RESUMEN
BACKGROUND: Cancer ranks as the second leading cause of death globally, imposing a significant public health burden. The rise in cancer resistance to current therapeutic agents underscores the potential role of phytotherapy. Black raspberry (BRB, Rubus Occidentalis) is a fruit rich in anthocyanins, ellagic acid, and ellagitannins. Accumulating evidence suggests that BRB exhibits promising anticancer effects, positioning it as a viable candidate for phytotherapy. PURPOSE: This article aims to review the existing research on BRB regarding its role in cancer prevention and treatment. It further analyzes the effective components of BRB, their metabolic pathways, and the potential mechanisms underlying the fruit's anticancer effects. METHODS: Ovid MEDLINE, EMBASE, Web of Science, and CENTRAL were searched through the terms of Black Raspberry, Raspberry, and Rubus Occidentali up to January 2023. Two reviewers performed the study selection by screening the title and abstract. Full texts of potentially eligible studies were retrieved to access the details. RESULTS: Out of the 767 articles assessed, 73 papers met the inclusion criteria. Among them, 63 papers investigated the anticancer mechanisms, while 10 conducted clinical trials focusing on cancer treatment or prevention. BRB was found to influence multiple cancer hallmarks by targeting various pathways. Decomposition of free radicals and regulation of estrogen metabolism, BRB can reduce DNA damage caused by reactive oxygen species. BRB can also enhance the function of nucleotide excision repair to repair DNA lesions. Through regulation of epigenetics, BRB can enhance the expression of tumor suppressor genes, inducing cell cycle arrest, and promoting apoptosis and pyroptosis. BRB can reduce the energy and nutrients supply to the cancer nest by inhibiting glycolysis and reducing angiogenesis. The immune and inflammatory microenvironment surrounding cancer cells can also be ameliorated by BRB, inhibiting cancer initiation and progression. However, the limited bioavailability of BRB diminishes its anticancer efficacy. Notably, topical applications of BRB, such as gels and suppositories, have demonstrated significant clinical benefits. CONCLUSION: BRB inhibits cancer initiation, progression, and metastasis through diverse anticancer mechanisms while exhibiting minimal side effects. Given its potential, BRB emerges as a promising phototherapeutic agent for cancer treatment.
Asunto(s)
Neoplasias , Rubus , Humanos , Antocianinas/farmacología , Frutas , Neoplasias/prevención & control , Fitoterapia , Rubus/metabolismo , Microambiente TumoralRESUMEN
Ruan Hua Tang (RHT) and Ruan Hua Fang (RHF) are two Chinese herbal mixtures that have been used in clinical cancer treatment for decades. This study validated our hypothesis that RHT and RHF can inhibit lung tumor development in the mouse model of Benzo(a)pyrene-induced lung tumorigenesis. An RHT oral solution was diluted to 9% and 18% in water. RHF was mixed into the diet at 15% and 30% of total food in the final doses. Two weeks after injecting BP into mice, we administered RHT and RHF for eighteen weeks. We found that 9% and 18% RHT reduced tumor multiplicity by 36.05% and 38.81% (both p < 0.05) and the tumor load by 27.13% and 55.94% (p < 0.05); 15% and 30% RHF inhibited tumor multiplicity by 12.75% and 39.84% (p < 0.01) and the tumor load by 18.38% and 61.68% (p < 0.05). Ki67 expressions in the 9% and 18% RHT groups were 19.55% and 11.51%, significantly lower than in the control (33.64%). The Ki67 levels in the 15% and 30% RHF groups were 15.56% and 14.04%, significantly lower than in the control (27.86%). Caspase 3 expressions in the 9% and 18% RHT groups were 5.24% and 7.32%, significantly higher than in the control (2.39%). Caspase 3 levels in the 15% and 30% RHF groups were 6.53% and 4.74%, significantly higher than in the control (2.07%). The bio-absorption was confirmed via a pharmacokinetic test. This study showed that RHT and RHF are safe and can inhibit lung tumor development, with anti-proliferative and pro-apoptotic effects.
RESUMEN
'Baiwei' (swallowwort root, Cynanchum versicolor Bunge), is a perennial cranberry type of Chinese medicinal herb, and grows in mountains with wide distribution in many provinces including Shandong, Henan, Hebei, Liaoning, Anhui and others. The functions of 'Baiwei' are strengthening myocardial contraction, detoxifying, and as a diuretic; thus it is one of very important herbs in China (Yunsi Su et al. 2021). With the increasing need for this herbal medicine in China, farmers are trying to cultivate the wild type of 'Baiwei'. In 2019, we found severe crop damage in a second-year planting of 'Baiwei' with many dead plants in a field (Fig. S1A, B) in Mengyin County of Shandong Province, China. Root galls were clearly seen in the roots and the typical root-knot nematode (Meloidogyne spp.) symptoms were observed (Fig. S1C). The previous crop was peanut. Peanut is widely planted in Shandong Province and peanut root-knot nematode (M. arenaria) is one of its major root-knot nematode pests. We suspected that the damage was caused by peanut root-knot nematode. The roots were taken to the lab and kept at 10â for morphological and molecular identification of root-knot nematodes, and pathogenicity testing. Twenty females were picked up from the infected roots for perineal pattern observation. The perineal pattern had distinct characteristics such as a low dorsal arch and lateral field marked by forked and broken striae and without punctate markings between the anus and tail terminus (Fig. S2A), which is similar to the description of M. arenaria (Eisenback et al., 1981). Eggs were extracted from roots and hatched to second-stage juveniles (J2s). The morphometric characters of J2s (n = 30) demonstrated body length = 437.35 ± SE 3.51 µm, body width = 16.74 ± 0.16 µm, stylet length = 11.31 ± 0.20 µm, DGO = 3.87 ± 0.07 µm, tail length = 53.32 ± 0.99 µm, and hyaline tail terminus = 11.14 ± 0.12 µm. The universal primer 194/195 (5.8S-18S rDNA TTAACTTGCCAGATCGGACG/TCTAATGAGCCGTACGC) for confirmation of Meloidogyne spp. was chosen and the sequence characterized amplified region (SCAR) PCR specific markers for M. incognita (Finc/Rinc GGGATGTGTAAATGCTCCTG/CCCGCTACACCCTCAACTTC), M. javanica (Fjav/Rjav ACGCTAGAATTCGACCCTGG/GGTACCAGAAGCAGCCATGC), M. enterolobii (Fent/Rent GAAATTGCTTTATTGTTACTAAG/TAGCCACAGCAAAATAGTTTTC), M. arenaria (Fare/Rare TCGGCGATAGAGGTAAATGAC/TCGGCGATAGACACTACAACT), M. hapla (Fhap/Rhap TGACGGCGGTGAGTGCGA/TGACGGCGGTACCTCATAG) and M. chitwoodi (Fchi/Rchi TGGAGAGCAGCAGGAGAAAGA/GGTCTGAGTGAGGACAAGAGTA) were utilized for species identification (Mao et al., 2019). PCR products of J2 amplification were run in the agar gel (Fig. S2B). A PCR product of 750 bp was obtained for 194/195 primer pair and a 420 bp band was identified for M. arenaria for all tested J2 samples. There were no bands for other specific primers. The amplicons from 194/195 and M. arenaria primer pairs were sequenced. A 100% identity of the Fare/Rare sequence (MZ522722.1) with M. arenaria KP234264.1 and a 99.8% identity with M. arenaria MW315990.1 were found through NCBI blast. A 100% identity of the 194/195 sequence (MZ555753.1) with both M. arenaria GQ395518.1 and U42342.1 and M. thailandica HF568829.1. To confirm the pathogenicity, 2000 J2s obtained from the same population as described above were used to inoculate each plant of one-month old 'Baiwei' seedlings (n = 5) and of one-month-old tomato cv. 'Zhongshu4' seedlings (n = 5) growing in 15-cm-diameter and 10-cm-height plastic pot containing sand and soil (2:1 ratio) in the glasshouse at 22-28â and 16/8 h day/night. Plants without J2s were used as control. Sixty days later, roots were stained with erioglaucine (Omwega et al. 1988) and an average of 107 ± SE 59 and 276 ± SE 31 egg masses per gram root were produced in each infected 'Baiwei' (Fig. S3A) and tomato (Fig. S3B) root, respectively. PCR amplification of the hatched J2s reconfirmed the reproduced nematode in 'Baiwei' and tomato was M. arenaria. This is the first report on M. arenaria parasitizing the medicinal herb C. versicolor in China.
RESUMEN
Magnetic coagulation is a promising approach for treating high phosphorous (high-P) wastewater by enhancing precipitation efficiency using magnetic particles. In this study, a cost-effective and environmentally friendly magnetic seed from coal fly ash (MS-CFA) was used as an alternative material for Fe3O4 magnetic seed (MS) coagulation. The potential effect of MS-CFA was explored to reduce the settling time and the dosage of coagulant aid of polyacrylamide (PAM) in treating high-phosphorous (high-P) simulated wastewater at 100 and 200 mg P/L. The physicochemical characteristics of MS-CFA were analysed through particle size distribution (20-100 µm), pore size distribution (14-30 nm), specific surface area (1.654 m2/g), X-ray diffraction (XRD), specific gravity (4.2), and magnetic induction intensity (49.8 emu/g). The characteristics met the requirements as magnetic coagulation material. MS-CFA was combined with polyaluminum chloride (PAC) and polyacrylamide (PAM) to improve phosphorous precipitation performance. The synergised magnetic coagulation effect using MS-CFA and PAM reduced the settling time of flocs to less than 1 min due to the high specific gravity. This represents a reduction of 90% of the settling time compared to the control using PAM alone (15 min) without MS-CFA. MS-CFA efficiently reduced PAM dosage by 83% and 87% for treating 100 and 200 mg P/L, respectively. The presence of PAM (1 mg/L for 100 mg P/L and 2 mg/L for 200 mg P/L) was imperative for binding the MS-CFA and flocs, hence increasing the particle size of the magnetic flocs. The characteristics of the magnetic flocs were analysed through microscopy, particle size distribution, zeta potential measurements, and magnetic induction intensity. The characteristics of the magnetic flocs confirmed that MS-CFA could be an alternative material for Fe3O4 as the magnetic seeds in the magnetic coagulation process for treating high-P wastewater.
Asunto(s)
Ceniza del Carbón , Aguas Residuales , Carbón Mineral , Fenómenos Magnéticos , FósforoRESUMEN
Neuropathic and inflammatory pain are major clinical challenges due to their ambiguous mechanisms and limited treatment approaches. N-methyl-D-aspartate receptor (NMDAR) and calcium-calmodulin-dependent protein kinase II (CaMKII) are responsible for nerve system sensation and are required for the induction and maintenance of pain. However, the roles of NMDAR and CaMKII in regulating orofacial pain are still less well known. Here, we established a neuropathic pain model by transecting a mouse inferior alveolar nerve (IAN) and an inflammatory pain model by injecting complete Freund's adjuvant (CFA) into its whisker pad. The Cre/loxp site-specific recombination system was used to conditionally knock out (KO) NR2B in the trigeminal ganglion (TG). Von Frey filament behavioral tests showed that IANX and CFA-induced mechanical allodynia were altered in NR2B-deficient mice. CFA upregulated CaMKIIα and CaMKIIß in the mouse TG and spinal trigeminal caudate nucleus (SpVc). CaMKIIα first decreased and then increased in the TG after IANX, and CaMKIIß decreased in the TG and SpVc. CFA and IANX both greatly enhanced the expression of phospho (p)-NR2B, p-CaMKII, cyclic adenosine monophosphate (cAMP), p-ERK, and p-cAMP response element binding protein (CREB) in the TG and SpVc. These neurochemical signal pathway alterations were reversed by the conditional KO of NR2B and inhibition of CaMKII. Similarly, IANX- and CFA-related behavioral alterations were reversed by intra-ganglionic (i.g.) -application of inhibitors of CaMKII, cAMP, and ERK. These findings revealed novel molecular signaling pathways (NR2B-CaMKII-cAMP-ERK-CREB) in the TG- and SpVc-derived latent subsequent peripheral and spinal central sensitization under nerve injury and inflammation, which might be beneficial for the treatment of orofacial allodynia.
Asunto(s)
Hiperalgesia , Neuralgia , Animales , Calcio/metabolismo , Proteína Quinasa Tipo 2 Dependiente de Calcio Calmodulina/metabolismo , Ratones , Neuralgia/metabolismo , Fosforilación , Receptores de N-Metil-D-Aspartato/metabolismoRESUMEN
BACKGROUND: Senescence leads to permanent cell-cycle arrest and is a potential target for cancer therapy. Andrographolide (AD) is a diterpene lactone isolated from Traditional Chinese Medicine (TCM) Andrographis paniculate, which has been used as an anti-inflammatory drug in clinical practice with the potential to target senescence in recalcitrant lung cancer. PURPOSE: To determine whether AD can induce senescence in human lung adenocarcinoma in vitro and in vivo and to elucidate the underlying mechanisms. METHODS: SA-ß-Gal staining was used to detect the expression of senescence-associated ß-galactosidase (SA-ß-Gal) in human lung adenocarcinoma cells A549 and NCI-H1795. DNA damage was examined by the detection of γH2AX foci. Cell cycle was analyzed by flow cytometry. Cancer cell proliferation was determined by ATPlite assay and clonogenic survival assay in vitro. Tumor growth was determined in a mouse model of A549. The expression level of proteins and mRNA was estimated by Western blotting and Quantitative RT-PCR, respectively. Small interfering RNA (siRNA) was used to knock down p21, p27 and p53 to explore the potential mechanism of AD-induced senescence in human lung adenocarcinoma cells. RESULTS: AD-induced A549 and NCI-H1795 cell senescence determined by increased cell size, flattened morphology, DNA damage, cell cycle arrest as well as the increased expression of ß-galactosidase. AD inhibited cell proliferation in lung cells in vitro and lung cells xenograft growth in nude mice. p21 and p27, the major cell cycle regulators and mediators of senescence, were upregulated at the protein level in AD-treated A549 lung adenocarcinoma in vitro and in vivo. Further studies demonstrated that AD induced cell senescence via p53/p21 and Skp2/p27. CONCLUSION: In the present study, we found that the primary anti-inflammatory drug AD could have a potential antitumor effect in lung cancer. We demonstrated that AD induced lung adenocarcinoma senescence in vitro and in vivo via p53/p21 and Skp2/p27 for the first time. AD is therefore a promising senescence-inducing therapeutic for recalcitrant human lung adenocarcinoma.
RESUMEN
Lung adenocarcinoma is the most common pathological type of lung cancer with poor patient outcomes; therefore, developing novel therapeutic agents is critically needed. Andrographolide (AD), a major active component derived from the traditional Chinese medicine (TCM) Andrographis paniculate, is a potential antitumor drug, but the role of AD in lung adenocarcinoma remains poorly understood. In the present study, we demonstrated that AD inhibited the proliferation of broad-spectrum lung cancer cell lines in a dose-dependent manner. Meanwhile, we found that a high dose of AD induced Noxa-dependent apoptosis in human lung adenocarcinoma cells (A549 and H1299). Further studies revealed that Noxa was transcriptionally activated by activating transcription factor 4 (ATF4) in AD-induced apoptosis. Knockdown of ATF4 by small interfering RNA (siRNA) significantly diminished the transactivation of Noxa as well as the apoptotic population induced by AD. These results of the present study indicated that AD induced apoptosis of human lung adenocarcinoma cells by activating the ATF4/Noxa axis and supporting the development of AD as a promising candidate for the new era of chemotherapy.
RESUMEN
Due to the number of phosphorylation sites, mono- and multiple-phosphopeptides exhibit significantly different biological effects. Therefore, comprehensive profiles of mono- and multiple-phosphopeptides are vital for the analysis of these biological and pathological processes. However, the most commonly used affinity materials based on metal oxide affinity chromatography (MOAC) show stronger selectivity toward mono-phosphopeptides, thus losing most information on multiple-phosphopeptides. Herein, we report polymer functionalized magnetic nanocomposite microspheres as an ideal platform to efficiently enrich both mono- and multiple-phosphopeptides from complex biological samples. Driven by complementary multiple hydrogen bonding interactions, the composite microspheres exhibited remarkable performance for phosphopeptide enrichment from model proteins and real bio-samples. Excellent selectivity (the molar ratio of nonphosphopeptides/phosphopeptides was 5000 : 1), high enrichment sensitivity (2 fmol) and coverage, as well as high capture rates of multiple-phosphopeptides revealed their great potential in comprehensive phosphoproteomics studies. More importantly, we successfully captured the cancer related phosphopeptides (from the phosphoprotein Stathmin-1) and identified their relevant phosphorylation sites from oral carcinoma patients' saliva and tissue lysate, demonstrating the potential of this material for phosphorylated disease marker detection and discovery.
Asunto(s)
Biomarcadores de Tumor/aislamiento & purificación , Óxido Ferrosoférrico/química , Microesferas , Fosfopéptidos/aislamiento & purificación , Animales , Biomarcadores de Tumor/química , Carcinoma/química , Caseínas/química , Caseínas/aislamiento & purificación , Bovinos , Humanos , Enlace de Hidrógeno , Fenómenos Magnéticos , Masculino , Leche/química , Nanosferas/química , Fragmentos de Péptidos/química , Fragmentos de Péptidos/aislamiento & purificación , Fosfopéptidos/química , Fosforilación , Polímeros/síntesis química , Polímeros/química , Ratas Sprague-Dawley , Saliva/química , Dióxido de Silicio/química , Extracción en Fase Sólida/métodos , Estatmina/química , Estatmina/aislamiento & purificaciónRESUMEN
BACKGROUND: Patients with coronary heart disease (CHD) angina pectoris are in critical condition, which can cause sudden death, myocardial infarction, and other adverse events, and bring serious burden to families and society. Timely treatment should be given to improve the condition. Western medicine treatment of angina pectoris failed to meet the demand of angina symptom control. OBJECTIVE: It is hoped that the research method with higher evidential value will be adopted to compare the short-term, medium-term, and long-term effects of Chinese patent medicine combined with conventional western medicine and conventional western medicine alone in the treatment of CHD angina pectoris, so as to tap the clinical efficacy advantages of traditional Chinese medicine (TCM) and provide reliable data support for its clinical application. METHODS: A prospective cohort study was conducted among patients with CHD angina pectoris who were treated with oral Chinese patent medicine and conventional western medicine. The patients were divided into exposed group and nonexposed group according to whether or not the patients with CHD angina pectoris were treated with Chinese patent medicine. The exposed group was treated with TCM combined with conventional western medicine, while the nonexposed group was treated with conventional western medicine alone. Patients need to be hospitalized for 2 weeks as the introduction period and whether to enter the group is determined according to the treatment and medication conditions of the patients. The follow-up time points were 0th, 4th, 12th, 24th, and 48th weeks. The main events and secondary events were used as the evaluation criteria for clinical efficacy of CHD angina pectoris. In the experimental study, we will use strict indicators to detect standard operation procedure for multinomics and bacterial flora detection. CONCLUSION: This study will provide evidence for the clinical efficacy advantages of Chinese patent medicine and reliable support for its clinical application through test data.
Asunto(s)
Angina de Pecho/tratamiento farmacológico , Medicamentos Herbarios Chinos/uso terapéutico , Medicina Tradicional China/métodos , Femenino , Humanos , Masculino , Persona de Mediana Edad , Guías de Práctica Clínica como Asunto , Estudios Prospectivos , Proyectos de Investigación , Resultado del TratamientoAsunto(s)
Neoplasias , Compuestos Orgánicos Volátiles , Pruebas Respiratorias , Espiración , HumanosRESUMEN
PURPOSE: Wound represents a major health challenge as they consume a large amount of healthcare resources to improve patient's quality of life. Many scientific studies have been conducted in search of ideal biomaterials with wound-healing activity for clinical use and collagen has been proven to be a suitable candidate biomaterial. This study intended to investigate the wound healing activity of collagen peptides derived from jellyfish following oral administration. METHODS: In this study, collagen was extracted from the jellyfish--Rhopilema esculentum using 1% pepsin. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and fourier transform infrared (FTIR) were used to identify and determine the molecular weight of the jellyfish collagen. Collagenase II, papain and alkaline proteinase were used to breakdown jellyfish collagen into collagen peptides. Wound scratch assay (in vitro) was done to determine migration potential of human umbilical vein endothelial cells (HUVEC) covering the artificial wound created on the cell monolayer following treatment with collagen peptides. In vivo studies were conducted to determine the effects of collagen peptides on wound healing by examining wound contraction, re-epithelialization, tissue regeneration and collagen deposition on the wounded skin of mice. Confidence level (p < 0.05) was considered significant using GraphPad Prism software. RESULTS: The yield of collagen was 4.31%. The SDS-PAGE and FTIR showed that extracted collagen from jellyfish was type I. Enzymatic hydrolysis of this collagen using collagenase II produced collagen peptides (CP1) and hydrolysis with alkaline proteinase/papain resulted into collagen peptides (CP2). Tricine SDS-PAGE revealed that collagen peptides consisted of protein fragments with molecular weight <25 kDa. Wound scratch assay showed that there were significant effects on the scratch closure on cells treated with collagen peptides at a concentration of 6.25 µg/mL for 48 h as compared to the vehicle treated cells. Overall treatment with collagen peptide on mice with full thickness excised wounds had a positive result in wound contraction as compared with the control. Histological assessment of peptides treated mice models showed remarkable sign of re-epithelialization, tissue regeneration and increased collagen deposition. Immunohistochemistry of the skin sections showed a significant increase in ß-fibroblast growth factor (ß-FGF) and the transforming growth factor-ß1 (TGF-ß1) expression on collagen peptides treated group. CONCLUSION: Collagen peptides derived from the jellyfish-Rhopilema esculentum can accelerate the wound healing process thus could be a therapeutic potential product that may be beneficial in wound clinics in the future.
Asunto(s)
Colágeno/aislamiento & purificación , Colágeno/farmacología , Escifozoos/química , Cicatrización de Heridas/efectos de los fármacos , Administración Oral , Animales , Colágeno/administración & dosificación , Colágeno/metabolismo , Factores de Crecimiento de Fibroblastos/metabolismo , Células Endoteliales de la Vena Umbilical Humana , Humanos , Masculino , Regeneración , Piel/metabolismo , Fenómenos Fisiológicos de la Piel , Estimulación Química , Factor de Crecimiento Transformador beta1/metabolismoRESUMEN
Coronary heart disease (CHD) threatens human health. The discovery and assessment of potential biometabolic markers for different syndrome types of CHD may contribute to decipher pathophysiological mechanisms and identify new targets for diagnosis and treatment. On the basis of UPLC-Q-TOF/MS metabolomics technology, urine samples of 1072 participants from nine centers, including normal control, phlegm and blood stasis (PBS) syndrome and Qi and Yin deficiency (QYD) syndrome, and other syndromes of CHD, were conducted to find biomarkers. Among them, the discovery set ( n = 125) and the test set ( n = 337) were used to identify and validate biomarkers, and the validation set ( n = 610) was used for the application and evaluation of the support vector machine (SVM) prediction model. We discovered 15 CHD-PBS syndrome biomarkers and 12 CHD-QYD syndrome biomarkers, and the receiver-operator characteristic (ROC) area-under-the-curve (AUC) values of them were 0.963 and 0.990. The established SVM model has a good diagnostic ability and can well distinguish the two syndromes of CHD with a high predicted accuracy >98.0%. The discovery of biomarkers and metabolic pathways in different syndrome types of CHD provides a basis for the diagnosis and evaluation of CHD, thereby improving the accurate diagnosis and precise treatment level of Chinese medicine.
Asunto(s)
Enfermedad Coronaria/diagnóstico , Medicina Tradicional China/métodos , Metaboloma , Adulto , Anciano , Anciano de 80 o más Años , Área Bajo la Curva , Biomarcadores/orina , Estudios de Casos y Controles , Cromatografía Líquida de Alta Presión , Enfermedad Coronaria/fisiopatología , Enfermedad Coronaria/orina , Diagnóstico Diferencial , Femenino , Humanos , Masculino , Persona de Mediana Edad , Curva ROC , Espectrometría de Masa por Láser de Matriz Asistida de Ionización Desorción , Máquina de Vectores de Soporte , SíndromeRESUMEN
PURPOSE: Temporomandibular joint (TMJ) disorders occur in many people and osteoarthritis (OA) is a severe form of this disease. Glucosamine has been used to treat OA of the large joints for many years and has been proved effective. A double-blinded randomized controlled trial was designed to investigate the effectiveness and safety of oral glucosamine hydrochloride pills combined with hyaluronate sodium intra-articular injection in TMJ OA. PATIENTS AND METHODS: One hundred forty-four participants with TMJ OA were randomized to 4 hyaluronate sodium injections and oral glucosamine hydrochloride (1.44 g/day) for 3 months (group A) or 4 hyaluronate sodium injections and oral placebo for 3 months (group B). All participants were followed for 1 year. Eighteen participants were lost to follow-up. RESULTS: The intention-to-treat analysis showed that group A had similar maximal interincisal mouth opening and pain intensity during TMJ function at months 1 and 6 (P > .05). However, during long-term follow-up, group A had significantly greater maximal interincisal mouth opening compared with group B at month 12 (41.5 vs 37.9 mm; P < .001). For pain intensity, group A showed obviously lower visual analog scale scores than group B at month 6 (20.6 vs 29.2 mm; P = .007) and month 12 (17.4 vs 28.6 mm; P = .001). Twenty-four participants had gastrointestinal tract side effects, fatigue, and rash. Of these, 23 had slight side effects that were not correlated with glucosamine. There was no significant difference between the 2 groups (P > .05). CONCLUSION: The results of this study suggest that, compared with hyaluronate sodium injection alone, glucosamine hydrochloride pills added to hyaluronate sodium injection had no meaningful effect on TMJ OA in the short-term but did relieve the pain caused by TMJ OA and improved TMJ functions in the long-term.
Asunto(s)
Glucosamina/administración & dosificación , Ácido Hialurónico/administración & dosificación , Inyecciones Intraarticulares/métodos , Osteoartritis/tratamiento farmacológico , Trastornos de la Articulación Temporomandibular/tratamiento farmacológico , Viscosuplementos/administración & dosificación , Administración Oral , Adolescente , Adulto , Anciano , Método Doble Ciego , Quimioterapia Combinada , Femenino , Humanos , Análisis de Intención de Tratar , Masculino , Persona de Mediana Edad , Dimensión del Dolor , Calidad de Vida , Rango del Movimiento Articular , Resultado del TratamientoRESUMEN
A unique sediment-capping agent consisting of a zeolite/hydrous zirconia composite (ZHZ) was developed and tested for P-immobilization in the overlying water and sediment cores from a freshwater pond. In the ZHZ, NaP1 zeolite was covered with hydrous zirconia, which existed as an amorphous phase. Experimental results in pond water indicated that ZHZ could efficiently remove soluble reactive phosphorus. The 28-day sediment incubation experiments showed that capping sediment with ZHZ resulted in a more efficient, rapid and sustained decrease in P concentration when compared with the traditional alum treatment method. Furthermore, ZHZ increased the sediment stability, resulting in the lowest turbidity, total phosphorus and soluble reactive phosphorus concentrations in overlying water following artificially induced resuspension of sediment. Phosphorus fractionation of sediment showed that the dominant P form transferred from HCl-extractable P to residual P, and the most release-sensitive P (labile P and reductant reactive P) was decreased after ZHZ application. Overall, ZHZ is a highly effective P-immobilization material. ZHZ has high potential as a sediment capping material to control internal P loading in eutrophic water bodies.
Asunto(s)
Fósforo/química , Contaminantes Químicos del Agua/química , Sedimentos Geológicos , Zeolitas , CirconioRESUMEN
Glutamate is one of the major excitatory neurotransmitters of the CNS and is essential for numerous key neuronal functions. However, excess glutamate causes massive neuronal death and brain damage owing to excitotoxicity via the glutamate receptors. Metabotropic glutamate receptor 5 (mGluR5) is one of the glutamate receptors and represents a promising target for studying neuroprotective agents of potential application in neurodegenerative diseases. Pu-erh tea, a fermented tea, mainly produced in Yunnan province, China, has beneficial effects, including the accommodation of the CNS. In this study, pu-erh tea markedly decreased the transcription and translation of mGluR5 compared to those by black and green teas. Pu-erh tea also inhibited the expression of Homer, one of the synaptic scaffolding proteins binding to mGluR5. Pu-erh tea protected neural cells from necrosis via blocked Ca2+ influx and inhibited protein kinase C (PKC) activation induced by excess glutamate. Pu-erh tea relieved rat epilepsy induced by LiCl-pilocarpine in behavioural and physiological assays. Pu-erh tea also decreased the expression of mGluR5 in the hippocampus. These results show that the inhibition of mGluR5 plays a role in protecting neural cells from glutamate. The results also indicate that pu-erh tea contains biological compounds binding transcription factors and inhibiting the expression of mGluR5 and identify pu-erh tea as a novel natural neuroprotective agent.
Asunto(s)
Fermentación/efectos de los fármacos , Sistema Nervioso/efectos de los fármacos , Extractos Vegetales/farmacología , Receptor del Glutamato Metabotropico 5/metabolismo , Té , Animales , Células Cultivadas , Masculino , Ratas WistarRESUMEN
Rhizosphere processes stimulate overyielding and facilitative phosphorus (P) uptake in cereal/legume intercropping systems. However, little is known about when and how rhizosphere alteration of legumes plays a role in improving P uptake by cereals. Wheat was grown isolated, monocropped or intercropped with faba bean in pots with low-P soil. The biomass, P content, carboxylates and phosphatases activity were measured in 15 destructive samplings. Intraspecific competition of the biomass and P uptake of monocropped wheat was not significant before 40 and 36 days after sowing (DAS), whereas there was interspecific competition of biomass of intercropped wheat before 66 DAS. However, afterwards, the increments of the biomass and P uptake of the intercropped wheat were 1.3-1.9 and 1.9-2.3 times of increment of monocropped wheat. Meanwhile, the concentrations of malate and citrate and the acid phosphatase activity in the rhizospheres of intercropped wheat were significantly increased, which suggested that wheat/faba bean intercropping is efficient in P utilization due to complementary P uptake in the early growth stage and the positive interactions of the rhizosphere processes when the soil P was depleted.
Asunto(s)
Fósforo/química , Fósforo/metabolismo , Suelo/química , Triticum/fisiología , Vicia faba/fisiología , Fosfatasa Ácida/metabolismo , Biomasa , Activación Enzimática , RizosferaRESUMEN
The fungal endophytes associated with medicinal plants have been demonstrated as a reservoir with novel natural products useful in medicine and agriculture. It is desirable to explore the species composition, diversity and tissue specificity of endophytic fungi that inhabit in different tissues of medicinal plants. In this study, a culture-independent survey of fungal diversity in the rhizosphere, leaves, stems and roots of a toxic medicinal plant, Stellera chamaejasme L., was conducted by sequence analysis of clone libraries of the partial internal transcribed spacer region. Altogether, 145 fungal OTUs (operational taxonomic units), represented by 464 sequences, were found in four samples, of these 109 OTUs (75.2 %) belonging to Ascomycota, 20 (13.8 %) to Basidiomycota, 14 (9.7 %) to Zygomycota, 1 (0.7 %) to Chytridiomycota, and 1 (0.7 %) to Glomeromycota. The richness and diversity of fungal communities were strongly influenced by plant tissue environments, and the roots are associated with a surprisingly rich endophyte community. The endophyte assemblages associated with S. chamaejasme were strongly shaped by plant tissue environments, and exhibited a certain degree of tissue specificity. Our results suggested that a wide variety of fungal assemblages inhabit in S. chamaejasme, and plant tissue environments conspicuously influence endophyte community structure.
Asunto(s)
Biodiversidad , Endófitos/clasificación , Endófitos/aislamiento & purificación , Hongos/clasificación , Hongos/aislamiento & purificación , Plantas Medicinales/microbiología , Thymelaeaceae/microbiología , ADN de Hongos/química , ADN de Hongos/genética , ADN Espaciador Ribosómico/química , ADN Espaciador Ribosómico/genética , Datos de Secuencia Molecular , Análisis de Secuencia de ADNRESUMEN
The mechanistic understanding of the dynamic processes linking nutrient acquisition and biomass production of competing individuals can be instructive in optimizing intercropping systems. Here, we examine the effect of inoculation with Funneliformis mosseae on competitive dynamics between wheat and faba bean. Wheat is less responsive to mycorrhizal inoculation. Both inoculated and uninoculated wheat attained the maximum instantaneous N and P capture approximately five days before it attained the maximum instantaneous biomass production, indicating that wheat detected the competitor and responded physiologically to resource limitation prior to the biomass response. By contrast, the instantaneous N and P capture by uninoculated faba bean remained low throughout the growth period, and plant growth was not significantly affected by competing wheat. However, inoculation substantially enhanced biomass production and N and P acquisition of faba bean. The exudation of citrate and malate acids and acid phosphatase activity were greater in mycorrhizal than in uninoculated faba bean, and rhizosphere pH tended to decrease. We conclude that under N and P limiting conditions, temporal separation of N and P acquisition by competing plant species and enhancement of complementary resource use in the presence of AMF might be attributable to the competitive co-existence of faba bean and wheat.