RESUMEN
Cyclophosphaty -45mide (Cyc) chemotherapy in young female cancer patients is associated with an increased risk of premature ovarian insufficiency (POI). This study was designed to investigate the protective role of melatonin (Mel) as an adjuvant against Cyc-induced POI. Female mice received a single intraperitoneal (i.p.) dose of Cyc (75 mg/kg). Mel protection was achieved in mice after i.p. injection of melatonin (50 mg/kg) every 24 h for four consecutive days prior to chemotherapy initiation and for 14 additional days. Ovarian reserve testing, hormonal assays for follicle-stimulating hormone, luteinizing hormone, and anti-Müllerian hormone (AMH), assessment of the oxidative stress status, and measurement of the relative expression of genes in PTEN/AKT/FOXO3a and mitochondrial apoptosis pathways were performed. The results showed that treatment with 50 mg/kg Mel significantly prevented Cyc-induced over-activation of primordial follicles by maintaining the plasma level of AMH and subsequently preventing litter size reduction in mice treated with Cyc chemotherapy. Importantly, Mel treatment significantly prevented ovarian granulosa cell loss by inhibiting the mitochondrial apoptotic pathway. Identifying the protective actions of Mel against Cyc-induced primordial follicle loss has important implications for fertility maintenance in young cancer patients undergoing chemotherapy.
Asunto(s)
Melatonina , Insuficiencia Ovárica Primaria , Animales , Hormona Antimülleriana , Apoptosis , Ciclofosfamida/efectos adversos , Femenino , Células de la Granulosa , Humanos , Melatonina/farmacología , Melatonina/uso terapéutico , Ratones , Insuficiencia Ovárica Primaria/inducido químicamente , Insuficiencia Ovárica Primaria/prevención & controlRESUMEN
Bupleurum chinensis is an important traditional medicine with anti-inflammatory and immunomodulatory effects in China (Navarro et al. 2001). So far, the diseases reported on B. chinensis were caused by fungi (rust and root rot) and virus (Cucumber mosaic virus and Broad bean wilt virus 2) (Zhang et al. 2009). However, no diseases caused by nematodes were reported previously. Root-knot nematodes (Meloidogyne spp.) are one of the most destructive plant-parasitic nematodes with strong adaptability and diversity, infecting more than 5,500 plant species (Azevedo de Oliveira et al. 2018). In October 2020, symptoms of dwarf, leaf yellowing and roots with numerous knots on B. chinensis in several fields were observed in Dingxi City, Gansu Province, Northwest China (N 35°19'42â³; E 104°2'24â³). Subsequently, hundreds of eggs, mature males and females were exuded from dissection of washed root-knots. Morphological characteristics of females, males and J2s were examined under the optical microscope. The perineal patterns of females (n=15) were oval-shaped with a slightly dorsal arches, and the lateral lines and punctations on anus were observed in some specimens. Measurements (mean ± SD, range) of females(n=20): L (body length) = (525.23 ± 59.88 µm, 439.72 to 659.93 µm), W (maximum body width) = (403.92 ± 57.17 µm, 311.01 to 513.34 µm), St (stylet length) = (11.28 ± 1.05 µm, 9.82 to 12.91 µm), MBW (width of the median bulb) = (31.13 ± 3.32 µm, 23.66 to 35.55 µm), MB (distance from anterior end to center of median oesophageal bulb valve) = (64.45 ± 3.44 µm, 58,62 to 71.92 µm), and DGO (dorsal gland orifice to stylet) = (3.79 ± 0.60 µm, 2.72 to 5.00 µm). Male (n=20): L= (1038.25 ± 90.34 µm, 877.28 to 1206.12 µm), St= (18.13 ± 1.48 µm, 15.10 to 20.12 µm), a (body length divided by greatest body width) = (31.77 ± 4.03 µm, 23.29 to 41.16µm), MBW= (10.97 ± 0.78 µm, 9.05 to 12.31 µm), MB= (64.81 ± 3.45 µm, 59.59 to 71.38 µm), DGO= (4.05 ± 0.47 µm, 3.11 to 5.08 µm), and Spic (spicule length) = (22.57 ± 1.91 µm, 19.26 to 26.43 µm). J2 (n=25): L= (381.73 ± 25.85µm, 336.96 to 419.98 µm), St= (10.52 ± 1.03 µm, 9.15 to 12.14 µm), a= (24.35 ± 2.10 µm, 20.45 to 28.29 µm), DGO= (3.02 ± 0.42 µm, 2.42 to 3.79 µm), c (body length divided by tail length) = (8.90 ± 0.86 µm, 7.71 to 10.48 µm), and c' (tail length divided by body width at anus) = (4.18 ± 0.50 µm, 3.47 to 5.04 µm). According to morphological characteristics, root-knot nematode infecting B. chinensis was preliminarily identified as Meloidogyne hapla Chitwood, 1949 (Whitehead 1968). To further verify this result, DNA was extracted from ten individual females, the ITS region and the D2-D3 region of 28S rDNA were amplified using the primer TW81/AB28(GTTTCCGTAGGTGAACCTGC/ ATATGCTTAAGTTCAGCGGGT) (Subbotin et al. 2000) D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/ TCGGAAGGAACCAGCTACTA) (De Ley et al. 1999), respectively. PCR products were purified and sequenced. The sizes of ITS region and D2-D3 region of 28S rDNA were 557 bp and 762 bp, respectively. The sequence of ITS region (GenBank accession number: OK030559) was 99.46%-99.82% identical to the M. hapla from China (MT490918), New Zealand (JX465560), Australia (AF516722) and Japan (LC030357). The sequence of D2-D3 region of 28S rDNA (GenBank accession number: OK030558) was 99.58%-100.00% identical to the M. hapla from Canada (MW182329), Ethiopia (KJ645432), USA (KP901086) and China (MN446015). Furthermore, fragments obtained using the specific primers of M. hapla (Mh-F/Mh-R) were 462 bp, which also was consistent with that of M. hapla (Feng et al. 2008). Through morpho-molecular characterization, the root-knot nematodes on B. chinensis in China were identified as M. hapla. Six seedlings of B. chinensis were planted in 16 cm diameter, 20 cm deep plastic pots with sterilized soil in the greenhouse at 20-25â for pathogenicity test. After planted 21 days, 2000 J2s/pot were inoculated, six seedling uninoculated were used as control. After 90 days, all inoculated plants showed similar symptoms observed in the field, and nematode reproduction factor (final population density/initial population density) was 1.47. Meanwhile, no symptoms were observed on control plants. These results proved that the nematode infecting B. chinensis is M. hapla. To our knowledge, this is the first report of B. chinensis as a new host of M. hapla in China. Bupleurum chinensis is widely planted in Gansu Province, the plant species cultivated across an area of about 19.1 million hectares, accounting for 40% of the China's total output (Wang et al. 2017). The root system of B. chinensis infected M. hapla is stunned and short, seriously affect the quality of medicinal materials, and restrict the development of the local Chinese herbal medicine industry.
RESUMEN
BACKGROUND: Irritable bowel syndrome (IBS) is a chronic gastrointestinal disorder characterized by abdominal pain, diarrhea or constipation, and changes in defecation patterns. No organic disease is found to explain these symptoms by routine clinical examination. This study aims to investigate the efficacy and safety of acupuncture therapy for IBS patients compared with those of conventional treatments. We also aim to identify the optimal acupoint combination recommended for IBS and to clarify the clinical advantage of the "multiacupoint co-effect and synergistic effect." METHODS AND ANALYSIS: A total of 204 eligible patients who meet the Rome IV criteria for IBS will be randomly stratified into acupuncture group A, acupuncture group B, or the control group in a 1:1:1 ratio with a central web-based randomization system. The prespecified acupoints used in the control group will include bilateral Tianshu (ST25), Shangjuxu (ST37), Neiguan (PC6), and Zusanli (ST36). The prespecified acupoints used in experimental group A will include bilateral Tianshu (ST25), Shangjuxu (ST37), and Neiguan (PC6). The prespecified acupoints used in experimental group B will include bilateral Tianshu (ST25), Shangjuxu (ST37), and Zusanli (ST36). Each patient will receive 12 acupuncture treatments over 4 weeks and will be followed up for 4 weeks. The primary outcome is the IBS-Symptom Severity Scale (IBS-SSS) score. The secondary outcomes include the Bristol Stool Form Scale (BSFS), Work and Social Adjustment Score (WSAS), IBS-Quality of Life (IBS-QOL), Self-Rating Anxiety Scale (SAS), and Self-Rating Depression Scale (SDS) scores. Both the primary outcome and the secondary outcome measures will be collected at baseline, at 2 and 4 weeks during the intervention, and at 6 weeks and 8 weeks after the intervention. ETHICS AND DISSEMINATION: The entire project has been approved by the ethics committee of the Beijing University of Chinese Medicine (2020BZYLL0903). DISCUSSION: This is a multicenter randomized controlled trial for IBS in China. The findings may shed light on the efficacy of acupuncture as an alternative to conventional IBS treatment. The results of the trial will be disseminated in peer-reviewed publications. TRIAL REGISTRATION: Chinese Clinical Trials Register ChiCTR2000041215 . First registered on 12 December 2020. http://www.chictr.org.cn/ .
Asunto(s)
Terapia por Acupuntura , Síndrome del Colon Irritable , Puntos de Acupuntura , Terapia por Acupuntura/efectos adversos , Diarrea , Humanos , Síndrome del Colon Irritable/diagnóstico , Síndrome del Colon Irritable/terapia , Estudios Multicéntricos como Asunto , Calidad de Vida , Ensayos Clínicos Controlados Aleatorios como Asunto , Resultado del TratamientoRESUMEN
INTRODUCTION: Irritable bowel syndrome (IBS) is a common chronic functional gastrointestinal disorder that presents with abdominal pain/discomfort and altered bowel patterns. IBS has multiple potential causes for which conventional medicines have had limited success, resulting in a significant number of patients who do not sensitively respond to pharmacotherapy for a period of 12 months and who develop a continuing symptom profile (described as refractory IBS) and seek help through (non)pharmacological treatments. The aim of this study is to investigate the efficacy and safety of acupuncture therapy for refractory IBS on the basis of conventional treatments. METHODS AND ANALYSIS: A total of 170 eligible patients who meet the Rome IV criteria for refractory IBS will be randomly allocated to receive acupuncture or sham acupuncture. Each patient will receive 12 sessions of acupuncture over 4 weeks and a 4-week follow-up. The primary outcome will be the IBS Symptom Severity Score. Secondary outcomes will include the proportion of participants experiencing adequate relief of global IBS symptoms, the weekly frequency of defecation, the stool properties assessed by the Bristol Grading Scale, the Work and Social Adjustment Scale, the IBS-Quality of Life score, and the Self-Rating Depression Scale and Self-Rating Anxiety Scale anxiety and depression scores. Outcome measures will be collected at baseline, 2 and 4 weeks of the intervention, and 6 and 8 weeks after the intervention. Categorical variables will be compared with Fisher's exact test or the Wilcoxon rank-sum test, and continuous variables will be compared using Student's t-test or the Wilcoxon rank-sum test. ETHICS AND DISSEMINATION: The entire project has been approved by the ethics committees of Beijing University of Chinese Medicine (2020BZYLL0507) and Sichuan Province Regional Institution for Conducting Research on Traditional Chinese Medicine (2020KL-025). The outcomes of the trial will be disseminated through peer-reviewed publications. TRIAL REGISTRATION NUMBER: NCT04276961.
Asunto(s)
Terapia por Acupuntura , Síndrome del Colon Irritable , Dolor Abdominal/etiología , Dolor Abdominal/terapia , Humanos , Síndrome del Colon Irritable/terapia , Calidad de Vida , Ensayos Clínicos Controlados Aleatorios como Asunto , Resultado del TratamientoRESUMEN
In November 2019, stem nematode was found on Codonopsis pilosula in Tanchang county, Gansu province, China. The population of stem nematode was identified on the basis of both molecular and morphological methods. The morphological and morphometric characteristics of this nematode population matched with Ditylenchus destructor Thorne, 1945. The sequences of rDNA-ITS and D2/D3 region of 28S-rRNA similarity with the D. destructor. The pathogenicity results revealed the symptom of dry rot on C. pilosula was caused by this nematode. To our knowledge, this is the first report that D. destructor on C. pilosula in China.
RESUMEN
BACKGROUND AND AIMS: The lack of valid therapeutic approach that can ameliorate the manifestations of NASH is a barrier to therapeutic development. Therefore, we investigate the novel role of Methyl Palmitate (MP) in preventing NASH and the possible mechanism involved. METHODS: 50 Male C57BL/6 J mice were randomly divided into 5 groups (n = 10). The control group was fed control diet; model group was fed MCD diet; MP 1 group was fed MCD diet supplemented with MP (75 mg/kg/day); MP 2 group was fed MCD plus MP diet (150 mg/kg/day); and MP 3 group was fed MCD plus MP diet (300 mg/kg/day). Histological staining's, and commercially available kits for serum ALT and AST and hepatic contents of TG, TC, MDA, SOD, and GSH were used to assess NASH. Furthermore, relative liver protein and gene expression levels were determined by Western Blot and qPCR, respectively. RESULTS: Mice fed MCD diet developed NASH, which was markedly improved by MP in a dose-dependent manner. MP treatment improved hepatic content of TG, TC, MDA, SOD and GSH and serum levels of ALT and AST. In vivo studies showed that MP treatment activated PPARα expression, that in turns, promoted ß-oxidation protein and gene expressions, suppressed TNFα, MCP1, TGFß1 and Colla1 protein and gene expression levels, contributing to the prevention of NASH. CONCLUSIONS: Our results indicated that MP could successfully prevent NASH. This effect of MP was mediated through induction of PPARα pathway. This study provides a novel therapeutic target that plays pivotal role in the prevention of NASH.
Asunto(s)
Enfermedad del Hígado Graso no Alcohólico/metabolismo , Enfermedad del Hígado Graso no Alcohólico/prevención & control , PPAR alfa/biosíntesis , Palmitatos/uso terapéutico , Animales , Deficiencia de Colina/complicaciones , Deficiencia de Colina/metabolismo , Células Hep G2 , Humanos , Peroxidación de Lípido/efectos de los fármacos , Peroxidación de Lípido/fisiología , Masculino , Metionina/deficiencia , Ratones , Ratones Endogámicos C57BL , Enfermedad del Hígado Graso no Alcohólico/etiología , Palmitatos/farmacologíaRESUMEN
BACKGROUND: The potential benefits and possible risks associated with Xuebijing when combined with ulinastatin for sepsis treatment are not fully understood. METHODS: Databases, such as PubMed, Web of Science, CNKI, WanFang and VIP, were searched to collect randomized, controlled trials. Studies were screened, data were extracted, and the methodological quality was assessed by two reviewers independently. A meta-analysis was carried out with Stata 11.0 software. RESULTS: A total of 16 studies involving 1192 participants were enrolled for meta-analysis based on the inclusion and exclusion criteria. The results showed that compared with the group using routine therapies and the group using a single administration of either ulinastatin or Xuebijing, the trial group using Xuebijing combined with ulinastatin was significantly superior in the following aspects: mortality (RRâ¯=â¯0. 54,95% CI (0. 41, 0. 70, Pâ¯=â¯.000), 7â¯d APACHE II (SMDâ¯=â¯-1.21, 95%CI (-1.62, -0.80), Pâ¯=â¯.000), duration of mechanical ventilation (SMDâ¯=â¯-1.21, 95%CI (-1.62, -0.80), Pâ¯=â¯.000), average length of time in the intensive care unit (SMDâ¯=â¯-1.21, 95%CI (-1.62, -0.80), Pâ¯=â¯.000), incidence of multiple organ dysfunction syndromes (RRâ¯=â¯0. 54, 95% CI (0.41, 0. 70, Pâ¯=â¯.000), interleukin-6 (SMDâ¯=â¯-1.36,95%CI (-2.46, -0.27), Pâ¯=â¯.000), lipopolysaccharide (SMDâ¯=â¯-9.92, 95%CI (-11.7, -7.90), Pâ¯=â¯.006), and procalcitonin (SMDâ¯=â¯-0.30, 95%CI (-0.34, -0.26), Pâ¯=â¯.012). CONCLUSIONS: Our results found that Xuebijing when combined with ulinastatin was superior to both routine therapies and the single administration of either ulinastatin or Xuebijing. This finding provides a new therapeutic option for the treatment of sepsis.
Asunto(s)
Medicamentos Herbarios Chinos/uso terapéutico , Glicoproteínas/uso terapéutico , Sepsis/tratamiento farmacológico , Inhibidores de Tripsina/uso terapéutico , Quimioterapia Combinada , Medicamentos Herbarios Chinos/administración & dosificación , Glicoproteínas/administración & dosificación , Humanos , Inhibidores de Tripsina/administración & dosificaciónRESUMEN
We investigated the effects of ulinastatin on early postoperative cognitive dysfunction (POCD) after one-lung ventilation (OLV) surgery in elderly patients receiving neoadjuvant chemotherapy. Eighty elderly patients with preoperative neoadjuvant chemotherapy scheduling for radical esophagectomy under OLV were recruited. They were randomly divided into an ulinastatin pretreatment group (U group, n = 40) and a control group (C group, n = 40). The U group received 10,000 U/kg ulinastatin before anesthesia and 5000 U/kg daily on postoperative days 1 to 3, while C group received saline. Levels of interleukin (IL)-6, IL-10, C-reactive protein (CRP), and S-100ß protein were assayed before surgery, at the end of surgery, and on postoperative days 1 and 3. Patients underwent cognitive assessment 1 day before and 7 days after surgery. 38 patients in U group and 37 patients in C group completed the neuropsychological tests. The U group had a lower incidence of POCD than C group (23.7 % versus 45.9 %, P = 0.043). The levels of S-100ß protein, IL-6, IL-10, and CRP in both groups increased after surgery. The postoperative concentrations of S-100ß protein, IL-6, and CRP in U group were lower than those in C group. On postoperative day 3, compared with C group, the level of CRP in U group was lower, while that of IL-10 was higher. These findings demonstrate that ulinastatin can attenuate the elevation of S100ß protein levels and the incidence of POCD, most likely by the mechanism of reducing serum IL-6 and CRP levels and increasing IL-10 levels.
Asunto(s)
Trastornos del Conocimiento/tratamiento farmacológico , Trastornos del Conocimiento/etiología , Glicoproteínas/uso terapéutico , Inhibidores de Hidroximetilglutaril-CoA Reductasas/uso terapéutico , Terapia Neoadyuvante/efectos adversos , Ventilación Unipulmonar/efectos adversos , Complicaciones Posoperatorias/tratamiento farmacológico , Complicaciones Posoperatorias/etiología , Anciano , Anciano de 80 o más Años , Trastornos del Conocimiento/psicología , Citocinas/metabolismo , Esofagectomía/efectos adversos , Femenino , Humanos , Masculino , Pruebas Neuropsicológicas , Complicaciones Posoperatorias/psicología , Subunidad beta de la Proteína de Unión al Calcio S100/metabolismoRESUMEN
The protective effects of methionine against hyperthermia-induced damage in bovine mammary epithelial cells (BMEC) were studied. We have investigated the effects of methionine on proliferation, antioxidant activity, and apoptosis of the mammary epithelial cells of dairy cow after heat treatment. The structure of BMEC membrane was damaged by hyperthermia. Methionine (30 and 60 mg/L) efficiently increased cell viability and attenuated morphological damages in hyperthermia-treated BMEC. It significantly reduced lactate dehydrogenase leakage and malondialdehyde formation, whereas superoxide dismutase activity increased significantly. It also increased cell survival and decreased early apoptosis. Methionine therefore is cytoprotective on hyperthermia-induced damage in BMEC by increasing intracellular antioxidant levels and decreasing lipid peroxidation.
Asunto(s)
Células Epiteliales/fisiología , Glándulas Mamarias Animales/citología , Metionina/farmacología , Animales , Antioxidantes/farmacología , Apoptosis , Bovinos , Forma de la Célula , Supervivencia Celular/efectos de los fármacos , Células Cultivadas , Citoprotección , Células Epiteliales/efectos de los fármacos , Femenino , Hipertermia Inducida , L-Lactato Deshidrogenasa/metabolismo , Peroxidación de Lípido , Malondialdehído/metabolismo , Superóxido Dismutasa/metabolismoRESUMEN
OBJECTIVE: To study the relevant information on the label of health food in Changsha, and provide scientific evidence for health food hygienic supervision. METHODS: Investigation was conducted in department stores, supermarkets, pharmacies, and wholesale markets in the 5 districts in Changsha with multistage stratified sampling method. Self designed basic information of health food questionnaire was used to investigate the quality of labels the health food products. RESULTS: Among the 408 random samples, the unidentified rates of label items were ranked in descending order: functional components (49.8%), unsuited community (27.9%), manufacturing date (23.0%), approval number and others (9.6%). The qualified rates of labels were different in different management types (χ(2)=59.793, P<0.05): the highest rate was in supermarkets (71.15%), followed by pharmacies (70.07%), shopping malls (57.47%), and wholesale markets (26.23%). CONCLUSION: The supervision of label identities of health food should be strengthened, especially for the health food in the wholesale markets.
Asunto(s)
Suplementos Dietéticos , Etiquetado de Alimentos , Alimentos Orgánicos , China , Humanos , Muestreo , Encuestas y CuestionariosRESUMEN
Figure four of the Jiujing Tu (Illustration of Moxibustion) of the Dunhuang Caves is the earliest and the most complete recording of treatment for five kinds of strain and seven kinds of impairments in the history of acupuncture and moxibustion. Figure 12 is held as a mystery since it only provided illustrations without indications. Through analysis and approved by clinical experiences, it is held that the two figures are companion illustrations on prevention and treatment of five kinds of strain and seven kinds of impairments as well as health keeping with moxibustion. The point prescriptions in these two figures are defined according to the tri-gram in Yijing (The Book of Change), which allowed the maximization of harmony between the human and the nature. Recovery and health are thus fulfilled through regulation on points at the head, trunk and four extremities of the body. And it is considered to have great significance for promoting the development of the present acupuncture and moxibustion theory since it is effective in both preventing and curing diseases caused by deficient and stagnation conditions such as the wei (flaccidity) syndrome, bi (arthralgia) syndrome, paralysis, dementia, asthma and so on.
Asunto(s)
Puntos de Acupuntura , Acupuntura/historia , Medicina en la Literatura , Moxibustión/historia , Medicina Preventiva/historia , China , Historia Antigua , HumanosRESUMEN
OBJECTIVE: To evaluate the effect of Shugan Jianpi Granule (, SJG) on the number of gut mucosal serotonin-positive cells (5-HT+C) in patients with irritable bowel syndrome (IBS) of stagnated Gan-qi attacking Pi (SGAP) syndrome type. METHODS: Twenty-four patients were randomized equally into three groups. All were treated with the basic conventional treatment by cognition-behavior therapy with assistance of lactein 3 tablets thrice a day. Additionally, 24 g of SJG was given three times a day to group A, and the same dosage of SJG and Smecta 15 g thrice a day was given to group B, while no additional treatment was given to the control group. The number of 5-HT+C was measured respectively before and two weeks after treatment by immunohistochemical method. RESULTS: The number of 5-HT+C decreased after treatment in all the three groups (P<0.05), but the decrement was more significant in the two test groups than in the control group (P<0.05 and P<0.01, respectively), while comparison of 5-HT+C between the two test groups showed insignificant difference (P>0.05). CONCLUSION: SJG can reduce the number of 5-HT+C in IBS patients of SGAP syndrome type, and its effect is enhanced when used in combination with Smecta.