Revealing Medicinal Constituents of Bistorta vivipara Based on Non-Targeted Metabolomics and 16S rDNA Gene Sequencing Technology.

Bistorta vivipara is a medicinal plant with a long history, but there are few studies on the effects of its medicinal components and endophytic bacteria on the accumulation of secondary metabolites. Therefore, in this study, non-targeted metabolomics techniques and 16s rDNA techniques were used to study B. vivipara from different regions. A total of 1290 metabolites and 437 differential metabolites were identified from all samples. Among them, flavonoids, isoflavonoids, and benzopyrans are the main medicinal components of B. vivipara; these have potential anticancer, antiviral, and antioxidant properties, as well as potential applications for the treatment of atrial fibrillation. In addition, irigenin, an important medicinal component, was identified for the first time. The endophytic bacterial communities in the root tissues of B. vivipara from different regions were also different in composition and richness. Hierarchical clustering heat map analysis showed that Proteobacteria and Actinobacteriota bacteria significantly affected the accumulation of many medicinal components in the roots of B. vivipara.

18s rDNA characterization and morphological investigation of the medicinal leech Hirudo medicinalis from Felaw Pond.

Hirudinea leeches are obligate parasites on a variety of vertebrates and have recently gained attention for their medicinal purposes. The present study aimed to improve the presence of Hirudo medicinalis in Kurdistan and Iraq (especially because it is regarded as a native species in this region). A total of 23 leech specimens were collected from Felaw Pond during January-July 2023. The collected specimens were investigated morphologically and their species were confirmed according to their partial sequence of 18s rDNA. Primers used were universal, C1 (ACCCGCTGAATTTAAGCAT) (forward primer), and C3 (CTCTTCAGAGTACTTTTCAAC) (reverse primer). The results of the morphological study and molecular sequencing of partial 18s rDNA demonstrated that all these leech specimens belonged to Hirudo medicinalis with an abundance of 0.13 leech/ m2. The present record was the first one investigating this species in Iraq.

Acidic growth conditions stabilize the ribosomal RNA gene cluster and extend lifespan through noncoding transcription repression.

Blackcurrant (Ribes nigrum L.) is a classical fruit that has long been used to make juice, jam, and liqueur. Blackcurrant extract is known to relieve cells from DNA damage caused by hydrogen peroxide (H2 O2 ), methyl methane sulfonate (MMS), and ultraviolet (UV) radiation. We found that blackcurrant extract (BCE) stabilizes the ribosomal RNA gene cluster (rDNA), one of the most unstable regions in the genome, through repression of noncoding transcription in the intergenic spacer (IGS) which extended the lifespan in budding yeast. Reduced formation of extrachromosomal circles (ERCs) after exposure to fractionated BCE suggested that acidity of the growth medium impacted rDNA stability. Indeed, alteration of the acidity of the growth medium to pH ~4.5 by adding HCl increased rDNA stability and extended the lifespan. We identified RPD3 as the gene responsible for this change, which was mediated by the RPD3L histone deacetylase complex. In mammals, as inflammation sites in a tissue are acidic, DNA maintenance may be similarly regulated to prevent genome instability from causing cancer.

Developing population identification tool based on polymorphism of rDNA for traditional Chinese medicine: Artemisia annua L.

BACKGROUND: Artemisia annua, a well-known traditional Chinese medicine, is the main source for production of artemisinin, an anti-malaria drug. A. annua is distributed globally, with great diversity of morphological characteristics and artemisinin contents. Diverse traits among A. annua populations impeded the stable production of artemisinin, which needs an efficient tool to identify strains and assess population genetic homogeneity. PURPOSE: In this study, ribosomal DNA (rDNA), were characterized for A. annua for strains identification and population genetic homogeneity assessment. METHODS: The ribosomal RNA (rRNA) genes were identified using cmscan and assembled using rDNA unit of LQ-9 as a reference. rDNA among Asteraceae species were compared performing with 45S rDNA. The rDNA copy number was calculated based on sequencing depth. The polymorphisms of rDNA sequences were identified with bam-readcount, and confirmed by Sanger sequencing and restriction enzyme experiment. The ITS2 amplicon sequencing was used to verify the stability of ITS2 haplotype analysis. RESULTS: Different from other Asteraceae species, 45S and 5S linked-type rDNA was only found in Artemisia genus. Rich polymorphisms of copy number and sequence of rDNA were identified in A. annua population. The haplotype composition of internal transcribed spacer 2 (ITS2) region which had moderate sequence polymorphism and relative short size was significantly different among A. annua strains. A population discrimination method was developed based on ITS2 haplotype analysis with high-throughput sequencing. CONCLUSION: This study provides comprehensive characteristics of rDNA and suggests that ITS2 haplotype analysis is ideal tool for A. annua strain identification and population genetic homogeneity assessment.

Comprehensive evaluation of the mechanism of Gastrodia elata Blume in ameliorating cerebral ischemia-reperfusion injury based on integrating fecal metabonomics and 16S rDNA sequencing.

Gastrodia elata Blume was used to treat stroke and headaches caused by "Feng" for thousands of years. The present study has shown a significant effect of G. elata Blume in improving cerebral ischemia-reperfusion injury (CIRI). However, the mechanism of G. elata Blume in improving CIRI by regulating the intestinal flora has not been reported until now. This research aimed to comprehensively evaluate the mechanism of G. elata Blume in CIRI based on fecal metabolomics and 16S rDNA sequencing. The rat model with CIRI was created based on the Zea Longa method. Enzyme-linked immunosorbent assay (ELISA) was used to monitor the inflammatory factors in rat serum. Damages of brain tissues were observed using hematoxylin and eosin (H&E) staining. Cerebral infarction was observed by 2,3,5-triphenyltetrazolium chloride (TTC) staining. The balance of intestinal flora in cecal contents of rats was evaluated by high-throughput sequencing. Changes of metabolites in the intestinal flora were evaluated by fecal metabolomics through Ultra high performance liquid chromatography-orbitrap exploris-mass spectrometer (UHPLC-OE-MS). The area of brain necrosis, cerebral infarction volume, and the contents of inflammatory factors in CIRI rats can be effectively reduced after oral administration of G. elata Blume. CIRI can cause disturbances in the intestinal flora and its associated metabolites. G. elata Blume can significantly regulate the composition of the intestinal microflora. It reversed CIRI-induced changes in the levels of multiple intestinal bacteria, including Prevotellaceae, Coriobacteriaceae; Prevotella, Gamma proteobacteria unclassified, Barnesiella, Escherichia, Shigella; uncultured Shigella sp., Flavonifractor sp., Escherichia sp. enrichment culture clone NBAR004, Veillonella sp. R-32, and Lactobacillus intestinalis. The levels of metabolites in cecal contents were disturbed in rats with CIRI, including amino acid, purine, and sphingolipid metabolism. The changes in the level of biomarkers in amino acid metabolism induced by CIRI were significantly reversed after treatment with G. elata Blume. Correlation studies show that Prevotellaceae was significantly positively correlated with interleukin (IL)-6, and L. intestinalis and L-phenylalanine were negatively interrelated to IL-1ß. Beta-glycerophosphoric acid was significantly negatively interrelated to high-sensitivity C-reactive protein (hs-CRP). There were significantly negative correlations between L-phenylalanine and L. intestinalis, beta-glycerophosphoric acid and Prevotellaceae. G. elata Blume protected against CIRI, which may be related to improved intestinal microflora composition and metabolism, resulting in decreased inflammation.

Antagonist activities and phylogenetic relationships of actinomycetes isolated from an Artemisia habitat.

Diverse habitats have been screened for novel antimicrobial actinomycetes, while others remain unexplored. In this study, we analyzed the bioactivities of actinomycetes cultured from rhizosphere soils of the desert plant Artemisia tridentata and the nearby bulk soils. Actinomycetes were screened for antifungal and antibacterial activities toward a panel of plant pathogens; all comparisons were between activities of rhizosphere soil isolates toward those of its counterpart bulk soil. A selected group of the strongest antifungal isolates were also tested against two antifungal-drug resistant strains of Candida albicans. 16S rDNA partial sequences and phylogenetic analysis of isolates that showed broad-spectrum antifungal activities were performed. Forty-two out of 200 and two soil isolated actinomycetes were selected for their strong antifungal activities. The highest proportion of isolates (p<0.05) from rhizosphere soil of an old plant showed antagonism against gram-positive bacteria (0.483 and 0.224 proportions against Bacillus subtilis and Rathayibacter tritici, respectively), and phytopathogenic fungi (0.259, 0.431, and 0.345 proportions against Fusarium oxysporum, Rhizoctonia solani and Pythium ultimum, respectively), while the highest antagonism against the gram-negative bacteria predominated in isolates from the bulk soils. Isolates from a rhizosphere soil of a young plant were characterized for strong antagonist activities against Fusarium oxysporum (0.333 proportion, p<0.05). Phylogenetic analysis of 16S rDNA sequences showed that isolates that exhibited strong antifungal activity were genetically similar. We conclude that the rhizosphere soil of A. tridentata is an excellent source for discovery of actinomycetes with potentially novel antifungal compounds.

16S rDNA analysis of osteoporotic rats treated with osteoking.

Introduction. Osteoporosis (OP) is characterized by microstructural degeneration of bone tissue, low bone mass, bone fragility and even brittle fracture (osteoporotic fracture, OPF). OP and OPF are common and there are many disadvantages to the current medications for OP/OPF. Osteoking is a traditional Chinese medicine (TCM) originating from the Yi nationality (Yunnan, China) that has been used to treat bone diseases for decades.Hypothesis/Gap Statement. This study will reveal the changes in the intestinal microbiota of OP rats after 70 days of osteoking treatment.Method. With duplication of sham and OP rats, eight groups were established, with six rats in each group. The intestinal microbiotas were analysed by 16S rDNA sequencing.Results. The results showed that osteoking changed the intestinal microbiota of sham rats and OP rats. The mechanism by which osteoking improves OP is related to the functions of the intestinal microbiota. After 70 days of treatment with osteoking, the contents of Pseudonocardia, Pedomicrobium, Variovorax, Niastella and Actinosynnema were decreased in OP rats. The functions of the above intestinal microbiota related to iron metabolism affected calcifediol and 25(OH)D, and measuring these bone metabolic indicators is required for further study.Conclusion. Osteoking changes the intestinal microbiota to improve OP, and further study which reveals these intestinal microbiota and mechanism is needed.

Roux-En-Y Gastric Bypass (RYGB) Surgery during High Liquid Sucrose Diet Leads to Gut Microbiota-Related Systematic Alterations.

Roux-en-Y gastric bypass (RYGB) surgery has been proven successful in weight loss and improvement of co-morbidities associated with obesity. Chronic complications such as malabsorption of micronutrients in up to 50% of patients underline the need for additional therapeutic approaches. We investigated systemic RYGB surgery effects in a liquid sucrose diet-induced rat obesity model. After consuming a diet supplemented with high liquid sucrose for eight weeks, rats underwent RYGB or control sham surgery. RYGB, sham pair-fed, and sham ad libitum-fed groups further continued on the diet after recovery. Notable alterations were revealed in microbiota composition, inflammatory markers, feces, liver, and plasma metabolites, as well as in brain neuronal activity post-surgery. Higher fecal 4-aminobutyrate (GABA) correlated with higher Bacteroidota and Enterococcus abundances in RYGB animals, pointing towards the altered enteric nervous system (ENS) and gut signaling. Favorable C-reactive protein (CRP), serine, glycine, and 3-hydroxybutyrate plasma profiles in RYGB rats were suggestive of reverted obesity risk. The impact of liquid sucrose diet and caloric restriction mainly manifested in fatty acid changes in the liver. Our multi-modal approach reveals complex systemic changes after RYGB surgery and points towards potential therapeutic targets in the gut-brain system to mimic the surgery mode of action.

Lipid accumulation by Coelastrella multistriata (Scenedesmaceae, Sphaeropleales) during nitrogen and phosphorus starvation.

A novel freshwater strain of Coelastrella multistriata MZ-Ch23 was discovered in Tula region, Russia. The identification is based on morphological features, phylogenetic analysis of SSU rDNA gene and ITS1-5.8S rDNA-ITS2 region and predicted secondary structure of the ITS2. Phylogenetic analysis places the novel strain in the "core" Coelastrella clade within the Chlorophyceae. This is the first record of Coelastrella multistriata in the algal flora of Russia. Cultivation experiments were carried out to evaluate growth dynamics of the newly identified strain and the impact of nitrogen and/or phosphorus depletion on the fatty acid profiles and lipid productivity. On the fully supplemented Bold's basal medium and under phosphorus-depleted conditions as well, the fatty acid profiles were dominated by α-linolenic acid (29.4-38.1% of total fatty acids). Depletion of either nitrogen or both nitrogen and phosphorus was associated with increased content of oleic acid (32.9-33.7%) and linoleic acid (11.9%). Prolongation of the growth to two months (instead of 25 days) resulted in increased content and diversity of very long-chain fatty acids including saturated species. The total very long-chain fatty acid content of 9.99% achieved in these experiments was 1.9-12.3-fold higher than in stress experiments. The highest variation was observed for oleic acid (3.4-33.7%). The novel strain showed the ability to accumulate lipids in amounts up to 639.8 mg L-1 under nitrogen and phosphorus starvation, which exceeds the previously obtained values for most Coelastrella strains. Thus, the newly identified MZ-Ch23 strain can be considered as a potential producer of omega-3 fatty acids on fully supplemented Bold's basal medium or as a source of biomass with high content of saturated and monounsaturated fatty acids after nitrogen and phosphorus starvation.

Psychrotolerant Mesorhizobium sp. Isolated from Temperate and Cold Desert Regions Solubilizes Potassium and Produces Multiple Plant Growth Promoting Metabolites.

Soil potassium (K) supplement depends intensively on the application of chemical fertilizers, which have substantial harmful environmental effects. However, some bacteria can act as inoculants by converting unavailable and insoluble K forms into plant-accessible forms. Such bacteria are an eco-friendly approach for enhancing plant K absorption and consequently reducing utilization of chemical fertilization. Therefore, the present research was undertaken to isolate, screen, and characterize the K solubilizing bacteria (KSB) from the rhizosphere soils of northern India. Overall, 110 strains were isolated, but only 13 isolates showed significant K solubilizing ability by forming a halo zone on solid media. They were further screened for K solubilizing activity at 0 °C, 1 °C, 3 °C, 5 °C, 7 °C, 15 °C, and 20 °C for 5, 10, and 20 days. All the bacterial isolates showed mineral K solubilization activity at these different temperatures. However, the content of K solubilization increased with the upsurge in temperature and period of incubation. The isolate KSB (Grz) showed the highest K solubilization index of 462.28% after 48 h of incubation at 20 °C. The maximum of 23.38 µg K/mL broth was solubilized by the isolate KSB (Grz) at 20 °C after 20 days of incubation. Based on morphological, biochemical, and molecular characterization (through the 16S rDNA approach), the isolate KSB (Grz) was identified as Mesorhizobium sp. The majority of the strains produced HCN and ammonia. The maximum indole acetic acid (IAA) (31.54 µM/mL) and cellulase (390 µM/mL) were produced by the isolate KSB (Grz). In contrast, the highest protease (525.12 µM/mL) and chitinase (5.20 µM/mL) activities were shown by standard strain Bacillus mucilaginosus and KSB (Gmr) isolate, respectively.

Smectite as a Preventive Oral Treatment to Reduce Clinical Symptoms of DSS Induced Colitis in Balb/c Mice.

Natural smectites have demonstrated efficacy in the treatment of diarrhea. The present study evaluated the prophylactic effect of a diosmectite (FI5pp) on the clinical course, colon damage, expression of tight junction (TJ) proteins and the composition of the gut microbiota in dextran sulfate sodium (DSS) colitis. Diosmectite was administered daily to Balb/c mice from day 1 to 7 by oral gavage, followed by induction of acute DSS-colitis from day 8 to 14 ("Control", n = 6; "DSS", n = 10; "FI5pp + DSS", n = 11). Mice were sacrificed on day 21. Clinical symptoms (body weight, stool consistency and occult blood) were checked daily after colitis induction. Colon tissue was collected for histological damage scoring and quantification of tight junction protein expression. Stool samples were collected for microbiome analysis. Our study revealed prophylactic diosmectite treatment attenuated the severity of DSS colitis, which was apparent by significantly reduced weight loss (p = 0.022 vs. DSS), disease activity index (p = 0.0025 vs. DSS) and histological damage score (p = 0.023 vs. DSS). No significant effects were obtained for the expression of TJ proteins (claudin-2 and claudin-3) after diosmectite treatment. Characterization of the microbial composition by 16S amplicon NGS showed that diosmectite treatment modified the DSS-associated dysbiosis. Thus, diosmectites are promising candidates for therapeutic approaches to target intestinal inflammation and to identify possible underlying mechanisms of diosmectites in further studies.

Gaeumannomyces nanograminis, sp. nov., a hyphopodiate fungus identified from diseased roots of ultradwarf bermudagrass in the United States.

The genus Gaeumannomyces (Magnaporthaceae, Magnaporthales, Sordariomycetes, Ascomycota) includes root-infecting pathogens, saprobes, and endophytes. Morphological, biological, and phylogenetic analyses were employed to identify fungal isolates derived from turfgrass roots colonized with ectotrophic, dark runner hyphae. Phylogenetic trees for partial sequences of the 18S nuc rDNA, ITS1-5.8S-ITS2 nuc rDNA internal transcribed spacer, and 28S nuc rDNA regions and of the minichromosome maintenance complex 7 (MCM7), largest subunit of RNA polymerase II (RPB1), and translation elongation factor 1-alpha (TEF1) genes were obtained via maximum likelihood and Bayesian methods. Our isolates consistently formed a distinct and highly supported clade within Gaeumannomyces. Common and distinctive biological and morphological characters reinforced these findings. Additionally, we conducted pathogenicity evaluations and demonstrated the ability of this fungus to colonize roots of ultradwarf bermudagrass (Cynodon dactylon (L.) Pers. × C. transvaalensis Burtt-Davey), its native host, via ectotrophic, dark runner hyphae, causing disease symptoms including root discoloration and reduced root and shoot mass. Altogether, our discoveries enabled recognition and description of a new species, Gaeumannomyces nanograminis, associated with rotted roots of ultradwarf bermudagrass.

Niche specificity and functional diversity of the bacterial communities associated with Ginkgo biloba and Panax quinquefolius.

Plant-associated bacteria can establish mutualistic relationships with plants to support plant health. Plant tissues represent heterogeneous niches with distinct characteristics and may thus host distinct microbial populations. The objectives of this study are to investigate the bacterial communities associated with two medicinally and commercially important plant species; Ginkgo biloba and Panax quinquefolius using high Throughput Sequencing (HTS) of 16S rRNA gene, and to evaluate the extent of heterogeneity in bacterial communities associated with different plant niches. Alpha diversity showed that number of operational taxonomic units (OTUs) varied significantly by tissue type. Beta diversity revealed that the composition of bacterial communities varied between tissue types. In Ginkgo biloba and Panax quinquefolius, 13% and 49% of OTUs, respectively, were ubiquitous in leaf, stem and root. Proteobacteria, Bacteroidetes, Actinobacteria and Acidobacteria were the most abundant phyla in Ginkgo biloba while Proteobacteria, Bacteroidetes, Actinobacteria, Plantomycetes and Acidobacteria were the most abundant phyla in Panax quinquefolius. Functional prediction of these bacterial communities using MicrobiomeAnalyst revealed 5843 and 6251 KEGG orthologs in Ginkgo biloba and Panax quinquefolius, respectively. A number of these KEGG pathways were predicted at significantly different levels between tissues. These findings demonstrate the heterogeneity, niche specificity and functional diversity of plant-associated bacteria.

Differential microbial assemblages associated with shikonin-producing Borage species in two distinct soil types.

Shikonin and its derivatives are the main components of traditional Chinese medicine, Zicao. The pharmacological potential of shikonin and its derivatives have been extensively studied. Yet, less is known about the microbial assemblages associated with shikonin producing Borage plants. We studied microbial profiles of two Borage species, Echium plantagineum (EP) and Lithospermum erythrorhizon (LE), to identify the dynamics of microbial colonization pattern within three rhizo-compatments and two distinct soil types. Results of α and ß-diversity via PacBio sequencing revealed significantly higher microbial richness and diversity in the natural soil along with a decreasing microbial gradient across rhizosphere to endosphere. Our results displayed genotype and soil type-dependent fine-tuning of microbial profiles. The host plant was found to exert effects on the physical and chemical properties of soil, resulting in reproducibly different micro-biota. Analysis of differentially abundant microbial OTUs displayed Planctomycetes and Bacteroidetes to be specifically enriched in EP and LE rhizosphere while endosphere was mostly prevailed by Cyanobacteria. Network analysis to unfold co-existing microbial species displayed different types of positive and negative interactions within different communities. The data provided here will help to identify microbes associated with different rhizo-compartments of potential host plants. In the future, this might be helpful for manipulating the keystone microbes for ecosystem functioning.

Combined LC-MS/MS and 16S rDNA analysis on mice under high temperature and humidity and Herb Yinchen protection mechanism.

With increased global warming, the impact of high temperature and humidity (HTH) on human health is increasing. Traditional Chinese medicine describes the Herb Yinchen as a remedy for reducing heat and eliminating dampness. This study focused on the impact of HTH conditions on mice and the potential protective effect of Herb Yinchen. Five male Balb/c mouse groups included two normal control groups, two HTH-exposed groups, and one Yinchen-treated group. For either three or ten days, normal and HTH-exposed mice were housed under normal or HTH (33 ± 2 °C,85% relative humidity) conditions, respectively. Yinchen-treated mice, housed under HTH conditions, received the Herb Yinchen decoction for three days. Metabolite profiles of plasma and liver samples from each group were analyzed using LC-MS/MS. Fecal DNA was extracted for 16S rDNA analysis to evaluate the intestinal microbiome. Spearman correlation analysis was performed on metabolites, bacteria, and bile acids that differed between the groups. We found that HTH altered the host metabolite profiles and reduced microbial diversity, causing intestinal microbiome imbalance. Interestingly, Herb Yinchen treatment improved HTH-mediated changes of the metabolite profiles and the intestinal microbiome, restoring them to values observed in normal controls. In conclusion, our study reveals that HTH causes intestinal bacterial disturbances and metabolic disorders in normal mice, while Herb Yinchen could afford protection against such changes.

Diversity and Spatiotemporal Distribution of Fungal Endophytes Associated with Salvia multicaulis.

Salvia multicaulis has been an important medicinal plant in Iran and several East Asian countries for hundreds of years. Because of growing demand, overharvesting of wild S. multicaulis has endangered its wild populations. Endophytes are well known for protecting wild plant populations against biotic and abiotic stresses, especially under harsh situations, as well as for their plant growth enhancement activities. Since no information was on endophyte biology in S. multicaulis, here we aimed at analyzing diversity and spatiotemporal distribution of fungal endophytes associating S. multicaulis in their main wild habitats in Iran, i.e., Qazvin, Alborz and Mazandaran provinces. A total of 153 fungal endophytes were isolated and identified according to their morphology and ribosomal ITS rDNA sequences. As results indicated Ascomycota dominated in colonizing S. multicaulis with a relative frequency (RF) of 96.77%, comprising of Eurotiomycetes (RF: 40.5%), Sordariomycetes (RF: 33.9%) and Dothideomycetes (RF: 20.5%). Mucoromycota, comprised the rest of endophytes (RF: 5.23%). The entire fungal microbiome was classified into nine genera including Fusarium (25.5%), Penicillium (21.5%), Aspergillus (17.0%), Alternaria (15.5%), Colletotrichum (5.2%), Rhizopus (5.2%), Macrophomina (4.5%), Trichoderma (3.25%) and Nodulisporium (2.0%). Analyses of different diversity indices indicated significant correlations with tissue type, sampling locations and season of recovery. Almost 43% of fungal endophytes were recovered at Mazandaran, Kojur; 35.4% at Qazvin, Barajin Forest Park; 30.1% at Alborz, Taleqan; and 21% at Alborz, Mahdasht. The highest overall endophyte recovery was in summer (36.8%), followed by spring (31.6%), autumn (21%), and winter (10.5%). In total, the number of endophytes recovered from roots (91) was higher than those of stems (32) and leaves (30), especially during autumn and winter. Accordingly, we conclude that Ascomycota are the major endophytic fungi colonizing S. multicaulis, and that sampling location, tissue type and season can affect the fungal endophyte composition of this medicinal plant. This knowledge could be further applied in protection and health management of this endangered species.

Piperazic acid containing peptides produced by an endophytic Streptomyces sp. isolated from the medicinal plant Atropa belladonna.

The culture broth of endophytic Streptomyces sp. AB100, isolated from the shoots of medicinal plant Atropa belladonna (L.) was investigated for the presence of antibacterial compounds. After initial testing followed by bioactivity-guided fractionation, six new piperazic acid (PA)-containing congeners of two known peptides, JBIR-39 and JBIR-40, were identified by HR-MS/MS and NMR analyses. Only the dehydroxylated hexapeptidic derivatives with unusual incorporation of four PA moieties exhibited weak antibacterial activity against Gram-positive test organism Bacillus subtilis. A 16S rDNA-based phylogenetic tree of known Streptomyces spp. producing PA-containing hexapeptides isolated from different habitats and endophyte Streptomyces AB100 showed considerable diversity, suggesting that these metabolites may play an important environmental role beyond their antibacterial activity.

Identification and characterization of Vietnamese coffee bacterial endophytes displaying in vitro antifungal and nematicidal activities.

The endophytic bacteria were isolated from coffee roots and seeds in Vietnam and identified with 16S rDNA sequencing as belonging to the Actinobacteria, Firmicutes and Proteobacteria phyla with the Nocardia, Bacillus and Burkholderia as dominant genera, respectively. Out of the thirty genera recovered from Coffea canephora and Coffea liberica, twelve were reported for the first time in endophytic association with coffee including members of the genera Brachybacterium, Caballeronia, Kitasatospora, Lechevalieria, Leifsonia, Luteibacter, Lysinibacillus, Mycolicibacterium, Nakamurella, Paracoccus, Sinomonas and Sphingobium. A total of eighty bacterial endophytes were characterized in vitro for several plant growth promoting and biocontrol traits including: the phosphate solubilization, the indolic compounds, siderophores, HCN, esterase, lipase, gelatinase and chitinase production. A subset of fifty selected bacteria were tested for their potential as biocontrol agents with in vitro confrontations with the fungal pathogen Fusarium oxysporum as well as the coffee parasitic nematodes Radopholus duriophilus and Pratylenchus coffeae. The three most efficient isolates on F. oxysporum belonging to the Bacillus, Burkholderia, and Streptomyces genera displayed a growth inhibition rate higher than 40%. Finally, five isolates from the Bacillus genus were able to lead to 100% of mortality in 24 h on both R. duriophilus and P. coffeae.

The effect of toxic pyridine-alkaloid secondary metabolites on the sunbird gut microbiome.

Sunbirds feed on tobacco tree nectar which contains toxic nicotine and anabasine secondary metabolites. Our aim was to understand the effect of nicotine and anabasine on the gut microbiota composition of sunbirds. Sixteen captive sunbirds were randomly assigned to two diets: artificial nectar either with (treatment) or without (control) added nicotine and anabasine. Excreta were collected at 0, 2, 4 and 7 weeks of treatment and samples were processed for bacterial culture and high-throughput amplicon sequencing of the 16S rRNA gene. The gut microbiome diversity of the treated and control birds changed differently along the seven-week experiment. While the diversity decreased in the control group along the first three samplings (0, 2 and 4 weeks), it increased in the treatment group. The microbiota composition analyses demonstrated that a diet with nicotine and anabasine, significantly changed the birds' gut microbiota composition compared to the control birds. The abundance of nicotine- and anabasine- degrading bacteria in the excreta of the treated birds, was significantly higher after four and seven weeks compared to the control group. Furthermore, analysis of culturable isolates, including Lactococcus, showed that sunbirds' gut-associated bacteria were capable of degrading nicotine and anabasine, consistent with their hypothesised role as detoxifying and nutritional symbionts.

Development of nitrate stimulated hydrocarbon degrading microbial consortia from refinery sludge as potent bioaugmenting agent for enhanced bioremediation of petroleum contaminated waste.

Stable and efficient hydrocarbon degrading microbial consortia were developed from a refinery sludge through nitrate amendment for their application in enhanced bioremediation of petroleum contaminated waste. Nitrate induced biostimulation of refinery sludge resulted in increased abundance of hydrocarbon degrading Rhodocyclaceae, Xanthomonadaceae, Syntrophaceae and Comamonadaceae members. Repeated subculturing of nitrate stimulated communities in crude oil supplemented basal medium was done under aerobic and anaerobic conditions. Aerobically enriched consortia (composed of Pseudomonadaceae, Pseudoxanthomonadaceae and unclassified Comamonadaceae) showed their ability to utilize alkanes, aromatics and crude oil as growth substrates. Anaerobically enriched consortium was predominated by Bacillaceae, Pseudomonadaceae, Xanthomonadaceae, Porphyromonadaceae and Comamonadaceae members. Anaerobic consortium was found to be relatively less efficient in terms of TPH (total petroleum hydrocarbons) degradation compared to its aerobic counterpart. These enriched microbial consortia were finally tested for their biodegradation performance and stability during bioremediation of highly contaminated refinery sludge using different strategies. A 30 days microcosm based bioremediation trial showed that bioaugmentation of aerobic cultures with refinery sludge was more effective in TPH degradation (~ 65% degradation) compared to the anaerobic consortium (only 36% TPH degradation) and a combination of bioaugmentation and nitrate amendment with sludge resulted in enhanced hydrocarbon attenuation (up to 86% TPH degradation). Subsequent community analysis at the end of bioremediation trial confirmed the stability of the added microbial populations. Thus, the strategy of bioaugmentation of specially enriched native microbial populations in combination with nitrate amendment was successfully used for the enhanced bioremediation of petroleum hydrocarbon contaminated refinery waste.