First Report of Epicoccum latusicollum Causing Leaf Blight on Curcuma kwangsiensis in China.

Curcuma kwangsiensis S. G. Lee et C. F. Liang is a traditional Chinese medicinal plant distributed in Guangxi and Yunnan Province, China. In May 2021, a leaf blight disease on C. kwangsiensi was observed in a plantation (~ 2 ha) in Lingshan county (21°51'00″N, 108°44'00″E), Guangxi Province. Disease incidence was up to 30% (n = 200). Initially, yellow to brown, irregular, water-soaked spots appeared at the tips or margins of leaves. As the disease progressed, the lesions gradually enlarged, merged. Finally, the entire leaf wilted, leading to defoliation. To isolate the pathogen, eighteen small pieces ( ~ 5 mm2) were cut from the margin of the necrotic lesions, surface disinfected with 1% NaOCl solution for 2 min, and rinsed three times in sterile water. Then the tissues were plated onto potato dextrose agar (PDA) and incubated for 3 days at 28°C. Hyphal tips from recently germinated spores were transferred to PDA to obtain pure cultures. Twelve isolates were obtained, of which ten isolates with similar morphological characterization. Two single-spore isolates (CK45.1 and CK45.2) were subjected to further morphological and molecular characterization. Colonies on PDA were villose, had a dense growth of aerial mycelia, and appeared white to grayish eventually. Pycnidia were brown, predominantly spheroidal, and 45.0 to 205.4 µm in diameter (n = 60). Conidia were ellipsoidal, aseptate, and 3.8 to 6.1 × 1.8 to 3.6 µm (n = 90). Morphological characteristics are similar to those of Epicoccum latusicollum (Chen et al. 2017).For molecular identification, primers ITS1/ITS4 (White et al. 1990), LR0R/LR5 (Vilgalys and Hester 1990, Rehner and Samuels 1994), RPB2-Ep-F (GGTCTTGTGTGCCCCGCTGAGAC)/RPB2-Ep-R TCGGGTGACATGACAATCATGGC), and TUB2-Ep-F (GTTCACCTTCAAACCGGTCAATG)/TUB2-Ep-R (AAGTTGTCGGGACGGAAGAGCTG) were used to amplify the internal transcribed spacer (ITS), partial nuclear large subunit rDNA (LSU), RNA polymerase II second largest subunit (rpb2), and ß-tubulin (tub2) genes, respectively. The obtained ITS (OP788080-81), LSU (OP811325-26), rpb2 (OP811267-68) and tub2 (OP811269-70) sequences showed 99.8% (478/479, and 478/479 bp), 99.9% (881/882, and 870/871 bp), 99.8 to 100% (429/431, and 429/430 bp), and 99.7% (332/333, and 332/333 bp) identity with those of ex-type strain E. latusicollum CGMCC 3.18346 (KY742101, KY742255, KY742174, KY742343). In addition, a phylogenetic analysis confirmed the isolates as E. latusicollum. Therefore, based on morphological and molecular characteristics, the isolates were identified as E. latusicollum. To verify pathogenicity, healthy leaves on nine plants (1 leaf per plant) were inoculated with mycelial discs from 5-day-old water-agar medium (WA) cultures of the strain CK45.1. Each leaf had four inoculation sites, two were inoculated with a representative strain, and two treated with pollution-free WA discs served as control. Plants were covered with transparent plastic bags and maintained in a greenhouse at 25°C with a 12 h photoperiod. Six days post-inoculation, the inoculated sites of leaves showed brown lesions, while the control remained healthy. The experiments repeated three times showed similar results. Koch's postulates were fulfilled by re-isolation of E. latusicollum from the lesions. To our knowledge, this is the first report of E. latusicollum causing leaf blight of C. kwangsiensi in China. This report might provide important information for growers to manage this disease.

Identification and expression analysis of PUB genes in tea plant exposed to anthracnose pathogen and drought stresses.

The plant U-box (PUB) gene family, one of the major ubiquitin ligase families in plants, plays important roles in multiple cellular processes including environmental stress responses and resistance. The function of U-box genes has been well characterized in Arabidopsis and other plants. However, little is known about the tea plant (Camellia sinensis) PUB genes. Here, 89 U-box proteins were identified from the chromosome-scale referenced genome of tea plant. According to the domain organization and phylogenetic analysis, the tea plant PUB family were classified into ten classes, named Class I to X, respectively. Using previously released stress-related RNA-seq data in tea plant, we identified 34 stress-inducible CsPUB genes. Specifically, eight CsPUB genes were expressed differentially under both anthracnose pathogen and drought stresses. Moreover, six of the eight CsPUBs were upregulated in response to these two stresses. Expression profiling performed by qRT-PCR was consistent with the RNA-seq analysis, and stress-related cis-acting elements were identified in the promoter regions of the six upregulated CsPUB genes. These results strongly implied the putative functions of U-box ligase genes in response to biotic and abiotic stresses in tea plant.

The Arabidopsis AGC kinases NDR2/4/5 interact with MOB1A/1B and play important roles in pollen development and germination.

Pollen formation and pollen tube growth are essential for the delivery of male gametes into the female embryo sac for double fertilization. Little is known about the mechanisms that regulate the late developmental process of pollen formation and pollen germination. In this study, we characterized a group of Arabidopsis AGC kinase proteins, NDR2/4/5, involved in pollen development and pollen germination. The NDR2/4/5 genes are mainly expressed in pollen grains at the late developmental stages and in pollen tubes. They function redundantly in pollen formation and pollen germination. At the tricellular stages, the ndr2 ndr4 ndr5 mutant pollen grains exhibit an abnormal accumulation of callose, precocious germination and burst in anthers, leading to a drastic reduction in fertilization and a reduced seed set. NDR2/4/5 proteins can interact with another group of proteins (MOB1A/1B) homologous to the MOB proteins from the Hippo signaling pathway in yeast and animals. The Arabidopsis mob1a mob1b mutant pollen grains also have a phenotype similar to that of ndr2 ndr4 ndr5 pollen grains. These results provide new evidence demonstrating that the Hippo signaling components are conserved in plants and play important roles in sexual plant reproduction.

ABORTED GAMETOPHYTE 1 is required for gametogenesis in Arabidopsis.

In flowering plants, the male and female gametogenesis is a crucial step of sexual reproduction. Although many genes have been identified as being involved in the gametogenesis process, the genetic mechanisms underlying gametogenesis remains poorly understood. We reported here characterization of the gene, ABORTED GAMETOPHYTE 1 (AOG1) that is newly identified as essential for gametogenesis in Arabidopsis thaliana. AOG1 is expressed predominantly in reproductive tissues including the developing pollen grains and ovules. The AOG1 protein shares no significant amino acid sequence similarity with other documented proteins and is located mainly in nuclei of the cells. Mutation in AOG1 caused degeneration of pollen at the uninucleate microspore stage and severe defect in embryo sacs, leading to a significant reduction in male and female fertility. Furthermore, the molecular analyses showed that the aog1 mutant significantly affected the expression of several genes, which are required for gametogenesis. Our results suggest that AOG1 plays important roles in gametogenesis at the stage prior to pollen mitosis I (PMI) in Arabidopsis, possibly through collaboration with other genes.

MALE GAMETOPHYTE DEFECTIVE 2, encoding a sialyltransferase-like protein, is required for normal pollen germination and pollen tube growth in Arabidopsis.

Sialyltransferases (SiaTs) exist widely in vertebrates and play important roles in a variety of biological processes. In plants, several genes have also been identified to encode the proteins that share homology with the vertebrate SiaTs. However, very little is known about their functions in plants. Here we report the identification and characterization of a novel Arabidopsis gene, MALE GAMETOPHYTE DEFECTIVE 2 (MGP2) that encodes a sialyltransferase-like protein. MGP2 was expressed in all tissues including pollen grains and pollen tubes. The MGP2 protein was targeted to Golgi apparatus. Knockout of MGP2 significantly inhibited the pollen germination and retarded pollen tube growth in vitro and in vivo, but did not affect female gametophytic functions. These results suggest that the sialyltransferase-like protein MGP2 is important for normal pollen germination and pollen tube growth, giving a novel insight into the biological roles of the sialyltransferase-like proteins in plants.