First report of the root-knot nematode Meloidogyne incognita on Salvia miltiorrhiza Bunge in Henan Province, China.

Salvia miltiorrhiza Bunge is an important Chinese herbal medicine, mainly used to treat cardiovascular disease. At present, the planting area of S. miltiorrhiza is near 20,000 hectares in China, mainly in Shandong, Henan, Shanxi, Shaanxi and Sichuan provinces. Root-knot nematode (Meloidogyne spp.) is one of the most devastating pathogens on S. miltiorrhiza. In November 2020, we observed that some S. miltiorrhiza plants grew poorly with smaller, fewer and chlorotic leaves and even necrosis on some middle and lower ones in a Chinese herbal medicine planting base (34° 4' 11.52'' N; 113° 25' 51.40'' E) in Yuzhou City, Henan Province, China. Furthermore, the galls and egg masses were visible on the roots of S. miltiorrhiza, which were the typical symptoms caused by root-knot nematodes. Ten samples of galled roots and rhizosphere soils were collected, bagged and taken to the lab for tests. Females and J2s were extracted from these samples. White, pear-shaped females were observed in the roots, and the average number of second-stage juveniles (J2s) was 121.5 ± 10.8 per 100 ml of soil. The perineal patterns of females showed a high dorsal arch, which was either square or trapezoid with either smooth or wavy striae and without obvious lateral lines. The main morphometrics of females (n=20, mean ± SE; range) were as follows: body length (L)  = 609.0  ±â€¯ 62.5 µm (492.4 to 716.4 µm); maximum body width (W) = 377.0  ±â€¯ 28.6 µm (329.7 to 436.1 µm); stylet length  =  17.0  ±â€¯ 1.8 µm (14.2 to 20.5 µm); and distance from dorsal esophageal gland orifice to stylet knobs (DGO) =  3.3  ±â€¯ 0.3 µm (2.8 to 3.9 µm). The J2s were in vermiform, and stylet knobs were prominent and rounded. The tail of J2s possessed a transparent area with an obtuse tip. J2s (n  =  20) were measured (mean ± SD; range) as follows: L  =  401.2  ±â€¯ 29.3 µm (358.2 to 456.1 µm); W = 14.1 ± 1.1 µm (12.5 to 16.0 µm); L/W  = 28.6  ±â€¯ 1.0 (26.7 to 30.4); stylet length =  10.3  ±â€¯ 0.6 µm (9.1 to 11.2 µm); DGO  =  2.4  ±â€¯ 0.1 µm (2.1 to 2.6 µm); and tail length  =  49.3  ± 2.8 µm (45.2 to 54.7 µm). All the key morphometrics were similar to those of the M. incognita population described by Song et al. (2019). The PCR amplifications of rDNA-internal transcribed spacer (ITS) fragments generated an amplicon of 544 bp from a single female or/and J2s (n = 22) using the universal primers M18S (5'-AACCTGCTGCTGGATCATTAC-3') and M28S (5'-GTATGCTTAAGTTCAGCG-3') (Feng et al. 2010). The PCR amplifications were repeated five times for each sample, and the products were purified and sequenced. The obtained sequnce was deposited in GenBank with Acc. No. OM304617.1. The amplified ITS region sequence was identical to those of M. incognita from India (KT869139.1) and China (MT490926.1 and MT071559.1). For confirmation, the primers species-specific for M. incognita (Inc-K14-F, 5'- GGGATGTGTAAATGCTCCTG -3' and Inc-K14-R, 5'- CCCGCTACACCCTCAACTTC -3') were further used for amplification. Expected PCR amplicon of 399 bp was acquired, which was consistent with previous report for M. incognita (Randig et al. 2002). Pathogenicity and reproduction of this M. incognita population on S. miltiorrhiza was confirmed and examined. Seeds of S. miltiorrhiza were sown in the pots filled with 200 ml of autoclaved soil mixture (loamy soil/sand, 1:1). Two weeks later, a total of 12 plants were inoculated each with 400 J2s, which were hatched from a field-derived M. incognita population. Four plants without nematode inoculation were used as the control. The plants grew in a chamber at 25/30 °C under 12-h dark/12-h light conditions. The parasitic J2s, J3s, J4s and females in roots were observed under a stereomicroscope at 5, 15 and 30 days post inoculation (dpi). At 35 dpi, an average of 98.3 ± 15.7 galls and 23.8 ± 6.9 egg masses per S. miltiorrhiza plant were counted, and the root gall index reached 6 according to the 0-10 RKN rating scale (Poudyal et al. 2005). Nematodes were re-isolated from the roots and their morphological and molecular characteristics were identical to the nematodes obtained from the original samples. Furthermore, all the inoculated S. miltiorrhiza roots showed typical RKN galls with the same symptoms as those initially observed in the field. No symptoms were developed on the non-inoculated control plants, and from which no nematodes were isolated. The nematode on S. miltiorrhiza was therefore certified as M. incognita. Han et al. (2019) isolated and morphologically identified M. incognita from the roots of S. miltiorrhiza and Trichosanthes kirilowii Maximin in Changqing area of Shandong Province, China, but did not perform the Koch's Rule. To our knowledge, this is the first formal report of M. incognita infecting S. miltiorrhiza in Henan Province, China. With the increase of Chinese herbal medicine planting area, plant parasitic nematodes are becoming more and more serious and have become an limiting factor on medicinal plant production, and the yield losses can be as high as 70%. This finding provides important and solid information for growers of Chinese medicinal plants, based on which suitable management action should be taken.

Effect of Sinisan on NLRP3 Inflammasomes and Depression-like Behaviors in Depressed Rats / 中国实验方剂学杂志

ObjectiveTo observe the effects of Sinisan on behaviors and NOD-like receptor protein 3 （NLRP3） inflammasomes of depressed rats induced by chronic unpredictable mild stress （CUMS） and further explore the anti-depressant mechanism of Sinisan. MethodFifty male rats were randomly divided into a normal group， a model group， an NLRP3 inhibitor （MCC950） group （10 mg·kg-1）， and low- （2.5 g·kg-1） and high-dose （5 g·kg-1） Sinisan groups， with 10 rats in each group. The depression model was induced by 42 d CUMS in rats except for those in the normal group. Drug intervention was performed on the 22nd day of modeling by gavage in the Sinisan groups and by intraperitoneal injection in the MCC950 group. Except for the MCC950 group， the remaining four groups received 10 mg·kg-1 physiological saline by intraperitoneal injection， while the rats in the model group， the normal group， and the MCC950 group were administered with 3 mL of physiological saline by gavage. Twenty-one days later， the sucrose preference test and open field test were performed. Western blot was used to detect the protein expression of NLRP3， apoptosis-associated speck-like protein containing a CARD （ASC）， cysteinyl aspartate-specific protease-1 （Caspase-1）， B-cell lymphoma-2 （Bcl-2）， Bcl-2 associated X protein （Bax）， ionized calcium-binding adapter molecule 1 （Iba1）， and CD68 in the hippocampus of rats in each group. Enzyme-linked immunosorbent assay （ELISA） was used to detect the levels of interleukin-1β （IL-1β） and interleukin-18 （IL-18） in the hippocampus of rats. Nissl staining and TUNEL were used to assess the pathological changes and apoptosis level in the hippocampal CA1 region of rats， respectively. ResultThe sucrose preference rate and consumption volume in the sucrose preference test， the total distance， the percentage of central movement distance， and the percentage of residence time in the open field test of rats in the model group were lower than those in the normal group （P<0.01）. Compared with the model group， the Sinisan groups and the MCC950 group showed improved depression-like behaviors， apoptosis level in the hippocampal CA1 region， and neuron loss to varying degrees. Sinisan could reduce the levels of IL-1β， IL-18， Bax， Iba1， and CD68 in the hippocampus （P<0.05， P<0.01）， increase the level of Bcl-2 （P<0.05， P<0.01）， and inhibit the protein expression of NLRP3， ASC， and Caspase-1 related to NLRP3 inflammasomes （P<0.05， P<0.01）. ConclusionSinisan can improve the depression-like behaviors and pathological damage of hippocampal neurons in CUMS-induced rats， and the mechanism may be related to the inflammatory response mediated by the NLRP3 inflammasome signaling pathway.

ATP redirects cytokine trafficking and promotes novel membrane TNF signaling via microvesicles.

Cellular stress or injury induces release of endogenous danger signals such as ATP, which plays a central role in activating immune cells. ATP is essential for the release of nonclassically secreted cytokines such as IL-1ß but, paradoxically, has been reported to inhibit the release of classically secreted cytokines such as TNF. Here, we reveal that ATP does switch off soluble TNF (17 kDa) release from LPS-treated macrophages, but rather than inhibiting the entire TNF secretion, ATP packages membrane TNF (26 kDa) within microvesicles (MVs). Secretion of membrane TNF within MVs bypasses the conventional endoplasmic reticulum- and Golgi transport-dependent pathway and is mediated by acid sphingomyelinase. These membrane TNF-carrying MVs are biologically more potent than soluble TNF in vivo, producing significant lung inflammation in mice. Thus, ATP critically alters TNF trafficking and secretion from macrophages, inducing novel unconventional membrane TNF signaling via MVs without direct cell-to-cell contact. These data have crucial implications for this key cytokine, particularly when therapeutically targeting TNF in acute inflammatory diseases.-Soni, S., O'Dea, K. P., Tan, Y. Y., Cho, K., Abe, E., Romano, R., Cui, J., Ma, D., Sarathchandra, P., Wilson, M. R., Takata, M. ATP redirects cytokine trafficking and promotes novel membrane TNF signaling via microvesicles.

Steroidal Saponins from the Rhizomes of Aspidistra typica.

Eleven new furostanol saponins, typaspidosides B-L (1-11), one new spirostanol saponin, typaspidoside M (12), and five known spirostanol saponins, 25S-atropuroside (13), neoaspidistrin (14), (25S)-pratioside D1 (15), 25S-aspidistrin (16) and 25S-neosibiricoside (17) were isolated from the rhizomes of Aspidistra typica Baill. The structures of the new compounds were established using 1D and 2D NMR (1H-1H COSY, HMQC, HMBC and ROESY) spectroscopy, high resolution mass spectrometry, and chemical methods. The aglycones of 1-3 (unusual furostanol saponins with opened E ring type), 9 and 10 (the methoxyl substituent at C-23 position) were found, identified from natural products for the first time. Moreover, the anti-HIV activities of the isolated steroidal glycosides were assessed, and compounds 13, 14, 16 and 17 exhibited high active against HIV-1.

Identification of multidrug resistance gene MDR1 associated microRNA of salvianolic acid A reversal in lung cancer / 中国中药杂志

This paper was aimed to investigate the microRNA associated with multidrug resistance gene MDR1 of salvianolic acid A reversal in lung cance. Human lung cancer A549 cells were divided into normal control group and drug group, and the MDR1 expression levels were determined by real-time quantitative PCR. MicroRNA expression profiling of normal control group and drug group were detected by using the latest microRNA microarray. Quantitative RT-PCR was used to validate the differentially expressed miRNA. Forecast of miRNA associated with MDR1 multi-resistant genes of up-regulated miRNA. Experimental results showed that the dosage of MDR1 expression level significantly lowered compared with control group. The miRNA expression spectrum analyses of human lung cancer A549 cells to drug group and the control group were detected by microRNA microarray, 426 differentially expressed miRNA were screened out. Then target prediction were performed for difference up-expression of miRNA and found that there were four obvious increase of miRNA associated with MDR1 multi-resistant genes. Real-time quantitative PCR for 4 microRNA verification, the results were consistent with the chip. So the author considered that salvianolic acid A down lung cancer multidrug resistance gene MDR1 is likely to be affected by the miRNA expression and regulation of target genes, to further clarify the traditional Chinese medicine to reverse multi-drug resistant mechanism provides the experimental basis.

Correlation of gene expression related to amount of ginseng saponin in 15 tissues and 6 kinds of ginseng saponin biosynthesis / 中国中药杂志

Fifteen tissues of 4-year-old fruit repining stage Jilin ginseng were chosen as materials, six kinds of monomer saponins (ginsenosides Rg1, Re, Rb1, Rc, Rb2 and Rd) content in 15 tissues was measured by HPLC and vanillin-sulfuric acid method. The relative expression of FPS, SQS, SQE, OSC, β-AS and P450 genes in 15 tissues was analyzed by real-time PCR. The correlations between ginseng saponin content in 15 tissues of Jilin ginseng and biosynthetic pathway -related genes were obtained. The results showed that was a synergistic increase and decrease trend of positive linear correlation among six kinds of monomer saponin content, and there was a significantly (P < 0.01) positive correlation between monomer saponin content and total saponins content. Monomer saponin content and 6 kinds of enzyme gene correlation were different. Biosynthesis of ginseng total saponins and monomer saponin were regulated by six kinds of participation ginsenoside biosynthesis enzyme genes, the expression of these six kinds of genes in different tissues of ginseng showed collaborative increase and decrease trend, and regulated biosynthesis of ginseng ginsenoside by group coordinative manner.

Two sets of acupoint combination of similar functions engage shared neural representation: a functional magnetic resonance imaging study / 中国结合医学杂志

<p><b>OBJECTIVE</b>To investigate whether the neural representations underlying alternating two acupoint combinations (ACs) are the same or not.</p><p><b>METHODS</b>In this functional magnetic resonance imaging study, two sets of analgesia ACs were utilized, including Waiguan (TE5) and Qiuxu (GB40) for Group A, and Neiguan (PC6) and Taichong (LR3) for Group B, which are the most commonly adopted in clinical treatment. Each group had 20 healthy subjects. An experimental design was proposed, which consisted of a pre-needling resting phase, a needling phase and a post-needling resting phase. This paradigm optimally mimics the clinical protocol as well as focuses on both the stimulation and the resting periods. The results were subjected to general linear model analysis, conjunction analysis and the functional connectivity analysis.</p><p><b>RESULTS</b>The rostral anterior cingulated cortex was engaged in the initiative period of the acupuncture effect in both groups, and it was chosen as the seed region for the functional connectivity analysis for the following resting period. The results showed that several shared brain regions were involved in both groups, in particular the insula, amygdala and hypothalamus. Moreover, significant differences were located at the posterior cingulated cortex as revealed by a two sample -test (P<0.05, corrected). Other regions showed no significant differences. This finding was further supported by the spatial correlation analysis that the two groups were significantly correlated (r =0.51, P<0.01).</p><p><b>CONCLUSION</b>This preliminary research helps us understand the neurophysiological mechanisms of acupuncture when following clinical guidelines on ACs, as well as provides an important opportunity to develop better treatment strategies for reducing, or even preventing pain.</p>

Two new furostanol saponins from Aspidistra typica.

Two new furostanol saponins (1 and 2), along with one known saponin (3), were obtained from the rhizomes of Aspidistra typica Baill. Their structures were elucidated as (25R)-26-O-ß-d-glucopyranosyl-furost-5-ene-12-one-3ß,22α,26-triol-3-O-ß-d-glucopyranosyl-(1 â†’ 2)-[ß-d-xylopyranosyl-(1 â†’ 3)]-ß-d-glucopyranosyl-(1 â†’ 4)-ß-d-galactopyranoside (1, typaspidoside A), (25S)-26-O-ß-d-glucopyranosyl-furost-5-ene-12-one-3ß,22α,26-triol-3-O-ß-d-glucopyranosyl-(1 â†’ 2)-[ß-d-xylopyranosyl-(1 â†’ 3)]-ß-d-glucopyranosyl-(1 â†’ 4)-ß-d-galactopyranoside (2, 25S-typaspidoside A), and timosaponin H1 (3), based on the integrative spectroscopic analysis of 1D- and 2D-NMR experiments, ESI-MS data and chemical evidence. The investigation on the chemical components of this plant is reported for the first time.

Neuraminidase inhibitory polyketides from the marine-derived fungus Phoma herbarum.

Two new polyketides, arthropsadiol C (1) and massarilactone H (2), together with six known derivatives (3-8) were isolated from the culture broth of the marine-derived fungus Phoma herbarum. Their structures were elucidated on the basis of spectroscopic methods, including 2D NMR techniques. Compounds 2, 4, 5, and 8 showed moderate neuraminidase inhibitory activity with IC(50) values ranging from 4.15 to 9.16 µM.

Bioactive alkaloids from the plant endophytic fungus Aspergillus terreus.

One new alkaloid, named 16 alpha-hydroxy-5 N-acetylardeemin ( 1), along with seven known metabolites ( 2- 8) was isolated from the fermentation broth of an endophytic fungus, ASPERGILLUS TERREUS. The structures of these metabolites were assigned on the basis of detailed spectroscopic analysis and by comparing spectroscopic data with those in the literature. Compound 1 displayed an inhibitory effect against acetylcholinesterase. Compounds 1- 8 also showed moderate or weak cytotoxic activity against KB and HSC-T6 cell lines.