Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 41
Filtrar
Más filtros

Métodos Terapéuticos y Terapias MTCI
Bases de datos
País/Región como asunto
Tipo del documento
País de afiliación
Intervalo de año de publicación
1.
Fitoterapia ; 175: 105944, 2024 Jun.
Artículo en Inglés | MEDLINE | ID: mdl-38580033

RESUMEN

Chelidonium majus L. contained alkaloids as its main component, exhibiting various biological activities, particularly antibacterial activity. This study aimed to extract alkaloids from C. majus L. (total alkaloids) and evaluate their antibacterial activity both in vitro and in vivo. Reflux extraction was carried out on C. majus L., and the extract was purified with HPD-600 macroporous resin and 732 cation exchange resin columns. Infection modeling of Caenorhabditis elegans (C. elegans) was established to investigate the impact of Methicillin-resistant Staphylococcus aureus (MRSA) and Methicillin-sensitive Staphylococcus aureus (MSSA) on the motility, longevity, and reactive oxygen species (ROS) levels of wild-type worms (N2 strain). The effects of total alkaloids on longevity and ROS were further evaluated in infected N2 worms. Additionally, the effect of total alkaloids on the stress resistance of C. elegans and the mechanism of action were investigated. By utilizing CB1370, DR26 and CF1038 transgenic strains of C. elegans to identify whether the antibacterial activity of total alkaloids was dependent on DAF-2/DAF-16 pathway. The results showed that total alkaloids exhibited a significant antibacterial activity against both MRSA and MSSA (MIC 31.25 µg/mL). Compared with MSSA, the MRSA exhibited a stronger inhibitory effect on the movement behavior and development of worms, along with faster pathogenicity and unique virulence factors. Total alkaloids also displayed the ability to extend the lifespan of C. elegans under oxidative stress and heat stress, and reduce the expression of ROS. The antibacterial activity of total alkaloids was primarily dependent on the DAF-2/DAF-16 pathway, and the presence of functional DAF-2 was deemed essential in total alkaloids mediated immune response against MRSA. Moreover, the antibacterial and anti-infection effects of total alkaloids were found to be associated with the daf-16 gene fragment.


Asunto(s)
Alcaloides , Antibacterianos , Caenorhabditis elegans , Chelidonium , Staphylococcus aureus Resistente a Meticilina , Caenorhabditis elegans/efectos de los fármacos , Animales , Alcaloides/farmacología , Alcaloides/aislamiento & purificación , Staphylococcus aureus Resistente a Meticilina/efectos de los fármacos , Antibacterianos/farmacología , Antibacterianos/aislamiento & purificación , Chelidonium/química , Especies Reactivas de Oxígeno/metabolismo , Fitoquímicos/farmacología , Fitoquímicos/aislamiento & purificación , Longevidad/efectos de los fármacos , Proteínas de Caenorhabditis elegans , Extractos Vegetales/farmacología , Extractos Vegetales/química , Staphylococcus aureus/efectos de los fármacos , Pruebas de Sensibilidad Microbiana , Chelidonium majus
2.
Sci Rep ; 13(1): 11336, 2023 07 13.
Artículo en Inglés | MEDLINE | ID: mdl-37443174

RESUMEN

ACT001 is a novel sesquiterpene lactone derivative that has been shown to have significant antitumor and anti-inflammatory effects. However, the effect of ACT001 on nonalcoholic steatohepatitis (NASH) is unknown. Methionine and choline deficient (MCD) diet induced NASH model in C57BL/6J mice. Steatosis, inflammation and fibrosis-related indices of serum and liver tissues were detected by fully automated biochemical analyzer, enzyme-linked immunosorbent assay (ELISA) kit, flow cytometry, hematoxylin and eosin (H&E), Masson and immunohistochemical staining. The results showed that ACT001 reduced serum lipid and inflammatory factor levels, attenuated hepatic steatosis, inflammation and fibrosis, and inhibited hepatic oxidative stress and activation of NOD-like receptor protein 3 (NLRP3) inflammatory vesicles in NASH mice. In addition, 381 differentially expressed proteins (DEPs), including 162 up-regulated and 219 down-regulated proteins, were identified in the MCD group and ACT001 high-dose group using isotope labeling relative and absolute quantification (iTRAQ) technique analysis. Among these DEPs, five proteins associated with NAFLD were selected for real-time fluorescence quantitative PCR (RT-qPCR) validation, and the results were consistent with proteomics. In conclusion, ACT001 has a therapeutic effect on NASH, and the results of proteomic analysis will provide new ideas for the mechanism study of ACT001 for NASH treatment.


Asunto(s)
Enfermedad del Hígado Graso no Alcohólico , Ratones , Animales , Enfermedad del Hígado Graso no Alcohólico/patología , Marcaje Isotópico , Proteómica , Ratones Endogámicos C57BL , Hígado/metabolismo , Cirrosis Hepática/patología , Inflamación/patología , Colina/metabolismo , Metionina/metabolismo , Modelos Animales de Enfermedad
3.
J Ethnopharmacol ; 302(Pt A): 115858, 2023 Feb 10.
Artículo en Inglés | MEDLINE | ID: mdl-36341816

RESUMEN

ETHNOPHARMACOLOGICAL RELEVANCE: As a commonly used traditional Chinese herbal medicine, Erodii Herba Geranii Herba (Geranium wilfordii Maxim., Geranium carolinianum L. and Erodium stephanianum Willd.), which was known as Laoguancao (Chinese:), has high medicinal value. It has been used to dispel rheumatism, dredge the meridians, activate blood circulation, remove blood stasis, clear heat and detoxify, and stop diarrhea and dysentery. It's also used to treat eczema, sores, carbuncles, boils caused by accumulation of damp toxin. AIM OF THE REVIEW: This review aimed to provide a systematic and comprehensive analysis of the current research progress in terms of the botany, ethnopharmacology, phytochemistry and pharmacological activities of Erodii Herba Geranii Herba, and discuss expectations for prospective research and implementation about this herb. MATERIALS AND METHODS: Information on Erodii Herba Geranii Herba was gathered via the Internet (using Google Scholar, Baidu Scholar, Pubmed, Elsevier, ACS, Medline Plus, CNKI and Web of Science) and libraries. Additionally, information was also obtained from local books and brilliant scholars in ethnopharmacology. RESULTS: More than isolated 240 chemical compounds were recorded, and main compositions are tannins, flavones, organic acids and volatile oil. The pharmacoactives of Erodii Herba Geranii Herba and its active constituents are diverse, including antibacterial, antiviral, antioxidant, liver and kidney protection, anti-inflammatory and analgesic, other activities. Among them, the antibacterial, antiviral, anti-inflammatory, analgesic, antidiarrheal and other pharmacological activities of it are consistent with traditional applications. CONCLUSIONS: All kinds of research conducted on Erodii Herba Geranii Herba, especially in field of ethnopharmacological use, phytochemicals and pharmacology have been reviewed. There are plenty of active compounds with varied effects in Erodii Herba Geranii Herba. However, some traditional applications and pharmacological activities of Erodii Herba Geranii Herba have not been scientifically evaluated or convincing due to incomplete methods and ambiguous results, as well as the lack of clinical data. In order to verify the pharmacological activity, clinical efficacy and safety of it, a systematic and comprehensive research evaluation is also required. As an important traditional Chinese medicine, Erodii Herba Geranii Herba should be further explored to promote the development of new drugs and therapeutics for various diseases. How to make better use of it should be paid more attention to.


Asunto(s)
Botánica , Medicamentos Herbarios Chinos , Etnofarmacología , Estudios Prospectivos , Medicina Tradicional China/métodos , Fitoquímicos , Medicamentos Herbarios Chinos/uso terapéutico , Antivirales , Antibacterianos/uso terapéutico
4.
Front Pharmacol ; 13: 878631, 2022.
Artículo en Inglés | MEDLINE | ID: mdl-35784741

RESUMEN

Rehmanniae Radix (RR, the dried tuberous roots of Rehmannia glutinosa (Gaertn.) DC.) is an important traditional Chinese medicine distributed in Henan, Hebei, Inner Mongolia, and Northeast in China. RR is frequently used to treat diabetes mellitus, cardiovascular disease, osteoporosis and aging-related diseases in a class of prescriptions. The oligosaccharides and catalpol in RR have been confirmed to have neuroprotective effects. However, there are few studies on the anti-Alzheimer's disease (AD) effect of oligosaccharides in Rehmanniae Radix (ORR). The chemical components and pharmacological effects of dried Rehmannia Radix (DRR) and prepared Rehmannia Radix (PRR) are different because of the different processing methods. ORR has neuroprotective potential, such as improving learning and memory in rats. Therefore, this study aimed to prove the importance of oligosaccharides in DRR (ODRR) and PRR (OPRR) for AD based on the Caenorhabditis elegans (C. elegans) model and the different roles of ODRR and OPRR in the treatment of AD. In this study, we used paralysis assays, lifespan and stress resistance assays, bacterial growth curve, developmental and behavioral parameters, and ability of learning and memory to explore the effects of ODRR and OPRR on anti-AD and anti-aging. Furthermore, the accumulation of reactive oxygen species (ROS); deposition of Aß; and expression of amy-1, sir-2.1, daf-16, sod-3, skn-1, and hsp-16.2 were analyzed to confirm the efficacy of ODRR and OPRR. OPRR was more effective than ODRR in delaying the paralysis, improving learning ability, and prolonging the lifespan of C. elegans. Further mechanism studies showed that the accumulation of ROS, aggregation, and toxicity of Aß were reduced, suggesting that ORR alleviated Aß-induced toxicity, in part, through antioxidant activity and Aß aggregation inhibiting. The expression of amy-1 was downregulated, and sir-2.1, daf-16, sod-3, and hsp-16.2 were upregulated. Thus, ORR could have a possible therapeutic effect on AD by modulating the expression of amy-1, sir-2.1, daf-16, sod-3, and hsp-16.2. Furthermore, ORR promoted the nuclear localization of daf-16 and further increased the expression of sod-3 and hsp-16.2, which significantly contributed to inhibiting the Aß toxicity and enhancing oxidative stress resistance. In summary, the study provided a new idea for the development of ORR.

5.
Antioxidants (Basel) ; 11(3)2022 Mar 15.
Artículo en Inglés | MEDLINE | ID: mdl-35326202

RESUMEN

This study used 40 castrated male pigs to determine the protective effects of a new selenium molecule (hydroxy selenomethionine, OH-SeMet) on dietary oxidative stress (DOS) induced hepatic lipid metabolism disorder, and corresponding response of selenotranscriptome. The pigs were randomly grouped into 5 dietary treatments and fed a basal diet formulated with either normal corn and oils or oxidized diet in which the normal corn and oils were replaced by aged corn and oxidized oils, and supplemented with OH-SeMet at 0.0, 0.3, 0.6 and 0.9 mg Se/kg for a period of 16 weeks (n = 8). The results showed that DOS induced liver damage, increased serum alanine aminotransferase (ALT) and alkaline phosphatase (ALP) levels, decreased serum triacylglycerol (TG) level, suppressed antioxidant capacity in the liver, and changed lipid metabolism enzyme activity, thus causing lipid metabolism disorder in the liver. The DOS-induced lipid metabolism disorder was accompanied with endoplasmic reticulum (ER) stress, changes in lipid metabolism-related genes and selenotranscriptome in the liver. Dietary Se supplementation partially alleviated the negative impact of DOS on the lipid metabolism. These improvements were accompanied by increases in Se concentration, liver index, anti-oxidative capacity, selenotranscriptome especially 11 selenoprotein-encoding genes, and protein abundance of GPX1, GPX4 and SelS in the liver, as well as the decrease in SelF abundance. The Se supplementation also alleviated ER stress, restored liver lipid metabolism enzyme activity, increased the mRNA expression of lipid synthesis-related genes, and decreased the mRNA levels of lipidolysis-related genes. In conclusion, the dietary Se supplementation restored antioxidant capacity and mitigated ER stress induced by DOS, thus resisting hepatic lipid metabolism disorders that are associated with regulation of selenotranscriptome.

6.
Int J Biol Macromol ; 207: 169-178, 2022 May 15.
Artículo en Inglés | MEDLINE | ID: mdl-35257730

RESUMEN

The application of traditional Chinese medicine has a long history in China with unique advantages and functions. With the rapid development of separation and purification technologies, more and more polypeptide compounds with specific biological activity and medicinal value were isolated from natural plants. The plant polypeptides have a lot of biological activities, such as antitumor effect, antioxidize effect, antibacterial effect, hypoglycemic effect, blood pressure lowering effect, lipid-lowering effect, anti-fatigue effect, and so on. This review summarized the extraction method, purification method, biological activities, and prospects of plant polypeptides, providing a basis for further study of plant polypeptides.


Asunto(s)
Hipoglucemiantes , Medicina Tradicional China , Antibacterianos/química , China , Hipoglucemiantes/química , Hipoglucemiantes/farmacología , Hipoglucemiantes/uso terapéutico , Medicina Tradicional China/métodos , Péptidos/farmacología , Extractos Vegetales/química
7.
Plant Dis ; 2022 Jan 24.
Artículo en Inglés | MEDLINE | ID: mdl-35072496

RESUMEN

Bupleurum chinensis is an important traditional medicine with anti-inflammatory and immunomodulatory effects in China (Navarro et al. 2001). So far, the diseases reported on B. chinensis were caused by fungi (rust and root rot) and virus (Cucumber mosaic virus and Broad bean wilt virus 2) (Zhang et al. 2009). However, no diseases caused by nematodes were reported previously. Root-knot nematodes (Meloidogyne spp.) are one of the most destructive plant-parasitic nematodes with strong adaptability and diversity, infecting more than 5,500 plant species (Azevedo de Oliveira et al. 2018). In October 2020, symptoms of dwarf, leaf yellowing and roots with numerous knots on B. chinensis in several fields were observed in Dingxi City, Gansu Province, Northwest China (N 35°19'42″; E 104°2'24″). Subsequently, hundreds of eggs, mature males and females were exuded from dissection of washed root-knots. Morphological characteristics of females, males and J2s were examined under the optical microscope. The perineal patterns of females (n=15) were oval-shaped with a slightly dorsal arches, and the lateral lines and punctations on anus were observed in some specimens. Measurements (mean ± SD, range) of females(n=20): L (body length) = (525.23 ± 59.88 µm, 439.72 to 659.93 µm), W (maximum body width) = (403.92 ± 57.17 µm, 311.01 to 513.34 µm), St (stylet length) = (11.28 ± 1.05 µm, 9.82 to 12.91 µm), MBW (width of the median bulb) = (31.13 ± 3.32 µm, 23.66 to 35.55 µm), MB (distance from anterior end to center of median oesophageal bulb valve) = (64.45 ± 3.44 µm, 58,62 to 71.92 µm), and DGO (dorsal gland orifice to stylet) = (3.79 ± 0.60 µm, 2.72 to 5.00 µm). Male (n=20): L= (1038.25 ± 90.34 µm, 877.28 to 1206.12 µm), St= (18.13 ± 1.48 µm, 15.10 to 20.12 µm), a (body length divided by greatest body width) = (31.77 ± 4.03 µm, 23.29 to 41.16µm), MBW= (10.97 ± 0.78 µm, 9.05 to 12.31 µm), MB= (64.81 ± 3.45 µm, 59.59 to 71.38 µm), DGO= (4.05 ± 0.47 µm, 3.11 to 5.08 µm), and Spic (spicule length) = (22.57 ± 1.91 µm, 19.26 to 26.43 µm). J2 (n=25): L= (381.73 ± 25.85µm, 336.96 to 419.98 µm), St= (10.52 ± 1.03 µm, 9.15 to 12.14 µm), a= (24.35 ± 2.10 µm, 20.45 to 28.29 µm), DGO= (3.02 ± 0.42 µm, 2.42 to 3.79 µm), c (body length divided by tail length) = (8.90 ± 0.86 µm, 7.71 to 10.48 µm), and c' (tail length divided by body width at anus) = (4.18 ± 0.50 µm, 3.47 to 5.04 µm). According to morphological characteristics, root-knot nematode infecting B. chinensis was preliminarily identified as Meloidogyne hapla Chitwood, 1949 (Whitehead 1968). To further verify this result, DNA was extracted from ten individual females, the ITS region and the D2-D3 region of 28S rDNA were amplified using the primer TW81/AB28(GTTTCCGTAGGTGAACCTGC/ ATATGCTTAAGTTCAGCGGGT) (Subbotin et al. 2000) D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/ TCGGAAGGAACCAGCTACTA) (De Ley et al. 1999), respectively. PCR products were purified and sequenced. The sizes of ITS region and D2-D3 region of 28S rDNA were 557 bp and 762 bp, respectively. The sequence of ITS region (GenBank accession number: OK030559) was 99.46%-99.82% identical to the M. hapla from China (MT490918), New Zealand (JX465560), Australia (AF516722) and Japan (LC030357). The sequence of D2-D3 region of 28S rDNA (GenBank accession number: OK030558) was 99.58%-100.00% identical to the M. hapla from Canada (MW182329), Ethiopia (KJ645432), USA (KP901086) and China (MN446015). Furthermore, fragments obtained using the specific primers of M. hapla (Mh-F/Mh-R) were 462 bp, which also was consistent with that of M. hapla (Feng et al. 2008). Through morpho-molecular characterization, the root-knot nematodes on B. chinensis in China were identified as M. hapla. Six seedlings of B. chinensis were planted in 16 cm diameter, 20 cm deep plastic pots with sterilized soil in the greenhouse at 20-25℃ for pathogenicity test. After planted 21 days, 2000 J2s/pot were inoculated, six seedling uninoculated were used as control. After 90 days, all inoculated plants showed similar symptoms observed in the field, and nematode reproduction factor (final population density/initial population density) was 1.47. Meanwhile, no symptoms were observed on control plants. These results proved that the nematode infecting B. chinensis is M. hapla. To our knowledge, this is the first report of B. chinensis as a new host of M. hapla in China. Bupleurum chinensis is widely planted in Gansu Province, the plant species cultivated across an area of about 19.1 million hectares, accounting for 40% of the China's total output (Wang et al. 2017). The root system of B. chinensis infected M. hapla is stunned and short, seriously affect the quality of medicinal materials, and restrict the development of the local Chinese herbal medicine industry.

8.
Antioxidants (Basel) ; 10(10)2021 Sep 29.
Artículo en Inglés | MEDLINE | ID: mdl-34679693

RESUMEN

Chronic heat stress (CHS) induces metabolic changes in skeletal muscle from growth to maintenance that jeopardizes growth performance, carcass traits, and meat quality of pigs. We investigated the protective effect of dietary organic selenium (hydroxy-4-methylselenobutanoic acid, OH-SeMet) on CHS-induced skeletal muscle damages of growing pigs, and the corresponding responses of selenoproteins. A total of 40 ((Landrace ×Yorkshire) × Duroc) pigs with an average live weight of 49.64 ± 2.48 kg were used in this 4-week trial. Pigs were randomly allotted to 5 groups: The control group was raised on a basal diet in a thermoneutral environment (22 ± 2 °C); and four CHS groups were raised on a basal diet and supplemented with Se 0.0, 0.2, 0.4, and 0.6 mg/kg as OH-SeMet, respectively, in hyperthermal condition (33 ± 2 °C). CHS resulted in significant decrease of growth performance, carcass traits, and meat quality, which were associated with reduced (p < 0.05) serum alkaline phosphatase (ALP) and total superoxide dismutase (T-SOD) and increased (p < 0.05) serum creatine (CK), sarcous heat shock protein 70 (HSP70), glucokinase (GCK), phosphoenolpyruvate carboxykinase (PEPCK), and malondialdehyde (MDA) contents. Meanwhile, four metabolism-related genes and seven selenoprotein encoding genes were abnormally expressed in skeletal muscle. Dietary OH-SeMet addition partially alleviated the negative impact of CHS on carcass traits and improved meat quality. These improvements were accompanied by the increase in Se deposition, the anti-oxidative capacity of serum and muscle, and protein abundance of GPX1, GPX3, GPX4, and SELENOP. Supplementation with 0.6 mg Se/kg (OH-SeMet) restored the sarcous PEPCK, and 0.4 and 0.6 mg Se/kg (OH-SeMet) restored all abnormally expressed metabolism-related and selenoprotein encoding genes. In summary, dietary supplementation with OH-SeMet beyond Se requirement mitigated CHS-induced depression of carcass traits and meat quality of pigs associated with optimal skeletal metabolism, enhanced antioxidant capacity, and regulation of selenoproteins in skeletal muscle of pigs.

9.
Biomed Pharmacother ; 141: 111876, 2021 Sep.
Artículo en Inglés | MEDLINE | ID: mdl-34328085

RESUMEN

Gastric cancer (GC) is one of the most common malignancies and has the second highest lethal rate in the world; thus, finding new medicines with high potency and low toxicity is urgent. Cudrania tricuspidata (Carr.) Bur. ex Lavallee (Moraceae) is a traditional medicinal herb that is considered to have antitumour efficacy. We extracted and isolated cudraxanthone L (CXL) from Cudrania tricuspidata and evaluated its anti-cancer efficacy. CXL treatment inhibited angiogenesis of chorioallantoic membrane (CAM) and repressed the cell viability of various human cancer cells, indicating it presented the antitumour potential. Among them, CXL presented the best inhibitory effects on MGC803 cells. In addition, the invasion, migration and clonogenicity were significantly repressed, S phase of the cell cycle was arrested, and apoptosis was induced when MGC803 cells were treated with CXL. The results of RNA sequencing, qRT-PCR and western blotting verified that CXL regulated the MAPK signalling pathway and induced apoptosis by FAS-mediated pathway. The in vivo data revealed that CXL arrested tumour growth without toxic effects and upregulated the protein levels in FAS-mediated pathway in MGC803 gastric cancer-bearing mice. In summary, we demonstrate CXL presents impactful anti-GC efficacy by regulating the MAPK signalling pathway and promoting the FAS-mediated pathway.


Asunto(s)
Antineoplásicos Fitogénicos/uso terapéutico , Sistema de Señalización de MAP Quinasas/efectos de los fármacos , Neoplasias Gástricas/tratamiento farmacológico , Neoplasias Gástricas/metabolismo , Xantonas/uso terapéutico , Receptor fas/metabolismo , Animales , Antineoplásicos Fitogénicos/aislamiento & purificación , Antineoplásicos Fitogénicos/farmacología , Supervivencia Celular/efectos de los fármacos , Supervivencia Celular/fisiología , Relación Dosis-Respuesta a Droga , Células Hep G2 , Humanos , Sistema de Señalización de MAP Quinasas/fisiología , Masculino , Ratones , Ratones Endogámicos BALB C , Ratones Desnudos , Moraceae , Neoplasias Gástricas/patología , Xantonas/aislamiento & purificación , Xantonas/farmacología , Ensayos Antitumor por Modelo de Xenoinjerto/métodos
10.
BMC Complement Med Ther ; 20(1): 256, 2020 Aug 17.
Artículo en Inglés | MEDLINE | ID: mdl-32807143

RESUMEN

BACKGROUND: Peganum harmala L. is a medicinal herb extensively used in traditional Chinese medicine (TCM). So far, relevant reports on the toxicity of Peganum harmala L. seeds (PHS) are hardly available. Especially, we still know little about the in vivo mechanism for PHS toxicity. This study aims to evaluate the toxicity effects of PHS in Caenorhabditis elegans (C. elegans), investigate the possible mechanism of the toxicity effects of PHS, and provide reference for the pharmacological research of PHS. METHODS: In the present study, the C. elegans was exposed to 0.25, 0.50, 1.00 mg/mL of PHS in nematode growth medium (NGM) at 22 °C in the presence of food. Lethality, lifespan, growth, reproduction, and locomotion behavior assays were performed to evaluate the toxicity effects of PHS in C. elegans. We then determined the mechanism of the toxicity effect of PHS by quantitative real-time polymerase chain reaction (qRT-PCR), acetylcholinesterase (AChE) activity assay, and oxidative stress resistance assays. The main components of PHS were detected by high performance liquid chromatography (HPLC). RESULTS: Compared with the control group, the lethality of C. elegans was significantly increased when they were exposed to the ethanol extract of PHS at 0.25, 0.50 and 1.00 mg/mL (P < 0.01), and the mean lifespan was significantly decreased (P < 0.01). We also observed that PHS exposure could induce the toxicity on body length, brood size, and locomotion behavior. CONCLUSION: Our study shows that the ethanol extract of PHS exerts obvious toxic effects on C. elegans, which would provide new ideas and methods for the biological evaluation of the toxicity of Chinese medicinal materials.


Asunto(s)
Caenorhabditis elegans , Peganum/toxicidad , Extractos Vegetales/toxicidad , Plantas Medicinales/toxicidad , Animales , China , Semillas
11.
Artículo en Inglés | MEDLINE | ID: mdl-32724322

RESUMEN

BACKGROUND/AIM: Curcumin exhibits anticancer effects against various types of cancer including hepatocellular carcinoma (HCC). miR-21 has been reported to be involved in the malignant biological properties of HCC. However, whether miR-21 plays a role in curcumin-mediated treatment of HCC is unknown. The purpose of this study was to identify the potential functions and mechanisms of miR-21 in curcumin-mediated treatment of HCC. METHODS: The anticancer effects of curcumin were assessed in vivo and in vitro. The underlying mechanism of miR-21 in curcumin-mediated treatment of HCC was assessed by quantitative real-time PCR (RT-qPCR), western blot, and Dual-Luciferase Reporter assays. RESULTS: The present study revealed that curcumin suppressed HCC growth in vivo and inhibited HCC cell proliferation and induced cell apoptosis in a dose-dependent manner in vitro. Meanwhile, the curcumin treatment can downregulate miR-21 expression, upregulate TIMP3 expression, and inhibit the TGF-ß1/smad3 signaling pathway. miR-21 inhibition enhanced the effect of curcumin on cell proliferation inhibition, apoptosis, and TGF-ß1/smad3 signaling pathway inhibition in HepG2 and HCCLM3 cells. It demonstrated that TIMP3 was a direct target gene of miR-21. Interestingly, the effect of miR-21 inhibition on cell proliferation, apoptosis, and TGF-ß1/smad3 signaling pathway in HepG2 and HCCLM3 cells exposed to curcumin was attenuated by TIMP3 silencing. CONCLUSION: Taken together, the present study suggests that miR-21 is involved in the anticancer activities of curcumin through targeting TIMP3, and the mechanism possibly refers to the inhibition of TGF-ß1/smad3 signaling pathway.

12.
Artículo en Inglés | MEDLINE | ID: mdl-32454864

RESUMEN

OBJECTIVE: The present study was designed to evaluate the neuroprotective effects of D-(-)-quinic acid on aluminum chloride- (AlCl3-) induced neurobehavioral and biochemical changes in rats. This study showed the behavioral and biochemical effects of D-(-)-quinic acid on rats with particular emphasis on the hippocampus and frontal cortex which are associated with memory. MATERIALS AND METHODS: Chronic administration of aluminum chloride at a dose of 175 mg/kg, p.o. for a period of 25 days markedly increased the level of acetylcholinesterase (AChE) activity and reduced the levels of antioxidant enzymes in the brain. Two doses of D-(-)-quinic acid (200 mg/kg and 400 mg/kg) were selected based on previous safety/toxicity studies and administered orally from the 26th day to the 36th day of the trial. Behavioral parameters were assessed using the Morris water maze test and an actophotometer in rats. Biochemical parameter content and histology of brain tissue were assessed on the final day of the experiment. RESULTS: D-(-)-Quinic acid (200 mg/kg and 400 mg/kg) orally administered alongside AlCl3 rescued AChE activity and the behavioral impairments caused by aluminum. There was significant inhibition of MAO-B in D-(-)-quinic acid-treated rats. Histopathological studies in the hippocampus and cortex of the rat brain also supported that D-(-)-quinic acid markedly reduced the toxicity of AlCl3 and preserved the normal histoarchitecture pattern of the hippocampus and cortex. These results indicate that D-(-)-quinic acid can reverse memory loss caused by aluminum intoxication by attenuating AChE activity and rescuing the deleterious effect of AlCl3.

13.
J Nematol ; 522020.
Artículo en Inglés | MEDLINE | ID: mdl-33829198

RESUMEN

In November 2019, stem nematode was found on Codonopsis pilosula in Tanchang county, Gansu province, China. The population of stem nematode was identified on the basis of both molecular and morphological methods. The morphological and morphometric characteristics of this nematode population matched with Ditylenchus destructor Thorne, 1945. The sequences of rDNA-ITS and D2/D3 region of 28S-rRNA similarity with the D. destructor. The pathogenicity results revealed the symptom of dry rot on C. pilosula was caused by this nematode. To our knowledge, this is the first report that D. destructor on C. pilosula in China.

14.
Biomed Pharmacother ; 120: 109470, 2019 Dec.
Artículo en Inglés | MEDLINE | ID: mdl-31590124

RESUMEN

Fufang Xueshuantong (FXST), a Chinese patent medicine, is composed of Panax notoginseng, Salviae miltiorrhizae, Astragali Radix and Radix Scrophulariae and has been found to prevent diabetic retinopathy. Yes-associated protein (YAP) participates in the pathophysiology of retinal disease and promotes endothelial cell proliferation and angiogenesis. Although it is known that YAP activity is altered by FXST, the role of YAP in mediating the effect of FXST remains unclear. In high glucose-treated retinal vascular endothelial cells (RVECs), FXST significantly reduced cell viability, the number of migrating cells and tube length in the present study. Moreover, FXST decreased the levels of YAP mRNA and protein and inhibited the expression of vascular endothelial growth factor (VEGF). Transfection of sh-YAP into the cells decreased the ability of FXST to modulate cell migration and tube formation. The effect of FXST on VEGF expression was also decreased. Similar results were obtained when the cells were stimulated with a YAP inhibitor in combination with FXST. Thus, FXST is shown to protect high glucose-injured RVECs via YAP-mediated effects.


Asunto(s)
Medicamentos Herbarios Chinos/farmacología , Células Endoteliales/efectos de los fármacos , Glucosa/metabolismo , Sustancias Protectoras/farmacología , Retina/efectos de los fármacos , Vasos Retinianos/efectos de los fármacos , Factores de Transcripción/metabolismo , Animales , Línea Celular , Movimiento Celular/efectos de los fármacos , Proliferación Celular/efectos de los fármacos , Retinopatía Diabética/metabolismo , Células Endoteliales/metabolismo , Haplorrinos , Retina/metabolismo , Vasos Retinianos/metabolismo , Factor A de Crecimiento Endotelial Vascular/metabolismo
15.
J Ethnopharmacol ; 240: 111954, 2019 Aug 10.
Artículo en Inglés | MEDLINE | ID: mdl-31085225

RESUMEN

ETHNOPHARMACOLOGICAL RELEVANCE: Radix trichosanthis (RT) is a popular plant in China to treat diabetes. AIM OF THE STUDY: The aim of this study is to investigate the therapeutic effect of different extracts of RT and explore the underlying mechanism. METHODS: Ethyl acetate extracts of radix trichosanthis (ERT), methanol extracts of radix trichosanthis (MRT) and water extracts of radix trichosanthis (WRT) were prepared. The retinal vascular endothelial cells (RVEC) were stimulated with high glucose or high glucose plus different extracts of RT. Then, cell viability, Transwell assay, tube formation and BrdU assay were measured. In the end, the Hippo and Notch signaling pathways were evaluated to clarify the pharmacological mechanism. RESULTS: The results indicated that ERT exhibited the best efficacy. It significantly inhibited cell viability, blocked cell migration, attenuated tube formation and reduced the ratio of proliferated cells. It also adjusted the Hippo and Notch signaling pathways. CONCLUSIONS: ERT suppressed high glucose-induced injury in REVC by regulating the Hippo and Notch signaling pathways.


Asunto(s)
Medicamentos Herbarios Chinos/farmacología , Células Endoteliales/efectos de los fármacos , Glucosa/toxicidad , Sustancias Protectoras/farmacología , Acetatos/química , Animales , Línea Celular , Supervivencia Celular/efectos de los fármacos , Células Endoteliales/metabolismo , Macaca mulatta , Proteínas Serina-Treonina Quinasas/metabolismo , Receptores Notch/genética , Receptores Notch/metabolismo , Retina/citología , Transducción de Señal/efectos de los fármacos , Solventes/química
16.
Complement Ther Med ; 43: 208-217, 2019 Apr.
Artículo en Inglés | MEDLINE | ID: mdl-30935533

RESUMEN

OBJECTIVE: The severity of angina pectoris has been recognized. It is believed that Chinese herbal injections have an outstanding clinical effect on this condition. This network meta-analysis was devised to investigate the comparative efficacy of eight Chinese herbal injections (Ciwujia injection, Dazhuhongjingtan injection, Huangqi injection, Shenfu injection, Shengmai injection, Shenmai injection, Shenqi Fuzheng injection, Yiqifumai injection) in the treatment of angina pectoris. METHODS: A literature search was performed in PubMed, Embase, and the Cochrane Library, Chinese Biological Medicine Database, China National Knowledge Infrastructure, Wanfang Database, and Chinese Scientific Journal Database from their inception to June 25, 2018. A pre-designed eligibility criterion was utilized in this network meta-analysis, and a methodological quality analysis was conducted. Data analysis was performed by WinGUGS 1.4.3, Stata 13.0 and TSA software, and the odds ratio or mean difference with the 95% credible interval was reported for symptomatic improvement, electrocardiography improvement, fibrinogen, triglyceride and cholesterol. The ranking probability of interventions in various outcomes was also utilized. RESULTS: A total of 73 randomized controlled trials with 6639 patients were identified. Integrating network meta-analysis results, Shenqi Fuzheng injection plus western medicine therapy and Shenmai injection plus western medicine therapy were shown to be more efficacious than other therapies. In addition, Huangqi injection plus western medicine therapy and Shenmai injection plus western medicine therapy performed well in improving the haemorheology index and serum lipid parameters. CONCLUSIONS: Eligible Chinese herbal injections plus western medicine therapy might have a better impact on angina pectoris patients than western medicine therapy alone. While this study had limitations, the findings should be interpreted with caution. In addition, more high-quality randomized controlled trials with a large sample must be conducted to support this study.


Asunto(s)
Angina de Pecho/tratamiento farmacológico , Medicamentos Herbarios Chinos/administración & dosificación , Teorema de Bayes , China , Humanos , Inyecciones , Metaanálisis en Red , Ensayos Clínicos Controlados Aleatorios como Asunto
17.
Zhongguo Zhong Yao Za Zhi ; 42(20): 3932-3937, 2017 Oct.
Artículo en Chino | MEDLINE | ID: mdl-29243430

RESUMEN

Components that systematic separated from the root of Anaycclus pyrethrum were identified, in order to lay a foundation for future study of the root of A. pyrethrum. The CCK-8 assay showed that dichloromethane fraction exhibited the highest degree of cytotoxicity than others. Ten monomeric components were obtained from dichloromethane fraction and ethyl acetate fraction extracted from the root of A. pyrethrum, including 7 N-alkylamides, one coumarin and two flavonoid glycosides. They were identified as tetradeca-2E,4E,8E-trienoic acid 4-hydroxyphenylethylamide(1), deca-2E,4E-dienoicacid isobutylamide(2), undeca-2E,4E-diene-8,10-diynoic acid phenylethylamide(3), tetradeca-2E,4E-dienoic acid 4-hydroxyphenylethylamide(4), tetradeca-2E,4E-diene-8,10-diynoic acid isobutylamide(5), deca-2E,4E- dienoic acid 4-hydroxyphenylethylamide(6), dodeca-2E,4E-dienoic acid 4-hydroxy -phenyl-ethylamide(7), isoscopoletin(8), quercetin-7-O-ß-D-glucopyranoside(9), isorhamnetin-7-O-ß-D-glucopyranoside(10). Among them, compound 1 was identified as a new compound, Compounds 2-4, 8-10 were isolated from this herb for the first time.


Asunto(s)
Antineoplásicos Fitogénicos/farmacología , Asteraceae/química , Extractos Vegetales/farmacología , Raíces de Plantas/química , Amidas/química , Antineoplásicos Fitogénicos/química , Línea Celular Tumoral , Cumarinas/química , Flavonoides/química , Glicósidos/química , Humanos , Extractos Vegetales/química
18.
J Ethnopharmacol ; 202: 162-171, 2017 Apr 18.
Artículo en Inglés | MEDLINE | ID: mdl-28315720

RESUMEN

ETHNOPHARMACOLOGICAL RELEVANCE: Euonymus alatus, Radix trichosanthis, Panax notoginseng and Coptis chinensis are popular plants used in traditional Chinese medicine to treat diabetes. AIM OF THE STUDY: The aim of the study is to investigate the therapeutic effect of the active components of Euonymus alatus, Radix trichosanthis, Panax notoginseng and Coptis chinensis (cERPC) on diabetic peripheral neuropathy in the rats and explore the underlying mechanism involved. METHODS: After diabetes was induced in rats for 20 weeks, cERPC or water was administered for 12 weeks. After a hot plate test, motor nerve conduction velocity and sciatic nerve blood flow were determined; the sciatic nerves were isolated for toluidine blue staining; and the fibre area, fibre diameter, axon area, axon diameter and myelin thickness were evaluated. The levels of the myelin basic protein, myelin protein zero, Oct6 and Krox20 were measured by western blot or immunofluorescence. RESULTS: cERPC was efficient in reducing the response latency, increasing motor nerve conduction velocity, enhancing sciatic nerve blood flow and ameliorating the pathological changes in diabetic rats. cERPC also had a role in increasing the levels of myelin basic protein and myelin protein zero and improving the expression of Oct6 and Krox20 in sciatic nerves of diabetic rats. CONCLUSIONS: cERPC ameliorates diabetic peripheral neuropathy by attenuating electrophysiological, circulatory and morphological alterations, which is mediated by the Oct6-Krox20 pathway.


Asunto(s)
Neuropatías Diabéticas/prevención & control , Medicamentos Herbarios Chinos/uso terapéutico , Sustancias Protectoras/uso terapéutico , Animales , Axones/efectos de los fármacos , Axones/patología , Axones/ultraestructura , Diabetes Mellitus Experimental/tratamiento farmacológico , Neuropatías Diabéticas/patología , Masculino , Neuronas Motoras/efectos de los fármacos , Proteínas de la Mielina/metabolismo , Vaina de Mielina/efectos de los fármacos , Vaina de Mielina/patología , Vaina de Mielina/ultraestructura , Conducción Nerviosa/efectos de los fármacos , Dimensión del Dolor/efectos de los fármacos , Ratas , Ratas Sprague-Dawley , Flujo Sanguíneo Regional/efectos de los fármacos , Nervio Ciático/irrigación sanguínea
19.
Molecules ; 21(11)2016 Nov 09.
Artículo en Inglés | MEDLINE | ID: mdl-27834877

RESUMEN

Fuzi has been used to treat diabetic complications for many years in china. In a previous study, we have shown that Fuzi aqueous extract can attenuate Diabetic peripheral neuropathy (DPN) in rats and protect Schwann cells from injury. Thus, the protective effect of Fuzi polysaccharides (FPS) on high glucose-induced SCs and the preliminary mechanism were investigated. Firstly, the FPS were obtained and their monose composition was analyzed by the combination of pre-column derivatization and high performance liquid chromatography coupled with electrospray ionization multi-tandem mass spectrometry (HPLC/ESI-MSn). The results witnessed the efficiency of this method and seven monosaccharides were tentatively identified, among which fucose was first reported. Simultaneously, m/z 215 can be considered as diagnostic ions to confirm the number of monosaccharides. Next, high glucose-induced SC model was applied and divided into model group, treated group of FPS, normal and osmotic control group. After treatment for 48 h, the data showed FPS could significantly decrease the intracellular ROS and apoptosis, which were determined by the corresponding fluorescent probes. Then, the expression of oxidative stress-related proteins in SCs were measured by Western blot. Furthermore, the protein tests found that FPS markedly up-regulated superoxide dismutase (SOD), catalase (CAT) and peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC-1α) protein level, but down-regulated NADPH oxidase-1 (Nox1) protein level. Moreover, FPS could also increase AMP-activated protein kinase (AMPK) activation significantly. Hence, we preliminary deduced that AMPK-PGC-1α pathway may play an important role in the protective effect of FPS against high glucose-induced cell damage.


Asunto(s)
Neuropatías Diabéticas/tratamiento farmacológico , Glucosa/metabolismo , Polisacáridos , Células de Schwann/metabolismo , Animales , Conformación de Carbohidratos , Línea Celular , Cromatografía Líquida de Alta Presión , Neuropatías Diabéticas/metabolismo , Neuropatías Diabéticas/patología , Diterpenos , Medicamentos Herbarios Chinos , Espectrometría de Masas , Estrés Oxidativo/efectos de los fármacos , Oxidorreductasas/biosíntesis , Coactivador 1-alfa del Receptor Activado por Proliferadores de Peroxisomas gamma/biosíntesis , Extractos Vegetales/química , Extractos Vegetales/farmacología , Polisacáridos/química , Polisacáridos/farmacología , Ratas , Especies Reactivas de Oxígeno/metabolismo , Células de Schwann/patología
20.
Pharmacogn Mag ; 12(45): 4-8, 2016.
Artículo en Inglés | MEDLINE | ID: mdl-27019554

RESUMEN

BACKGROUND: Crude radix Aconitum kusnezoffii (RAK) has great toxicity. Traditional Chinese medicine practice proved that processing may decrease its toxicity. In our previous study, we had established a new method of RAK processing (Paozhi). However, the mechanism is yet not perfect. OBJECTIVE: To explore the related mechanism of processing through comparing the chemical contents. MATERIALS AND METHODS: A new processing method of RAK named stoving (Hong Zhi) was used. In particular, RAK was stored at 110°C for 8 h, and then high performance liquid chromatography combined with electrospray ionization tandem mass spectrometry (HPLC-ESI-MS(n)) was developed for the detection of the alkaloids of the crude and processed RAK decoction pieces. RESULTS: Thirty components of the crude RAK were discovered, among which, 23 alkaloids were identified. Meanwhile, 23 ingredients were detected in the processed RAK decoction pieces, among which, 20 alkaloids were determined yet. By comparison, eight alkaloids were found in both crude and processed RAK decoction pieces, 15 alkaloids were not found in the crude RAK, however, 10 new constituents yield after processing, which are 10-OH-hypaconine, 10-OH-mesaconine, isomer of bullatine A, 14-benzoyl-10-OH-mesaconine, 14-benzoyl-10-OH-aconine, 14-benzoyl-10-OH-hypaconine, dehydrated aconitine, 14-benzoylaconine, chuanfumine, dehydrated mesaconitine. CONCLUSION: The present study showed that significant change of alkaloids was detected in RAK before and after processing. Among them, the highly toxic diester alkaloids decreased and the less toxic monoester alkaloids increased. Moreover, the concentration changes significantly. HPLC-ESI-MS(n) are Efficient to elaborate the mechanism of reduction of toxicity and enhancement efficacy after processing. SUMMARY: Stoving is a simple and effective method for the processing of radix Aconitum kusnezoffii.In the positive mode, the characteristic fragmentations of Aconitum alkaloids were obtained.The highly toxic alkaloids have decreased, and the new constituents appeared, which has explained successfully the processing mechanism of radix Aconitum kusnezoffii in chemistry.

SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA