Yin Yang 1 expression predicts a favourable survival in diffuse large B-cell lymphoma.

Aims: Yin Yang 1 (YY1) is a multifunctional transcription factor that plays an important role in tumour development and progression, while its clinical significance in diffuse large B-cell lymphoma (DLBCL) remains largely unexplored. This study aimed to investigate the expression and clinical implications of YY1 in DLBCL. Methods: YY1 expression in 198 cases of DLBCL was determined using immunohistochemistry. The correlation between YY1 expression and clinicopathological parameters as well as the overall survival (OS) and progression-free survival (PFS) of patients was analyzed. Results: YY1 protein expression was observed in 121 out of 198 (61.1 %) DLBCL cases. YY1 expression was significantly more frequent in cases of the GCB subgroup than in the non-GCB subgroup (P = 0.005). YY1 was positively correlated with the expression of MUM1, BCL6, pAKT and MYC/BCL2 but was negatively associated with the expression of CXCR4. No significant relationships were identified between YY1 and clinical characteristics, including age, sex, stage, localization, and B symptoms. Univariate analysis showed that the OS (P = 0.003) and PFS (P = 0.005) of patients in the YY1-negative group were significantly worse than those in the YY1-positive group. Multivariate analysis indicated that negative YY1 was a risk factor for inferior OS (P < 0.001) and PFS (P = 0.017) independent of the international prognostic index (IPI) score, treatment and Ann Arbor stage. Furthermore, YY1 is more powerful for stratifying DLBCL patients into different risk groups when combined with MYC/BCL2 double-expression (DE) status. Conclusions: YY1 was frequently expressed in DLBCL, especially in those of GCB phenotype and with MYC/BCL2-DE. As an independent prognostic factor, YY1 expression could predict a favourable outcome in DLBCL. In addition, a complex regulatory mechanism might be involved in the interactions between YY1 and MYC, pAKT as well as CXCR4 in DLBCL, which warrants further investigation.

First Report of Colletotrichum fructicola Causing Leaf Spot on Smilax glabra Roxb in China.

Smilax glabra Roxb is a medicinal plant distributed in 17 countries and used in the production of food and tea (Wu et al. 2022). In May 2021, a leaf spot disease was observed on ~60% of S. glabra plants in a field (∼0.4 ha) in Qinzhou City, Guangxi Province. Initially, small, circular, brown spots appeared on the leaf surfaces, which then gradually expanded into large, sunken, dark brown necrotic areas. As disease progressed, lesions merged into large spots, eventually leading to defoliation. To determine the causal agent, six symptomatic plants were collected from the field. Small pieces (∼5 mm2) were cut from the infected leaves (n = 12), sterilized for two min in 1% NaOCl, and rinsed three times in sterile water. Then, the leaf tissues were placed on potato dextrose agar (PDA) with chloramphenicol (0.1 g/liter) and incubated for 3 days at 28°C (12-h photoperiod). Pure cultures were obtained by transferring hyphal tips from recently germinated spores or colony edges onto PDA. Among the 17 isolates, 15 exhibited similar morphologies. Two single-spore isolates (TFL45.1 and TFL46.2) were subjected to further morphological and molecular characterization. Colonies on PDA were grayish green with a white outer ring and cottony surface, and pale blackish green on the reverse side. Conidia were hyaline, aseptate, straight, and cylindrical, with rounded ends, and 11.4 to 16.5 µm × 4.1 to 6.1 µm (average 13.9 × 4.8 µm, n = 100). Appressoria were brown to dark brown, with a smooth edge and different shapes such as ovoid, elliptical or irregular, and 6.8 to 8.9 µm × 5.9 to 7.8 µm (average 7.7 × 6.6 µm, n = 25). For molecular identification, eight target gene sequences, internal transcribed spacer (ITS), glyceraldehydes-3-phosphate dehydrogenase (GAPHD), calmodulin (CAL), partial actin (ACT), chitin synthase (CHS-1), glutamine synthetase (GS), manganese superoxide dismutase (SOD2), and ß-tubulin (TUB) were selected for PCR amplification (Weir et al. 2012). The resulting sequences were deposited in GenBank (OR399160-61 and OR432537-50). BLASTn analysis of the obtained sequences showed 99-100% identity with those of the ex-type strain C. fructicola ICMP:18581 (JX010165, JX010033, FJ917508, FJ907426, JX009866, JX010095, JX010327, JX010405) (Weir et al. 2012). In addition, a phylogenetic analysis confirmed the isolates as C. fructicola. Therefore, based on morphological and molecular characteristics (Park et al. 2018; Weir et al. 2012), the isolates were identified as C. fructicola. To verify pathogenicity, three healthy leaves on each of six two-year-old S. glabra plants were inoculated with ∼5 mm2 mycelial discs or aliquots of 10 µl suspension (106 conidia/ml) of the strain TFL46.2, and six control plants were inoculated with sterile PDA discs or sterile water. All plants were enclosed in plastic bags and incubated in a greenhouse at 25°C (12-h photoperiod). Six days post-inoculation, leaf spot symptoms appeared on the inoculated leaves. No symptoms were detected in the controls. Experiments were replicated three times with similar results. To fulfill Koch's postulates, C. fructicola was consistently re-isolated from symptomatic tissue and confirmed by morphology and sequencing of the eight genes, whereas no fungus was isolated from the control plants. To our knowledge, this is the first report of C. fructicola causing leaf spot disease on S. glabra. Further studies will be needed to develop strategies against this disease based on the identification of this pathogen.

The haplotype-resolved genome assembly of autotetraploid rhubarb Rheum officinale provides insights into its genome evolution and massive accumulation of anthraquinones.

Rheum officinale, a member of the Polygonaceae family, is an important medicinal plant that is widely used in traditional Chinese medicine. Here, we report a 7.68-Gb chromosome-scale assembly of R. officinale with a contig N50 of 3.47 Mb, which was clustered into 44 chromosomes across four homologous groups. Comparative genomics analysis revealed that transposable elements have made a significant contribution to its genome evolution, gene copy number variation, and gene regulation and expression, particularly of genes involved in metabolite biosynthesis, stress resistance, and root development. We placed the recent autotetraploidization of R. officinale at ∼0.58 mya and analyzed the genomic features of its homologous chromosomes. Although no dominant monoploid genomes were observed at the overall expression level, numerous allele-differentially-expressed genes were identified, mainly with different transposable element insertions in their regulatory regions, suggesting that they functionally diverged after polyploidization. Combining genomics, transcriptomics, and metabolomics, we explored the contributions of gene family amplification and tetraploidization to the abundant anthraquinone production of R. officinale, as well as gene expression patterns and differences in anthraquinone content among tissues. Our report offers unprecedented genomic resources for fundamental research on the autopolyploid herb R. officinale and guidance for polyploid breeding of herbs.

Dual Stimuli-Responsive Micelles for Imaging-Guided Mitochondrion-Targeted Photothermal/Photodynamic/Chemo Combination Therapy-Induced Immunogenic Cell Death.

Introduction: As the special modality of cell death, immunogenic cell death (ICD) could activate immune response. Phototherapy in combination with chemotherapy (CT) is a particularly efficient tumor ICD inducing method that could overcome the defects of monotherapies. Methods: In this study, new dual stimuli-responsive micelles were designed and prepared for imaging-guided mitochondrion-targeted photothermal/photodynamic/CT combination therapy through inducing ICD. A dual-sensitive methoxy-polyethylene glycol-SS-poly(L-γ-glutamylglutamine)-SS-IR780 (mPEG-SS-PGG-SS-IR780) polymer was synthesized by grafting IR780 with biodegradable di-carboxyl PGG as the backbone, and mPEG-SS-PGG-SS-IR780/paclitaxel micelles (mPEG-SS-PGG-SS-IR780/PTXL MCs) were synthesized by encapsulating PTXL in the hydrophobic core. Results: In-vivo and -vitro results demonstrated that the three-mode combination micelles inhibited tumor growth and enhanced the therapeutic efficacy of immunotherapy. The dual stimuli-responsive mPEG-SS-PGG-SS-IR780/PTXL MCs were able to facilitate tumor cell endocytosis of nanoparticles. They were also capable of promoting micelles disintegration and accelerating PTXL release. The mPEG-SS-PGG-SS-IR780/PTXL MCs induced mitochondrial dysfunction by directly targeting the mitochondria, considering the thermo- and reactive oxygen species (ROS) sensitivity of the mitochondria. Furthermore, the mPEG-SS-PGG-SS-IR780/PTXL MCs could play the diagnostic and therapeutic roles via imaging capabilities. Conclusion: In summary, this study formulated a high-efficiency nanoscale platform with great potential in combined therapy for tumors through ICD.

First Report of Epicoccum latusicollum Causing Leaf Blight on Curcuma kwangsiensis in China.

Curcuma kwangsiensis S. G. Lee et C. F. Liang is a traditional Chinese medicinal plant distributed in Guangxi and Yunnan Province, China. In May 2021, a leaf blight disease on C. kwangsiensi was observed in a plantation (~ 2 ha) in Lingshan county (21°51'00″N, 108°44'00″E), Guangxi Province. Disease incidence was up to 30% (n = 200). Initially, yellow to brown, irregular, water-soaked spots appeared at the tips or margins of leaves. As the disease progressed, the lesions gradually enlarged, merged. Finally, the entire leaf wilted, leading to defoliation. To isolate the pathogen, eighteen small pieces ( ~ 5 mm2) were cut from the margin of the necrotic lesions, surface disinfected with 1% NaOCl solution for 2 min, and rinsed three times in sterile water. Then the tissues were plated onto potato dextrose agar (PDA) and incubated for 3 days at 28°C. Hyphal tips from recently germinated spores were transferred to PDA to obtain pure cultures. Twelve isolates were obtained, of which ten isolates with similar morphological characterization. Two single-spore isolates (CK45.1 and CK45.2) were subjected to further morphological and molecular characterization. Colonies on PDA were villose, had a dense growth of aerial mycelia, and appeared white to grayish eventually. Pycnidia were brown, predominantly spheroidal, and 45.0 to 205.4 µm in diameter (n = 60). Conidia were ellipsoidal, aseptate, and 3.8 to 6.1 × 1.8 to 3.6 µm (n = 90). Morphological characteristics are similar to those of Epicoccum latusicollum (Chen et al. 2017).For molecular identification, primers ITS1/ITS4 (White et al. 1990), LR0R/LR5 (Vilgalys and Hester 1990, Rehner and Samuels 1994), RPB2-Ep-F (GGTCTTGTGTGCCCCGCTGAGAC)/RPB2-Ep-R TCGGGTGACATGACAATCATGGC), and TUB2-Ep-F (GTTCACCTTCAAACCGGTCAATG)/TUB2-Ep-R (AAGTTGTCGGGACGGAAGAGCTG) were used to amplify the internal transcribed spacer (ITS), partial nuclear large subunit rDNA (LSU), RNA polymerase II second largest subunit (rpb2), and ß-tubulin (tub2) genes, respectively. The obtained ITS (OP788080-81), LSU (OP811325-26), rpb2 (OP811267-68) and tub2 (OP811269-70) sequences showed 99.8% (478/479, and 478/479 bp), 99.9% (881/882, and 870/871 bp), 99.8 to 100% (429/431, and 429/430 bp), and 99.7% (332/333, and 332/333 bp) identity with those of ex-type strain E. latusicollum CGMCC 3.18346 (KY742101, KY742255, KY742174, KY742343). In addition, a phylogenetic analysis confirmed the isolates as E. latusicollum. Therefore, based on morphological and molecular characteristics, the isolates were identified as E. latusicollum. To verify pathogenicity, healthy leaves on nine plants (1 leaf per plant) were inoculated with mycelial discs from 5-day-old water-agar medium (WA) cultures of the strain CK45.1. Each leaf had four inoculation sites, two were inoculated with a representative strain, and two treated with pollution-free WA discs served as control. Plants were covered with transparent plastic bags and maintained in a greenhouse at 25°C with a 12 h photoperiod. Six days post-inoculation, the inoculated sites of leaves showed brown lesions, while the control remained healthy. The experiments repeated three times showed similar results. Koch's postulates were fulfilled by re-isolation of E. latusicollum from the lesions. To our knowledge, this is the first report of E. latusicollum causing leaf blight of C. kwangsiensi in China. This report might provide important information for growers to manage this disease.

High-quality Fagopyrum esculentum genome provides insights into the flavonoid accumulation among different tissues and self-incompatibility.

Common buckwheat (Fagopyrum esculentum) and Tartary buckwheat (Fagopyrum tataricum), the two most widely cultivated buckwheat species, differ greatly in flavonoid content and reproductive mode. Here, we report the first high-quality and chromosome-level genome assembly of common buckwheat with 1.2 Gb. Comparative genomic analysis revealed that common buckwheat underwent a burst of long terminal repeat retrotransposons insertion accompanied by numerous large chromosome rearrangements after divergence from Tartary buckwheat. Moreover, multiple gene families involved in stress tolerance and flavonoid biosynthesis such as multidrug and toxic compound extrusion (MATE) and chalcone synthase (CHS) underwent significant expansion in buckwheat, especially in common buckwheat. Integrated multi-omics analysis identified high expression of catechin biosynthesis-related genes in flower and seed in common buckwheat and high expression of rutin biosynthesis-related genes in seed in Tartary buckwheat as being important for the differences in flavonoid type and content between these buckwheat species. We also identified a candidate key rutin-degrading enzyme gene (Ft8.2377) that was highly expressed in Tartary buckwheat seed. In addition, we identified a haplotype-resolved candidate locus containing many genes reportedly associated with the development of flower and pollen, which was potentially related to self-incompatibility in common buckwheat. Our study provides important resources facilitating future functional genomics-related research of flavonoid biosynthesis and self-incompatibility in buckwheat.

Anthraquinones with potential antiproliferative activities from the fruits of Morinda citrifolia.

The phytochemical investigation on the fruits of Morinda citrifolia led to the isolation and characterization of a new anthraquinone, moricitrifone (1), along with seven known anthraquinones (2-8). The chemical structure of 1 was elucidated by extensive spectral analyses. The known compounds (2-8) were identified by comparing their spectral data with those reported in the literature. The antiproliferative activities of all isolated anthraquinones (1-8) against five human cancer cell lines: HL-60, SMMC-7721, A-549, MCF-7 and SW480 were evaluated in vitro. Compounds 1-8 exhibited remarkable antiproliferative activities with IC50 values ranging from 0.26 ± 0.05 to 16.58 ± 0.18 µM, which were comparable to those of doxorubicin.

Photodynamic antitumor activity of Gallium(III) and Phosphorus(V) complexes of trimethoxyl A2B triaryl corrole.

Two new trimethoxyl A2B triaryl corroles 10-(2,4,6-trimethoxyphenyl)-5,15-bis(pentafluorophenyl)- corrole (1) and 10-(3,4,5-trimethoxyphenyl)-5,15-bis(pentafluorophenyl)-corrole (2) and their gallium(III) and phosphorus(V) (1-Ga, 1-P, 2-Ga and 2-P) complexes had been prepared and well characterized by UV-vis, NMR and HR-MS. Among all compounds, 2-Ga, 1-P and 2-P showed excellent in vivo photodynamic activity against the MDA-MB-231, A549, Hela and HepG2 cell lines upon light irradiation at 625 nm. And 2-P even exhibited higher phototoxicity than the clinical photosensitizer temoporfin. Also, 2-P exhibited the highest singlet oxygen quantum yield and photostability. The preliminary investigation revealed that 2-P could be rapidly absorbed by tumor cells and mainly located in the cytoplasm. After photodynamic therapy (PDT) treatment with 2-P, mitochondrial membrane potential destruction, intracellular ROS level increasing and nuclear fragmentation of cancer cells could be observed. Cell cycle analysis demonstrated that the 2-P PDT may cause tumor cell arrest at sub-G1 stage and induce early and late apoptosis of cells. These results suggest that 2-P is a promising candidate as a photosensitizer for photodynamic therapy.

Chinese Herbal Formula Huayu-Qiangshen-Tongbi Decoction Attenuates Rheumatoid Arthritis through Upregulating miR-125b to Suppress NF-κB-Induced Inflammation by Targeting CK2.

The Huayu-Qiangshen-Tongbi (HQT) decoction, a Chinese medical formula, has been identified to show a potent therapeutic effect on rheumatoid arthritis (RA). However, the specific molecular mechanism of HQT in RA has not been well studied. In the present study, LPS-treated human rheumatoid fibroblast-like synoviocyte (FLS) MH7A cells and collagen-induced arthritis (CIA) mice were utilized as in vitro and in vivo models. Our results demonstrated that HQT could efficiently inhibit RA-induced inflammation by reducing the production of cytokines including tumor necrosis factor alpha (TNF-α), interleukin-1 beta (IL-1ß), and interleukin-6 (IL-6). Moreover, HQT significantly upregulated the expression of miR-125b. Besides, analysis of bioinformatics suggested casein kinase 2 (CK2) was a potential target of miR-125b. Luciferase reporter assay was performed and revealed that miR-125b suppressed CK2 expression in MH7A cells. Furthermore, miR-125b inhibited LPS-induced NF-kappa-B (NF-κB) activation, which is a downstream target of CK2. In addition, the NF-κB inhibitor ammonium pyrrolidinedithiocarbamate (PDTC) and NF-kappa-B inhibitor alpha (IkB-α) enhanced the inhibitory effect of miR-125b on the expression of TNF-α, IL-1ß, and IL-6. Taken together, our study revealed that HQT could attenuate RA through upregulating miR-125b to suppress NF-κB-induced inflammation by targeting CK2. The findings of this study should facilitate investigating the mechanism of HQT on RA and discovering novel therapeutic targets for RA.

Lycium barbarum polysaccharide protects against osteonecrosis of femoral head via regulating Runx2 expression.

BACKGROUND: Osteonecrosis of femoral head (ONFH) is a pathological state caused by lack of blood supply in femoral head. This study aimed to explore the function of Lycium barbarum polysaccharide (LBP), an antioxidant agent extracted from L. barbarum, on ONFH. METHODS: Osteonecrosis rat model was generated using lipopolysaccharide (LPS) and methylprednisolone followed by examination of body weight, blood glucose, morphology, and BMSC osteoblast differentiation. The effect and underlying mechanism of LBP on the proliferation, apoptosis, and osteoblast differentiation of BMSC were determined with or without LPS or hypoxia treatment using CCK-8. Alizarin Red S staining, flow cytometry, and western blot, respectively. RESULT: LBP could protect against glucocorticoid-induced ONFH in rats, resulting in improved sparse trabecular bone, empty lacunae and bone cell coagulation. Moreover, LBP promoted the proliferation and osteoblast differentiation of bone mesenchymal-derived stem cells (BMSCs) in a dose-dependent manner. Furthermore, LBP enhanced osteoblast differentiation of BMSCs under hypoxia condition. Mechanistically, we found that LBP treatment enhanced Runx2 and ALP expression in BMSCs. LBP restored the expression of Runx2 and ALP under hypoxia, suggesting that LBP might be involved in regulating Runx2/ALP expression and contributed to osteoblast differentiation. Knockdown of Runx2 significantly inhibited BMSCs proliferation, while LBP treatment did not rescue the osteoblast differentiation ability of BMSCs with Runx2 knockdown. CONCLUSION: Our findings suggested that LBP protects against ONFH via regulating Runx2 expression, which could be utilized to treat patients suffering ONFH.

Twelve natural estrogens in urines of swine and cattle: Concentration profiles and importance of eight less-studied.

Although four major natural estrogens (i.e., estrone (E1), 17ß-estradiol (E2), estriol (E3) and 17α-estradiol (αE2)) have been commonly found in livestock urine, this study reports the occurrence of eight other less-studied natural estrogens in urine of swine and cattle, i.e. 2-hydroxyestone (2OHE1), 4-hydroxyestrone (4OHE1), 2-hydroxyestradiol (2OHE2), 4-hydroxyestradiol (4OHE2), 16-epiestriol (16epiE3), 16α-hydroxyestrone (16αE1), 16-ketoestradiol (16ketoE2), and 17epiestriol (17epiE3). Results showed that each estrogen was found in at least one urine sample, and 6 of 8 the less-studied estrogens were present at frequencies of ≥90% in boars, ≥70% in sows, and ≥50% in dairy cattle. Five of eight the less-studied estrogens were present at frequencies of ≥33.3% in four beef cattle and one bull. On a concentration basis, the 8 less-studied natural estrogens represented 73.2%, 85.2%, 39.9%, 47.7%, 26.9%, 56.0% and 44.1% of total concentrations of the twelve natural estrogens when combining data from all animals. Similar results were observed based on estrogen equivalence, which indicated these newly detected eight less-studied natural estrogens were not negligible. This work is the first to figure out the importance of these less-studied natural estrogens in livestock urine, and their potential environmental risks associated with discharge of livestock wastewater should be urgently assessed in a holistic manner.

Procyanidin B1 and p-Coumaric Acid from Highland Barley Grain Showed Synergistic Effect on Modulating Glucose Metabolism via IRS-1/PI3K/Akt Pathway.

INTRODUCTION: Phenolic extract in highland barley grain has showed hypoglycemic effect, while little information is available about the active compounds and whether there exist additive or synergistic effect on modulating glucose metabolism. METHODS AND RESULTS: Procyanidin B1 (PB) and p-coumaric acid (CA) are the active compounds in highland barley grain and show synergistic effect on improving glucose uptake and glycogen synthesis by upregulating glucose transporter (GLUT4) and downregulating glycogen synthase kinase-3ß (GSK-3ß) protein expression, respectively. The mechanism may be attributed to target insulin receptor (IRß) and regulate insulin receptor substrate-1 (IRS-1)/phosphatidylinositol 3-kinase (PI3K)/ protein kinase B (Akt) pathway. Furthermore, PB + CA exhibits synergistic effect on restoring glucose intolerance and insulin resistance, and improving hepatic glycogen synthesis in impaired glucose tolerance (IGT) mice. The postprandial blood glucose (PBG), homeostasis model assessment (HOMA)-IR values and serum insulin contents in PB + CA-treated IGT mice with dosage of 300 mg kg-1 BW are reversed to normal levels. Additionally, PC + CA shows additive effect on inhibiting gluconeogenesis in vitro and in vivo. CONCLUSION: PB + CA in highland barley grain synergistically modulate glucose metabolism. These results may provide evidence of whole highland barley grain diet achieve superior effect on restoring IGT than isolated components.

HPLC-QTOF/MS-based metabolomics to explore the molecular mechanisms of Yiqi Fumai Lyophilized Injection in heart failure mice.

Chronic heart failure is a common and fatal disease triggered by loss of normal cardiac function. Yiqi Fumai Lyophilized Injection is widely used in the treatment of cardiovascular diseases, especially chronic heart failure. In this study, a model of chronic heart failure in mice was established with permanent coronary artery ligation followed by Yiqi Fumai Lyophilized Injection intervention for 14 days. Then, the endogenous metabolites of mice plasma and urine samples were screened through nontargeted metabolomics techniques. The results indicated that Yiqi Fumai Lyophilized Injection treatment changed the metabolic pattern of chronic heart failure and regulated valine, leucine, and isoleucine biosynthesis, taurine and hypotaurine metabolism, histidine metabolism and arginine biosynthesis, etc. Finally, the cardioprotective mechanism of Yiqi Fumai Lyophilized Injection was further verified in the mouse model of chronic heart failure and angiotensin II-induced cardiac fibroblasts based on metabolomics. The results showed that Yiqi Fumai Lyophilized Injection could inhibit myocardial fibrosis to improve chronic heart failure. This study firstly elucidated the metabolic network and pathways regulated by Yiqi Fumai Lyophilized Injection, which might facilitate the realization of the clinically accurate application of Yiqi Fumai Lyophilized Injection in the treatment of chronic heart failure.

Analysis of accumulation and phytotoxicity mechanism of uranium and cadmium in two sweet potato cultivars.

The purpose of this study was to reveal the accumulation and phytotoxicity mechanism of sweet potato (Ipomoea batatas L.) roots following exposure to toxic levels of uranium (U) and cadmium (Cd). We selected two accumulation-type sweet potato cultivars as experimental material. The varietal differences in U and Cd accumulation and physiological metabolism were analyzed by a hydroponic experiment. High concentrations of U and Cd inhibited the growth and development of sweet potato and damaged the microstructure of root. The roots were the main accumulating organs of U and Cd in both sweet potato. Root cell walls and vacuoles (soluble components) were the main distribution sites of U and Cd. The chemical forms of U in the two sweet potato varieties were insoluble and oxalate compounds, while Cd mainly combined with pectin and protein. U and Cd changed the normal mineral nutrition metabolism in the roots, and also significantly inhibited the photosynthetic metabolism of sweet potatoes. RNA-seq showed that the cell wall and plant hormone signal transduction pathways responded to either U or Cd toxicity in both varieties. The inorganic ion transporter and organic compound transporter in roots of both sweet potato varieties are sensitive to U and Cd toxicity.

Polyphenol oxidase dominates the conversions of flavonol glycosides in tea leaves.

Flavonol glycosides are associated with astringency and bitterness of teas. To clarify the dominant enzymatic reaction of flavonol glycosides in tea leaves, the catalytic effects of polyphenol oxidase (PPO), peroxidase (POD) and ß-glucosidase were studied, with the maintaining rates of total flavonol glycosides (TFG) being 73.0%, 99.8% and 94.3%. PPO was selected for further investigations, including the effects of pH value (3.5 ~ 6.5), temperature (25 °C ~ 55 °C) and dosage (39 ~ 72 U/mL PPO and 36 U/mL PPO, 3 ~ 36 U/mL POD). The oxidation of flavonol glycosides were intensified at pH 6.5, with 51.8% and 15.4% of TFG maintained after PPO and PPO + POD treatments, suggesting an enhancement from POD. The sensitivity ranking to PPO was: myricetin glycosides > quercetin glycosides > kaempferol glycosides. The inhibitor treatment testified the leading role of PPO in catalyzing flavonol glycosides in tea leaves. Sugar moiety enhanced the docking affinity of flavonol glycosides for PPO. PPO shows the potential of modifying flavonol glycoside composition.

Grass-Specific EPAD1 Is Essential for Pollen Exine Patterning in Rice.

The highly variable and species-specific pollen surface patterns are formed by sporopollenin accumulation. The template for sporopollenin deposition and polymerization is the primexine that appears on the tetrad surface, but the mechanism(s) by which primexine guides exine patterning remain elusive. Here, we report that the Poaceae-specific EXINE PATTERN DESIGNER 1 (EPAD1), which encodes a nonspecific lipid transfer protein, is required for primexine integrity and pollen exine patterning in rice (Oryza sativa). Disruption of EPAD1 leads to abnormal exine pattern and complete male sterility, although sporopollenin biosynthesis is unaffected. EPAD1 is specifically expressed in male meiocytes, indicating that reproductive cells exert genetic control over exine patterning. EPAD1 possesses an N-terminal signal peptide and three redundant glycosylphosphatidylinositol (GPI)-anchor sites at its C terminus, segments required for its function and localization to the microspore plasma membrane. In vitro assays indicate that EPAD1 can bind phospholipids. We propose that plasma membrane lipids bound by EPAD1 may be involved in recruiting and arranging regulatory proteins in the primexine to drive correct exine deposition. Our results demonstrate that EPAD1 is a meiocyte-derived determinant that controls primexine patterning in rice, and its orthologs may play a conserved role in the formation of grass-specific exine pattern elements.

The Role of Th17/Treg Axis in the Traditional Chinese Medicine Intervention on Immune-Mediated Inflammatory Diseases: A Systematic Review.

The Th17/Treg axis plays a crucial role in immune-mediated inflammatory diseases (IMID) and might represent an interesting drug target of treatment strategy for these diseases. Accumulating evidence suggests a role for traditional Chinese medicine (TCM) in the modulation of Th17/Treg axis, but a comprehensive overview which summarizes this field hitherto is lacked. This paper performs a systematic literature review of the regulatory effects of TCM on the imbalance of Th17/Treg axis and its potential mechanisms. In addition, the frequency analysis and network pharmacology for the collected TCM herbs from clinical trial data were performed. The studies reported the changes in the ratio of Th17 and/or Treg cells as well as their transcription factor and related cytokines were included. Frequency analysis of composition of the 39 assessed TCM prescriptions showed that Astragalus membranaceus var.mongholicus (5.20%), Glycyrrhiza uralensis (3.67%), Paeonia obovate (3.06%), Salvia digitaloides (3.06%), and Angelica sinensis (2.75%) were the top five herbal components, which were closely associated to the treatment of IMID. Network pharmacology showed that six target proteins (transforming growth factor (TGF)-beta receptor type-1, TGF-beta receptor type-2, retineic-acid-receptor-related orphan nuclear receptor gamma (ROR-gamma), TGFB2, IL-17 and IL-2, respectively) might be involved in the regulatory effects of TCM on Th17/Treg axis. Moreover, there were nine active ingredients (including Oxymatrine, Baicalin, Triptolide, Paeoniflorin, Sinomenine, Celastrol, Emodin, Diosgenin and Chlorogenic acid) originating from TCM reported to have an immunological regulation effect on the Th17/Treg axis. The highlight of this systematic review is to reveal the pharmacological basis of TCM treating IMID and is helpful for supporting future pharmacologic-driven studies. Further research elucidates the immune-modulating mechanisms on Th17/Treg axis by TCM might provide a broader insight for the treatment of IMID.

Successful treatment of a case of idiopathic linear IgA bullous dermatosis with oral sulfasalazine.

Linear IgA bullous dermatosis (LABD) is a rare acquired autoimmune chronic vesiculobullous dermatosis affecting primarily young children and older adults. We report a 17-year-old Chinese boy with a 2-month history of intense itching erythema or tense vesicles on healthy skin or on an erythematous base, with parts of lesions arising a characteristic "cluster of jewels" pattern. With the characteristics of vesicles or blisters on the skin, subepidermal blisters with neutrophilic infiltrate on histology, and linear IgA deposits on the basement membrane zone and absence of other immunoglobulins on direct immunofluorescence, LABD was dignosized. Sulfapyridine has also been reported as one of the best options of systemic therapy for LABD. Our patient successfully treated with only oral sulfasalazine (alternative medicine of sulfasalazine), which is safe and effective.

A metabolomic, transcriptomic profiling, and mineral nutrient metabolism study of the phytotoxicity mechanism of uranium.

Uranium (U) is a nonessential element that is readily adsorbed and retained in plant roots, causing root damage plants, rather than being translocated to other parts of the plant. The phytotoxicity mechanism of U is poorly understood. In this study, Vicia faba, a model plant for toxicological research, was selected as experimental material to investigate the phytotoxicity mechanism of U. In this study, the effects of U on the growth and development, methonome, transcriptome and mineral nutrient metabolism of V. faba were studied under different U treatments (0-25 µM) by integrating metabolomics, transcriptomic, and mineral nutrient metabolism analysis techniques. The results showed that U accumulation in roots and aboveground parts reached 164.34-927.90 µg/pot, and 0.028-0.119 µg/pot, respectively. U was mainly accumulated in the cell wall of roots, which damaged the root microstructure and inhibited root growth and development. In terms of mineral nutrient metabolism, U treatment (0-25 µM) led to changes in mineral metabolic profiles of seedlings. In total, 612 different metabolites were identified in nontargeted metabolomics, including 309 significantly upregulated metabolites and 303 significantly downregulated metabolites. Using RNA-seq, 4974 differentially expressed genes (DEGs) were identified under the high-concentration U treatment (25 µM), including 1654 genes significantly upregulated genes and 3320 genes significantly downregulated genes. Metabolic pathway analysis showed that a high concentration of U led to an imbalance of mineral nutrient metabolism in plants and changes in the metabolism and transcriptome pathway of plants, including alterations in the function of plasmodesmata and auxin signal transduction pathway. The latter finding may potentially explain the toxic effect of U on plant roots.