Development of Hydrolysis Probe-Based qPCR Assays for Panax ginseng and Panax quinquefolius for Detection of Adulteration in Ginseng Herbal Products.

Authentication of Panax ginseng and Panax quinquefolius products is important to be able to mitigate instances of adulteration and substitution that exist within the international supply chain of ginseng. To address this issue, species-specific hydrolysis probe qPCR assays were developed and validated for both P. ginseng and P. quinquefolius herbal dietary supplements. Performance of the probe-based assays was evaluated using analytical validation criteria, which included evaluation of: (1) specificity, in selectively identifying the target species; (2) sensitivity, in detecting the lowest amount of the target material; and (3) repeatability and reproducibility of the method in detecting the target species in raw materials on a real-time PCR platform (reliability). The species-specific probes were developed and successfully passed the validation criteria with 100% specificity, 80-120% efficiency and 100% reliability. The methods developed in this study are fit for purpose, rapid, and easy to implement in quality assurance programs; authentication of ginseng herbal supplements is possible, even with extracts where DNA is fragmented and of low quality and quantity.

Niche specificity and functional diversity of the bacterial communities associated with Ginkgo biloba and Panax quinquefolius.

Plant-associated bacteria can establish mutualistic relationships with plants to support plant health. Plant tissues represent heterogeneous niches with distinct characteristics and may thus host distinct microbial populations. The objectives of this study are to investigate the bacterial communities associated with two medicinally and commercially important plant species; Ginkgo biloba and Panax quinquefolius using high Throughput Sequencing (HTS) of 16S rRNA gene, and to evaluate the extent of heterogeneity in bacterial communities associated with different plant niches. Alpha diversity showed that number of operational taxonomic units (OTUs) varied significantly by tissue type. Beta diversity revealed that the composition of bacterial communities varied between tissue types. In Ginkgo biloba and Panax quinquefolius, 13% and 49% of OTUs, respectively, were ubiquitous in leaf, stem and root. Proteobacteria, Bacteroidetes, Actinobacteria and Acidobacteria were the most abundant phyla in Ginkgo biloba while Proteobacteria, Bacteroidetes, Actinobacteria, Plantomycetes and Acidobacteria were the most abundant phyla in Panax quinquefolius. Functional prediction of these bacterial communities using MicrobiomeAnalyst revealed 5843 and 6251 KEGG orthologs in Ginkgo biloba and Panax quinquefolius, respectively. A number of these KEGG pathways were predicted at significantly different levels between tissues. These findings demonstrate the heterogeneity, niche specificity and functional diversity of plant-associated bacteria.

Quantification of Actaea racemosa L. (black cohosh) from some of its potential adulterants using qPCR and dPCR methods.

The demand for popular natural health products (NHPs) such as Black Cohosh is increasing considerably, which in turn challenges quality assurance (QA) throughout the supply chain. To detect and quantify the target species present in a given NHP, DNA-based molecular techniques such as Real-time quantitative PCR (qPCR) and digital PCR (dPCR) are standard tools in the food and pathogen testing industries. There is a gap in the literature concerning validated quantitative PCR methods for botanicals that can be utilized for QA and good manufacturing practices. The objective of this study is to develop an efficient quantification method using qPCR and dPCR techniques for the detection and quantification of Actaea racemosa (Black cohosh) NHPs from its potential adulterants. These developed methods are validated for applicability on commercial NHPs. Species-specific hydrolysis probe assays were designed to analyze the black cohosh NHPs using qPCR and dPCR techniques. The results confirmed that the developed qPCR and dPCR methods are highly precise for identifying and quantifying black cohosh NHPs, indicating their potential applicability in future routine industrial and laboratory testing. This enables a single qPCR test to determine not only the presence of a specific botanical, but also the amount when mixed with an adulterant.

Validation and Optimization of qPCR Method for Identification of Actaea racemosa (Black Cohosh) NHPs.

BACKGROUND: Actaea racemosa (black cohosh) herbal dietary supplements are commonly used to treat menopausal symptoms in women. However, there is a considerable risk of contamination of A. racemosa herbal products in the natural health product (NHP) industry, impacting potential efficacy. Authentication of A. racemosa products is challenging because of the standard, multi-part analytical chemistry methods that may be too costly and not appropriate for both raw and finished products. OBJECTIVE: In this paper, we discuss developing and validating quick alternative biotechnology methods to authenticate A. racemosa herbal dietary supplements, based on the use of a species-specific hydrolysis PCR probe assay. METHODS: A qPCR-based species-specific hydrolysis probe assay was designed, validated, and optimized for precisely identifying the species of interest using the following analytical validation criteria: (1) specificity (accuracy) in determining the target species ingredient, while not identifying other non-target species; (2) sensitivity in detecting the smallest amount of the target material; and (3) reliability (repeatability and reproducibility) in detecting the target species in raw materials on a real-time PCR platform. RESULTS: The results show that the species-specific hydrolysis probe assay was successfully developed for the raw materials and powders of A. racemosa. The specificity of the test was 100% to the target species. The efficiency of the assay was observed to be 99%, and the reliability of the assay was 100% for the raw/starting and powder materials. CONCLUSION: The method developed in this study can be used to authenticate and perform qualitative analysis of A. racemosa supplements.

Genome skimming and NMR chemical fingerprinting provide quality assurance biotechnology to validate Sarsaparilla identity and purity.

Sarsaparilla is a popular natural health product (NHP) that has been reported to be one of the most adulterated botanicals in the marketplace. Several plausible explanations are documented including economically motivated product substitution, unintentional errors due to ambiguous trade name associated with several different taxa, and wild harvesting of incorrect non-commercial plants. Unfortunately, this includes the case of an adulterant species Decalepis hamiltonii, a Red listed medicinal plant species by the International Union for Conservation of Nature (IUCN) and declared as a species with high conservation concern by the National Biodiversity Authority of India (NBA). This study provides validated genomic (genome skimming & DNA probes) and metabolomic (NMR chemical fingerprints) biotechnology solutions to prevent adulteration on both raw materials and finished products. This is also the first use of Oxford Nanopore on herbal products enabling the use of genome skimming as a tool for quality assurance within the supply chain of botanical ingredients. The validation of both genomics and metabolomics approach provided quality assurance perspective for both product identity and purity. This research enables manufactures and retailers to verify their supply chain is authentic and that consumers can enjoy safe, healthy products.

Mitochondrial plastid DNA can cause DNA barcoding paradox in plants.

The transfer of ancestral plastid genomes into mitochondrial genomes to generate mitochondrial plastid DNA (MTPT) is known to occur in plants, but its impacts on mitochondrial genome complexity and the potential for causing a false-positive DNA barcoding paradox have been underestimated. Here, we assembled the organelle genomes of Cynanchum wilfordii and C. auriculatum, which are indigenous medicinal herbs in Korea and China, respectively. In both species, it is estimated that 35% of the ancestral plastid genomes were transferred to mitochondrial genomes over the past 10 million years and remain conserved in these genomes. Some plastid barcoding markers co-amplified the conserved MTPTs and caused a barcoding paradox, resulting in mis-authentication of botanical ingredients and/or taxonomic mis-positioning. We identified dynamic and lineage-specific MTPTs that have contributed to mitochondrial genome complexity and might cause a putative barcoding paradox across 81 plant species. We suggest that a DNA barcoding guidelines should be developed involving the use of multiple markers to help regulate economically motivated adulteration.

Investigating appropriate molecular and chemical methods for ingredient identity testing of plant-based protein powder dietary supplements.

Plant-based protein powders are rapidly growing in popularity, and outdated quality assurance tools expose vulnerabilities to adulteration via different methods of "protein spiking". Adequate diagnostic tools are urgently needed to be able to authenticate protein source ingredients and screen for potential adulterants. We explored the application of three diagnostic tools for ingredient identification: targeted PCR with Sanger sequencing, NGS, and LC-MS/MS. We collected 33 samples of common commercial products from the plant-based protein powder market and sought to identify botanical components using the three technologies. We found success in detection with all approaches, with at least one main protein source being identified by at least one approach in all samples. The investigation uncovered challenges to data collection or result interpretation with each technology including but not limited to amplification biases with PCR technologies, potential influence of DNA degradation, and issues with protein solubility during isolation. Ultimately, each platform demonstrated utility along with certain caveats, which epitomized the importance of orthogonality of testing.

DNA Quality and Quantity Analysis of Camellia sinensis Through Processing from Fresh Leaves to a Green Tea Extract.

Background: Although there has been some success using DNA barcoding to authenticate raw natural health product (NHP) botanical ingredients, there are many gaps in our understanding of DNA degradation, which may explain low PCR and sequencing success in processed NHPs. Objective: In this study, we measured multiple DNA variables after each step in the processing of a green tea extract in order to document DNA quality and quantity. Methods: We sampled plant material after each step of green tea extract processing: five steps at a Chinese tea farm (n = 10) and five at an NHP processing facility (n = 3). We hypothesized that processing treatments degrade and remove DNA from NHPs, reflected by decreasing quantities of extractable genomic DNA (gDNA), an increasing proportion of small DNA fragments in genomic extracts, and decreasing quantitative PCR (QPCR) efficiency [higher cycle threshold (Ct) values]. DNA from end-production green tea extract was sequenced in order to try to validate material as the botanical of interest. Results: We saw a 41.1% decrease in mean extractable gDNA through farm processing (P < 0.01) and a 99.7% decrease through facility processing (P < 0.05). There was a 26.3% decrease in mean DNA fragment size through farm processing (P < 0.001) and an 82.0% decrease through facility processing (P < 0.05). QPCR efficiency was reduced through processing, marked by significant increases in Ct values with 100 base pair (bp) and 200 bp PCR targets (P < 0.05), and an inability to amplify 300 bp targets when using DNA template from end-production green tea extract. Conclusions: Although there was significant degradation and removal of DNA through processing, sufficiently intact DNA was able to be recovered from highly processed green tea extract for further sequencing and identification. Highlights: This work addresses a key gap in the understanding of DNA degradation through processing and provides useful information to consider when designing molecular diagnostic techniques for NHP identification.

Validated Identity Test Method for Ginkgo biloba NHPs Using DNA-Based Species-Specific Hydrolysis PCR Probe.

Background: There is considerable risk of adulteration of Ginkgo biloba herbal products in the natural health product (NHP) industry. Authentication of G. biloba products is challenging because of the standard, complex, analytical chemistry methods that may be too costly and not appropriate for both raw and finished products. Objective: We sought to develop and validate an alternative method to authenticate G. biloba herbal dietary supplements, based on the use of a species-specific hydrolysis PCR probe assay. Methods: A species-specific hydrolysis probe assay was developed, validated, and evaluated for the performance of the assay in accurately identifying the species of interest using the following analytical validation criteria: (1) specificity (accuracy) in identifying the target species ingredient, while not identifying other nontarget species, (2) sensitivity in detecting the smallest amount of the target material, and (3) reliability (repeatability and reproducibility) in detecting the target species in raw materials on a real-time PCR platform. Results: The species-specific hydrolysis probe assay was successfully developed for raw materials of G. biloba. The specificity of the assay was 100% to the target species. Efficiency of the assay was observed to be 99%, and the reliability of the assay was 100% for the raw/starting materials. Conclusions and Highlights: The method developed in this study is simple, rapid, and easy for supplement manufacturers to perform in their laboratories to ensure that their G. biloba supplements are authentic.

Recommendations for Validation of Real-Time PCR Methods for Molecular Diagnostic Identification of Botanicals.

Background: PCR methods are the most commonly used DNA-based identity tool in the commercial food, beverage, and natural health product markets. These methods are routinely used to identify foodborne pathogens and allergens in food. Proper validation methods for some sectors have been established, while there are none in other markets, such as botanicals. Results: A survey of the literature indicates that some validation criteria are not addressed when developing PCR tests for botanicals. Objective: We provide recommendations for qualitative real-time PCR methods for validating identity tests for botanical ingredients. Methods: These include common criteria that underpin the development and validation of rigorous tests, including (1) the aim of the validation test, (2) the applicability of different matrix variants, (3) specificity in identifying the target species ingredient, (4) sensitivity in detecting the smallest amount of the target material, (5) repeatability of methods, (6) reproducibility in detecting the target species in both raw and processed materials, (7) practicability of the test in a commercial laboratory, and (8) comparison with alternative methods. In addition, we recommend additional criteria, according to which the practicability of the test method is evaluated by transferring the method to a second laboratory and by comparison with alternative methods. Conclusions and Highlights: We hope that these recommendations encourage further publication on the validation of PCR methods for many botanical ingredients. These properly validated PCR methods can be developed on small, real-time biotechnology that can be placed directly into the supply chain ledger in support of highly transparent data systems that support QC from the farm to the fork of the consumer.

Detection of Cistanches Herba (Rou Cong Rong) Medicinal Products Using Species-Specific Nucleotide Signatures.

Cistanches Herba is a medicinal plant that has tonification properties and is commonly used in Asia. Owing to the imbalance between supply and demand, adulterants are frequently added for profit. However, there is no regulatory oversight because quality control tools are not sufficient for identifying heavily processed products. Thus, a novel molecular tool based on nucleotide signatures and species-specific primers was developed. The ITS2 regions from 251 Cistanches Herba and adulterant samples were sequenced. On the basis of SNP sites, four nucleotide signatures within 30~37 bp and six species-specific primers were developed, and they were validated by artificial experimental mixtures consisting of six different species and different ratios. This method was also applied to detect 66 Cistanches Herba products on the market, including extracts and Chinese patent medicines. The results demonstrated the utility of nucleotide signatures in identifying adulterants in mixtures. The market study revealed 36.4% adulteration: 19.7% involved adulteration with Cynomorium songaricum or Cistanche sinensis, and 16.7% involved substitution with Cy. songaricum, Ci. sinensis, or Boschniakia rossica. The results also revealed that Cy. songaricum was the most common adulterant in the market. Thus, we recommend the use of species-specific nucleotide signatures for regulating adulteration and verifying the quality assurance of medicinal product supply chains, especially for processed products whose DNA is degraded.

Biomonitoring for traditional herbal medicinal products using DNA metabarcoding and single molecule, real-time sequencing.

Global concerns have been paid to the potential hazard of traditional herbal medicinal products (THMPs). Substandard and counterfeit THMPs, including traditional Chinese patent medicine, health foods, dietary supplements, etc. are potential threats to public health. Recent marketplace studies using DNA barcoding have determined that the current quality control methods are not sufficient for ensuring the presence of authentic herbal ingredients and detection of contaminants/adulterants. An efficient biomonitoring method for THMPs is of great needed. Herein, metabarcoding and single-molecule, real-time (SMRT) sequencing were used to detect the multiple ingredients in Jiuwei Qianghuo Wan (JWQHW), a classical herbal prescription widely used in China for the last 800 years. Reference experimental mixtures and commercial JWQHW products from the marketplace were used to confirm the method. Successful SMRT sequencing results recovered 5416 and 4342 circular-consensus sequencing (CCS) reads belonging to the ITS2 and psbA-trnH regions. The results suggest that with the combination of metabarcoding and SMRT sequencing, it is repeatable, reliable, and sensitive enough to detect species in the THMPs, and the error in SMRT sequencing did not affect the ability to identify multiple prescribed species and several adulterants/contaminants. It has the potential for becoming a valuable tool for the biomonitoring of multi-ingredient THMPs.

Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines.

Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.

Species Adulteration in the Herbal Trade: Causes, Consequences and Mitigation.

The global economy of the international trade of herbal products has been increasing by 15% annually, with the raw material for most herbal products being sourced from South and Southeast Asian countries. In India, of the 8000 species of medicinal plants harvested from the wild, approximately 960 are in the active trade. With increasing international trade in herbal medicinal products, there is also increasing concern about the widespread adulteration and species admixtures in the raw herbal trade. The adverse consequences of such species adulteration on the health and safety of consumers have only recently begun to be recognised and documented. We provide a comprehensive review of the nature and magnitude of species adulteration in the raw herbal trade, and identify the underlying drivers that might lead to such adulteration. We also discuss the possible biological and chemical equivalence of species that are used as adulterants and substitutes, and the consequences thereof to consumer health and safety, and propose a framework for the development of a herbal trade authentication service that can help regulate the herbal trade market.

Estimating Herbal Product Authentication and Adulteration in India Using a Vouchered, DNA-Based Biological Reference Material Library.

INTRODUCTION: India is considered the 'medicinal garden' of the world, with 8000 medicinal plants of which 960 are commercial species that are traded nationally and globally. Although scientific studies estimate herbal product adulteration as 42-66 % in North America, India does not have any published marketplace studies and subsequent estimates of adulteration in an industry facing considerable supply demands. OBJECTIVES: The goal of this project is to provide an initial assessment of herbal product authentication and adulteration in the marketplace in India by (1) developing a biological reference material (BRM) herbal DNA library for Indian herbal species using DNA barcode regions (ITS2 and rbcL) in order to facilitate accurate species resolution when testing the herbal products; and (2) assessing herbal product identification using our BRM library; and (3) comparing the use of our BRM library to identify herbal products with that of GenBank. METHODS: A BRM herbal DNA library consisting of 187 herbal species was prepared to authenticate the herbal products within India. Ninty-three herbal products representing ten different companies were procured from local stores located at Coimbatore, India. These samples were subjected to blind testing for authenticity using the DNA barcode regions rbcL and ITS2. RESULTS: The results indicate that 40 % of the products tested are authentic, and 60 % of the products may be adulterated (i.e. contained species of plants not listed on the product labels). The adulterated samples included contamination (50 %), substitution (10 %) and fillers (6 %). Our BRM library provided a 100 % Basic Local Alignment Search Tool (BLAST) match for all species, whereas the GenBank match was 64 %. CONCLUSIONS: Our findings suggest that most Indian herbal medicinal products are essentially mixed with one or a few other herbs that could lessen the therapeutic activity of the main ingredients. We do not recommend the use of GenBank to identify herbal products because the use of this non-curated and/or vouchered database will result in inaccurate species identification. These DNA-based tools provide a scientific foundation for herbal pharmacovigilance to ensure the safety and efficacy of natural drugs. This study provides curated BRMs that will underpin innovations in molecular diagnostic biotechnology, which will soon provide more robust estimates of adulteration and commercial tools that will strengthen due diligence in quality assurance within the herbal industry.

DNA barcoding and NMR spectroscopy-based assessment of species adulteration in the raw herbal trade of Saraca asoca (Roxb.) Willd, an important medicinal plant.

Saraca asoca (Roxb.) Willd, commonly known as "Asoka" or "Ashoka," is one of the most important medicinal plants used in raw herbal trade in India. The bark extracts of the tree are used in the treatment of leucorrhea and other uterine disorders besides also having anti-inflammatory, anti-bacterial, anti-pyretic, anti-helminthic, and analgesic activity. The indiscriminate and rampant extraction of the wood to meet the ever-increasing market demand has led to a sharp decline in naturally occurring populations of the species in the country. Consequently, the species has recently been classified as "vulnerable" by the International Union for Conservation of Nature (IUCN). Increasing deforestation and increasing demand for this medicinal plant have resulted in a limited supply and suspected widespread adulteration of the species in the raw herbal trade market. Adulteration is a serious concern due to: (i) reduction in the efficacy of this traditional medicine, (ii) considerable health risk to consumers, and (iii) fraudulent product substitution that impacts the economy for the Natural Health Product (NHP) Industry and consumers. In this paper, we provide the first attempt to assess the extent of adulteration in the raw herbal trade of S. asoca using DNA barcoding validated by NMR spectroscopic techniques. Analyzing market samples drawn from 25 shops, mostly from peninsular India, we show that more than 80 % of the samples were spurious, representing plant material from at least 7 different families. This is the first comprehensive and large-scale study to demonstrate the widespread adulteration of market samples of S. asoca in India. These results pose grave implications for the use of raw herbal drugs, such as that of S. asoca, on consumer health and safety. Based on these findings, we argue for a strong and robust regulatory framework to be put in place, which would ensure the quality of raw herbal trade products and reassure consumer confidence in indigenous medicinal systems. Graphical Abstract DNA barcoding and NMR spectroscopy-based assessment of adulteration in Saraca asoca.

DNA Barcoding and Pharmacovigilance of Herbal Medicines.

Pharmacovigilance of herbal medicines relies on the product label information regarding the ingredients and the adherence to good manufacturing practices along the commercialisation chain. Several studies have shown that substitution of plant species occurs in herbal medicines, and this in turn poses a challenge to herbal pharmacovigilance as adverse reactions might be due to adulterated or added ingredients. Authentication of constituents in herbal medicines using analytical chemistry methods can help detect contaminants and toxins, but are often limited or incapable of detecting the source of the contamination. Recent developments in molecular plant identification using DNA sequence data enable accurate identification of plant species from herbal medicines using defined DNA markers. Identification of multiple constituent species from compound herbal medicines using amplicon metabarcoding enables verification of labelled ingredients and detection of substituted, adulterated and added species. DNA barcoding is proving to be a powerful method to assess species composition in herbal medicines and has the potential to be used as a standard method in herbal pharmacovigilance research of adverse reactions to specific products.

Assessing product adulteration in natural health products for laxative yielding plants, Cassia, Senna, and Chamaecrista, in Southern India using DNA barcoding.

Medicinal plants such as Cassia, Senna, and Chamaecrista (belonging to the family Fabaceae) are well known for their laxative properties. They are extensively used within indigenous health care systems in India and several other countries. India exports over 5000 metric tonnes per year of these specific herbal products, and the demand for natural health product market is growing at approximately 10-15% annually. The raw plant material used as active ingredients is almost exclusively sourced from wild populations. Consequently, it is widely suspected that the commercial herbal products claiming to contain these species may be adulterated or contaminated. In this study, we have attempted to assess product authentication and the extent of adulteration in the herbal trade of these species using DNA barcoding. Our method includes four common DNA barcode regions: ITS, matK, rbcL, and psbA-trnH. Analysis of market samples revealed considerable adulteration of herbal products: 50% in the case of Senna auriculata, 37% in Senna tora, and 8% in Senna alexandrina. All herbal products containing Cassia fistula were authentic, while the species under the genus Chamaecrista were not in trade. Our results confirm the suspicion that there is rampant herbal product adulteration in Indian markets. DNA barcodes such as that demonstrated in this study could be effectively used as a regulatory tool to control the adulteration of herbal products and contribute to restoring quality assurance and consumer confidence in natural health products.