presented herein, we have characterized its inflorescences hydromethanolic extract and assessed its antifungal activity for the pre- and postharvest management of tomato crop diseases. Gas chromatography-mass spectrometry characterization of the extract showed that 4-ethenyl-1,3-benzenediol, 2,3-dihydro-benzofuran, quinic acid, 3,5-dihydroxy-6,7,8-trimethoxy-2-phenyl-4H-1-benzopyran-4-one, 1,6-anhydro-ß-D-glucopyranose, catechol, scopoletin, and maltol were the main constituents. The co-occurrence of pyranones, benzenediols, and quinic acids as phytoconstituents of H. stoechas extract resulted in promising in vitro minimum inhibitory concentrations of 500, 375, 500, 187.5, 187.5, and 375 µg·mL-1 against mycelia of Alternaria alternata, Colletotrichum coccodes, Fusarium oxysporum f. sp. lycopersici, Rhizoctonia solani, Sclerotinia sclerotiorum, and Verticillium dahliae, respectively. Further, to assess the potential of H. stoechas inflorescence extract for postharvest tomato crop protection, ex situ tests were conducted against C. coccodes, obtaining high protection at a dose of 750 µg·mL-1. Taking into consideration that the demonstrated activity is among the highest reported to date for plant extracts and comparable to that of the synthetic fungicides tested as positive controls, H. stoechas inflorescence extract may be put forward as a promising biorational and may deserve further testing in field-scale studies.