[Application progress of clinical outcome assessment measures in patients with gastric cancer].

Gastric cancer is a common tumor of the gastrointestinal tract, and the global trend in morbidity and mortality are not encouraging. Especially in advanced gastric cancer, patient survival outcome is an essential clinical concern and a vital outcome indicator in clinical outcome assessment. This article reviews the definition of clinical outcome assessment and the measurement tools that can be applied in gastric cancer patients, describes the detailed classification of clinical outcome assessment tools, and reviews the current status of the application of clinical outcome assessment in gastric cancer, analyzing the effects and shortcomings of its application, to provide a reference for the clinical staff in choosing the appropriate tools, and assisting in the comprehensive and holistic assessment of clinical outcomes for the promotion of the development of precision medicine.

Effects of dietary methionine supplementation from different sources on growth performance and meat quality of barrows and gilts.

Methionine is indispensable for growth and meat formation in pigs. However, it is still unclear that increasing dietary sulphur-containing amino acid (SAA) levels using different methionine sources affects the growth performance and meat quality of barrows and gilts. To investigate this, 144 pigs (half barrows and half gilts) were fed the control (100% SAA, CON), DL-Methionine (125% SAA, DL-Met)-supplemented, or OH-Methionine (125% SAA, OH-Met)-supplemented diets during the 11-110 kg period. The results showed that plasma methionine levels varied among treatments during the experimental phase, with increased plasma methionine levels observed following increased SAA consumption during the 25-45 kg period. In contrast, pigs fed the DL-Met diet had lower plasma methionine levels than those fed the CON diet (95-110 kg). Additionally, gilts fed the DL-Met or OH-Met diets showed decreased drip loss in longissimus lumborum muscle (LM) compared to CON-fed gilts. OH-Met-fed gilts had higher pH45min values than those fed the CON or DL-Met diets, whereas OH-Met-fed barrows had higher L45min values than those fed the CON or DL-Met diets. Moreover, increased consumption of SAA, regardless of the methionine source, tended to decrease the shear force of the LM in pigs. In conclusion, this study indicates that increasing dietary levels of SAA (+25%) appeared to improve the meat quality of gilts by decreasing drip loss and increasing meat tenderness.

Chondroitin Sulfate Enhances Proliferation and Migration via Inducing ß-Catenin and Intracellular ROS as Well as Suppressing Metalloproteinases through Akt/NF-κB Pathway Inhibition in Human Chondrocytes.

BACKGROUND: Chondroitin sulfate (CS) is found in humans' cartilage, bone, cornea, skin, and arterial wall. It consists of the foundation substance in the extracellular matrix (ECM) of connective tissue. The oral supplement form of CS is clinically used in treating osteoarthritis (OA). METHODS: Cell migration was observed by the transwell assay. The EMT, Akt/IKK/IκB pathways, TIMPs, collagen and MMPs in cell lysate were determined by Western blotting. The expression of MMP activity was determined by gelatin zymography. The production of reactive oxygen species (ROS) was determined by using a fluorescence spectrophotometer. RESULTS: In the current report, we demonstrated that CS can increase the cell proliferation and migration of chon-001 chondrocytes. Treatment with CS induced the epithelial-mesenchymal transition and increased the expression of type II collagen and TIMP-1/TIMP2 and inhibited the expressions and activities of metalloproteinase-9 (MMP-9) and metalloproteinase-2 (MMP-2). The phosphorylation of Akt, IκB kinase (IKK), IκB and p65 was decreased by CS. CS treatment resulted in ß-catenin production and XAV939, a ß-catenin inhibitor, and inhibited the cell proliferation by CS treatment. In addition, also significantly induced intracellular ROS generation. Treatment with antioxidant propyl gallate blocked cell migration induced by CS. CONCLUSION: We demonstrated that CS induced cell proliferation and migration of chondrocytes by inducing ß-catenin and enhancing ROS production. Moreover, our studies demonstrated that CS can increase the activity of chondrocytes and help patients with osteoarthritis to restore cartilage function.

[Research advances in the relationship of dietary factors and prostate cancer risk].

Prostate cancer is the second most common malignancy in men worldwide. An increasing trend for prostate cancer incidence was observed in China. Enormous studies have been conducted to investigate the association between dietary factors and prostate cancer, however conflicted results were obtained. Red meat, processed meat, and dairy products consumption were reported to be associated with the increased prostate cancer risk, while tomatoes, soybeans and green tea might reduce the risk of prostate cancer occurance. However, no consensus could be reached without strong evidence. Furthermore, further studies are needed to investigate the association between vitamin and mineral supplements and prostate cancer risk. Some studies reported that men with higher dietary inflammatory index scores increased prostate cancer risk. There may be a long susceptible period when dietary factors affect prostate cancer risk, which poses challenges for collecting exposure and the follow-up. Measure bias and detection bias are the main reasons which impair the authenticity of studies on the relationship of dietary factors and prostate cancer risk. Researchers should apply various methods to measure participants' dietary consumption levels and ascertain essential outcomes, such as prostate cancer death. This article reviews updated epidemiological evidences on the association of dietary factors and prostate cancer, aims to benefit future nutritional epidemiology studies focus on the prostate cancer prevention.

Effect and possible mechanisms of dioscin on ameliorating metabolic glycolipid metabolic disorder in type-2-diabetes.

BACKGROUND: Our previous study revealed that microRNA-125a-5p plays a crucial role in regulating hepatic glycolipid metabolism by targeting STAT3 in type 2 diabetes mellitus (T2DM). Dioscin, a major active ingredient in Dioscoreae nipponicae rhizomes, displays various pharmacological activities, but its role in T2DM has not been reported. PURPOSE: The aim of this study was to investigate the effect of dioscin on T2DM and elucidate its potential mechanism. METHODS: The effect of dioscin on glycolipid metabolic disorder in insulin-induced HepG2 cells, palmitic acid-induced AML12 cells, high-fat diet- and streptozotocin- induced T2DM rats, and spontaneous T2DM KK-Ay mice were evaluated. Then, the possible mechanisms of dioscin were comprehensively evaluated. RESULTS: Dioscin markedly alleviated the dysregulation of glycolipid metabolism in T2DM by reducing hyperglycemia and hyperlipidemia, improving insulin resistance, increasing hepatic glycogen content, and attenuating lipid accumulation. When the mechanism was investigated, dioscin was found to markedly elevate miR-125a-5p level and decrease STAT3 expression. Consequently, dioscin increased phosphorylation levels of STAT3, PI3K, AKT, GSK-3ß, and FoxO1 and decreased gene levels of PEPCK, G6Pase, SREBP-1c, FAS, ACC, and SCD1, leading to an increase in glycogen synthesis and a decrease in gluconeogenesis and lipogenesis. The effects of dioscin on regulating miR-125a-5p/STAT3 pathway were verified by miR-125a-5p overexpression and STAT3 overexpression. CONCLUSIONS: Dioscin showed potent anti-T2DM activity by improving the inhibitory effect of miR-125a-5p on STAT3 signaling to alleviate glycolipid metabolic disorder of T2DM.

Effects of cold plasma, UV-C or aqueous ozone treatment on Botrytis cinerea and their potential application in preserving blueberry.

AIMS: This study aimed to compare the effects of cold plasma (CP), ultraviolet (UV-C) and aqueous ozone (AO) on Botrytis cinerea and explore their application in preserving blueberry. METHODS AND RESULTS: The effects of CP, UV-C or AO on B. cinerea were investigated. Results showed that three treatments effectively inhibited the growth of B. cinerea, increasing cell membrane penetrability and causing the leakage of cytoplasm and nucleic acid. Scanning electron microscopy showed that CP caused the mycelium fold and collapse depression; UV-C caused the mycelium shrivelled; mycelium treated with AO appeared to fold and break. In the in vivo test in blueberry, all treatments effectively inhibited the growth of micro-organisms, maintained qualities and enhanced antioxidant activities in blueberry during postharvest storage. CONCLUSION: Cold plasma, UV-C and AO effectively inhibited the growth of B. cinerea and significantly extended the shelf life of blueberry. Based on in vitro and in vivo tests, CP showed better effects to preserve blueberry compared with other treatments. SIGNIFICANCE AND IMPACT OF THE STUDY: Our findings revealed the effective mechanisms of CP, UV-C and AO to inhibit B. cinerea in vitro. CP exhibited better application potential to preserve fresh fruit than traditional sterilization methods such as UV-C and AO.

Methionine and valine activate the mammalian target of rapamycin complex 1 pathway through heterodimeric amino acid taste receptor (TAS1R1/TAS1R3) and intracellular Ca2+ in bovine mammary epithelial cells.

Amino acids play a key role in regulating milk protein synthesis partly through activation of the mammalian target of rapamycin (mTOR) signaling pathway. However, the involvement of extracellular AA sensing receptors in this process is not well understood. In nonruminants, it is well established that the AA taste 1 receptor member 1/3 (TAS1R1/TAS1R3) heterodimer contributes to the sensing of most l-AA. Whether this receptor is functional in bovine mammary cells is unknown. The objective of this study was to determine essential AA signaling through TAS1R1/TAS1R3 and their roles in regulating mTOR signaling pathway and casein mRNA abundance in primary bovine mammary epithelial cells and the Mac-T cell line. The bovine mammary epithelial cells were stimulated with complete Dulbecco's modified Eagle's medium (+EAA), medium without EAA (-EAA), or medium supplemented with only 1 of the 10 essential AA, respectively. The nonessential AA levels were the same across all treatments. Small interference RNA targeting TAS1R1 were designed and transfected into bovine primary mammary epithelial cells (bPMEC). Supplementation of a complete mixture of essential AA or Arg, Val, Leu, His, Phe, Met, and Ile individually led to greater mTOR phosphorylation. Phosphorylation of ribosomal protein S6 kinase ß-1 was greater in the presence of Val, Leu, Trp, Met, and Ile. Valine, Leu, Met, and Ile led to greater eIF4E-binding protein 1 phosphorylation. Although +EAA and a few individual AA tested induced increases in intracellular calcium, Met and Val were the most potent. Knockdown of TAS1R1 decreased intracellular calcium in bPMEC cultured with both Val and Met. Phosphorylation of mTOR, ribosomal protein S6 kinase ß-1, and eIF4E-binding protein 1 was lower when TAS1R1 was knocked-down in bPMEC supplemented with Val and Met. In addition, small interference RNA silencing of TAS1R1 resulted in lower ß-casein (CSN2) abundance. The TAS1R1/TAS1R3 receptor may sense extracellular AA and activate mTOR signaling in bovine mammary cells, likely by elevating intracellular calcium concentration. This mechanism appears to have a role in Met- and Val-induced changes in CSN2 mRNA abundance. Further in vivo studies will have to be performed to assess the relevance of this mechanism in the mammary gland.

Methionine deficiency decreases hepatic lipid exportation and induces liver lipid accumulation in broilers.

The objective of the study was to investigate the effects of deficiency or high level addition of methionine (Met) in diet on homocysteine (Hcy) metabolism and hepatic lipid metabolism in broiler. A completely random design was used with 3 dietary treatments with the addition of Met from DL-methionine (DLM) at 0%, 0.22%, and 0.32% in a basal diet. The analyzed dietary Met was 0.271%, 0.485%, and 0.584% respectively for the Met-deficient, sufficient, and excessive diet. A total of 360 one-day-old male Ross 308 broiler chicks were randomly assigned to the treatments. The trial was last for 21 d. Compared to the Met-sufficient diet, the Met-deficient diet significantly resulted the decrease of 1 to 21 d growth performance and the increase of liver ether extract (EE). Compared to the Met-sufficient group, the expression of lipid transport gene apolipoprotein B (APOB) in both Met-deficient and Met-excessive group was decreased (P < 0.05). However, compared to the Met-sufficient group, a decreased of serum low-density lipoprotein cholesterol (LDLC) was only shown in birds fed a Met-deficient diet (P < 0.05). Although the plasma Hcy content was decreased, the expression of Cystathionine ß-synthase (CßS) and hepatic inflammatory cytokines included interleukin-1 (IL-1) and interleukin-8 (IL-8) was significantly decreased in birds fed the Met-deficient diet when compared to those in Met-sufficient group (P < 0.05). When compared to the Met-sufficient group, the broilers in high dietary Met group had increased levels of catabolic enzyme genes expression especially acyl-coenzyme A oxidase 1 (ACOX1) and carbohydrate response element-binding protein (CHREBP) (P < 0.05), and a decreased content of liver EE. In conclusion, dietary Met deficiency decreased the hepatic lipid export and subsequently increased the hepatic lipid accumulation. High dietary Met addition increased the hepatic lipid catabolism and subsequently decreased the liver lipid accumulation.

High-dose dexamethasone or all-trans-retinoic acid restores the balance of macrophages towards M2 in immune thrombocytopenia.

Essentials M1/M2 imbalance is involved in many autoimmune diseases, and could be restored. The expressions and functions of M1 and M2 were investigated in an in vitro culture system. A preferred M1 polarization is involved in the pathogenesis of immune thrombocytopenia (ITP). High-dose dexamethasone or all-trans-retinoic acid restores M1/M2 balance in ITP patients. SUMMARY: Background Immune thrombocytopenia (ITP) is an autoimmune disorder. Deficiency of immune tolerance in antigen-presenting cells and cross-communication between antigen-presenting cells and T cells are involved in the pathogenesis of ITP. Macrophages can polarize into proinflammatory M1 or anti-inflammatory M2 phenotypes in response to different environmental stimuli, and have diverse immunologic functions. Objectives To investigate the M1/M2 imbalance in ITP and whether high-dose dexamethasone (HD-DXM) or all-trans-retinoic acid (ATRA) could restore this imbalance. Methods The numbers of M1 and M2 macrophages in the spleens of ITP patients and patients with traumatic spleen rupture were analyzed by immunofluorescence. Monocyte-derived macrophages were cultured and induced with cytokines and drugs. The expression of M1 and M2 markers and functions of M1 and M2 macrophages before and after modulation by HD-DXM or ATRA were evaluated with flow cytometry and ELISA. Results There was preferred M1 polarization in ITP spleens as compared with healthy controls. Monocyte-derived macrophages from ITP patients had increased expression of M1 markers and impaired immunosuppressive functions. Either HD-DXM or ATRA corrected this imbalance by decreasing the expression of M1 markers and increasing the expression of M2 markers. Moreover, HD-DXM-modulated or ATRA-modulated macrophages suppressed both CD4+ and CD8+ T-cell proliferation and expanded CD4+ CD49+ LAG3+ type 1 T-regulatory cells. HD-DXM or ATRA modulated macrophages to shift the T-cell cytokine profile towards Th2. Treating patients with HD-DXM or ATRA revealed that macrophages induced from responders showed a predominant M2-like phenotype and immunosuppressive function. Conclusions Aberrant macrophage polarization is involved in the pathogenesis of ITP. Either HD-DXM or ATRA is able to correct this imbalance.

Supplementing oregano essential oil to boar diet with strengthened fish oil: Effects on semen antioxidant status and semen quality parameters.

Previous research has shown benefits of dietary fish oil supplementation on semen quality of boars. However, little is known about how antioxidant protects lipid peroxidation on spermatozoa from n-3 polyunsaturated fatty acid (PUFA) addition. This study evaluated the effect of oregano essential oil (OEO) supplementation on semen antioxidant status and semen quality in boars fed a diet enriched with fish oil. Thirty-four mature boars of proven fertility, received daily 2.5 kg basal diet top-dressed with 45 g soybean oil and 15 g fish oil to meet the n-3 PUFA requirement of spermatozoa, randomly allocated to one of four groups supplemented with 100 mg α-tocopheryl acetate kg-1 (control), or 250 or 500 or 750 mg OEO kg-1 for 16 weeks. Semen was collected at weeks 0, 8, 12 and 16 for measurements of sperm production, motion characteristics, sperm α-tocopherol content, antioxidant enzyme activities, reactive oxygen species (ROS), DNA damage (8-hydroxydeoxyguanosine, 8-OHdG), lipoperoxidation (malondialdehyde, MDA) and seminal total antioxidant capacity (TAC). Sperm production and motion characteristics were similar (p > .05) among groups throughout the experimental week 16, but increased (p < .01) with experimental week. Although higher α-tocopherol content and superoxide dismutase (SOD) activities were in OEO group spermatozoa, feeding diet with 500 mg/kg OEO resulted in elevation in seminal TAC, decrease in sperm ROS, MDA and 8-OHdG than control group (p < .05). Overall, these results support the view that oregano essential oil has a positive effect on antioxidant capacity in boar when used fish oil.

A carvacrol-thymol blend decreased intestinal oxidative stress and influenced selected microbes without changing the messenger RNA levels of tight junction proteins in jejunal mucosa of weaning piglets.

Recent studies indicate that intestinal oxidative stress and microbiota imbalance is involved in weaning-induced intestinal dysfunction in piglets. We have investigated the effect of feeding a carvacrol-thymol blend supplemented diet on intestinal redox status, selected microbial populations and the intestinal barrier in weaning piglets. The piglets (weaned at 21 days of age) were randomly allocated to two groups with six pens per treatment and 10 piglets per pen. At weaning day (21 days of age), six piglets were sacrificed before weaning to serve as the preweaning group. The weaned group was fed with a basal diet, while the weaned-CB group was fed with the basal diet supplemented with 100 mg/kg carvacrol-thymol (1 : 1) blend for 14 days. On day 7 post-weaning, six piglets from each group were sacrificed to determine intestinal redox status, selected microbial populations, messenger RNA (mRNA) transcript levels of proinflammatory cytokines and biomarkers of intestinal barrier function. Weaning resulted in intestinal oxidative stress, indicated by the increased concentration of reactive oxygen species and thiobarbituric acid-reactive substances present in the intestine. Weaning also reduced the population of Lactobacillus genus and increased the populations of Enterococcus genus and Escherichia coli in the jejunum, and increased mRNA levels of tumor necrosis factor α (TNF-α), interleukin 1ß and interleukin 6 (IL-6). In addition, decreased mRNA levels of zonula occludens and occludin in the jejunal mucosa and increased plasma diamine oxidase concentrations indicated that weaning induced dysfunction of the intestinal barrier. On day 7 post-weaning, supplementation with the carvacrol-thymol blend restored weaning-induced intestinal oxidative stress. Compared with the weaned group, the weaned-CB group had an increased population of Lactobacillus genus but reduced populations of Enterococcus genus and E. coli in the jejunum and decreased mRNA levels of TNF-α. The results indicated that weaning induced intestinal oxidative stress and dysfunction of the intestinal barrier. Dietary supplementation with 100 mg/kg carvacrol-thymol (1 : 1) decreased the intestinal oxidative stress and influenced selected microbial populations without changing the biomarkers of intestinal barrier in weaning piglets.

Sodium tanshinone IIA sulfonate and its interactions with human CYP450s.

1.Sodium tanshinone IIA sulfonate (STS) is a water-soluble derivative of tanshinone IIA, a famous Chinese medicine used for many years to treat cardiovascular disorders. However, the role of cytochrome P450 (CYP) enzymes in the metabolism of STS was unclear. In this study, we screened the main CYPs for the metabolism of STS and studied their interactions in vitro. 2.Seven CYPs were screened for the metabolism of STS by human liver microsomes (HLMs) or recombinant CYP isoforms. To determine the potential of STS to affect CYP-mediated phase I metabolism in humans, phenacetin (CYP1A2), coumarin (CYP2A6), tolbutamide (CYP2C9), metoprolol (CYP2D6), chlorzoxazone (CYP2E1), S-Mephenytoin (CYP2C19), and midazolam (CYP3A4) were used as the respective probe substrates. Enzyme kinetic studies were performed to investigate the mode of inhibition of the enzyme-substrate interactions. 3.STS inhibited the activity of CYP3A4 in a dose-dependent manner in the HLMs and CYP3A4 isoform. Other CYP isoforms, including CYP1A2, CYP2A6, CYP2C9, CYP2D6, CYP2E1, and CYP2C19, showed minimal or no effect on the metabolism of STS. 4.The results suggested that STS primarily inhibits the activities of CYP3A4 in vitro, and STS has the potential to perpetrate drug-drug interactions with other CYP3A4 substrates.

In vitro and in vivo digestibility of corn starch for weaned pigs: Effects of amylose:amylopectin ratio, extrusion, storage duration, and enzyme supplementation.

The objective of this study was to investigate the effects of amylose (AM):amylopectin (AP) ratio, extrusion, storage duration, and enzyme supplementation on starch digestibility of corn. Three corn varieties with high (0.60; HA), medium (0.44; MA), and low (0.39; LA) AM:AP ratios, respectively, were selected from 74 corn samples to evaluate the in vitro and in vivo digestibility of starch. In Exp. 1, during wk 4 after extrusion, resistant starch (RS) content of the 3 selected corn varieties (LA, MA, and HA) increased (P < 0.05) each week and starch digestibility in vitro decreased as storage time increased (P < 0.05). The AM:AP ratio affected the formation of RS (P < 0.01). The RS content of the 3 corn varieties was ranked as LA < MA < HA in each week (P < 0.05). Correlation analysis showed that AM:AP ratio and storage duration were both positively correlated with RS content (P < 0.01). Furthermore, a significant quadratic relation was found between storage duration and RS content in each corn variety as well as storage duration and digestibility. Starch digestibility was negatively correlated with RS content (P < 0.001). In Exp. 2, digestion trials were performed on cannulated pigs with BW of 13.20 ± 0.94 kg. Extrusion increased ileal digestibility of GE and starch of either HA or LA compared with the enzyme-supplemented diets (P < 0.001). Enzyme supplementation did not improve ileal energy and starch digestibility. The ileal digestibility of starch and GE of LA varieties was greater than HA samples (P < 0.05). The results implied that AM:AP ratio and storage duration after extrusion may be important determinants of RS formation and digestibility of starch for corn. In addition, RS content could be an important indicator of digestibility of starch in extruded corn. Using a lower AM:AP ratio corn or reducing the storage duration of extruded corn would help to reduce the formation of RS and improve the starch bioavailability of corn for piglets.

Effects of dietary n-6:n-3 fatty acid ratio and vitamin E on semen quality, fatty acid composition and antioxidant status in boars.

The aim of the present study was to evaluate the effects of dietary n-6:n-3 fatty acid (FA) ratio and vitamin E on the semen quality, FA composition and antioxidant status of boars. Forty-eight Landrace boars were randomly distributed in a 3×2 factorial design with three n-6:n-3 FA ratios (14.4, 6.6 and 2.2) by the inclusion of three oil sources (soybean, fish/soybean, fish) and two vitamin E levels (200 and 400mg/kg). During the 8 weeks of treatment, semen parameters were evaluated. Serum, sperm and seminal plasma samples were taken at 0 and 8 weeks to monitor the FA composition and antioxidant status. Results showed that the 6.6 and 2.2 dietary ratios very effectively increased docosahexaenoic acid (DHA) and n-3 polyunsaturated fatty acid (PUFA) and decreased docosapentaenoic acid (DPA) and n-6:n-3 ratio in spermatozoa. The 6.6 dietary ratio contributed to a greater progressive sperm motility (P<0.05) than the 14.4 and 2.2 dietary ratio, and this ratio also enhanced the superoxide dismutase (SOD) and total antioxidant capacity (TAC) (P<0.05) in seminal plasma more significantly than the other two ratios at week 8. Compared with 200mg/kg supplementation of vitamin E, 400mg/kg supplementation of vitamin E increased the progressive sperm motility, SOD of sperm, TAC and SOD of seminal plasma and serum, and decreased sperm malondialdehyde (MDA) (P<0.05). In conclusion, the 6.6 dietary ratio and 400mg/kg vitamin E supplementation improve progressive sperm motility by modifying the sperm FA composition and antioxidant status.

Mitochondria-dependent apoptogenic activity of the aqueous root extract of Croton membranaceus against human BPH-1 cells.

Croton membranaceus aqueous root extract (CMARE) is among the widely used phytotherapeutics in Ghana for the management of benign prostatic hyperplasia (BPH) and prostate cancer. However, the mechanism of action of CMARE remains to be elucidated. This study aimed to establish whether apoptosis is involved in the antiproliferative effect of CMARE on human BPH-1 cells. We determined the effect of treatment with 0, 1, 3, and 5 mg/mL CMARE for 24, 48, and 72 h on the viability and morphology of BPH-1 cells using the MMT assay and phase-contrast microscopy, respectively. We examined the apoptosis-inducing effects of CMARE after 48 h at the cellular level using Hoescht 33258 and JC-1 dye staining and flow cytometry analysis. We performed reverse transcription polymerase chain reaction and Western blotting to confirm the apoptotic effects of CMARE at the molecular level. CMARE induced a significant dose-dependent inhibition in the proliferation of BPH-1 cells (P < 0.05) and an alteration in their morphology and a reduction their density. Furthermore, CMARE induced dose-dependent staining of the nuclear chromatin, significant DNA fragmentation with G0/G1 sub-diploid cells (P < 0.01), and loss of the mitochondrial membrane potential in the treated cells compared to the controls after 48 h (P < 0.01). Additionally, while CMARE induced a significant upregulation of the mRNA and protein levels of Bax, those of Bcl2 did not change significantly. Therefore, induction of mitochondria-dependent apoptosis of BPH-1 cells may be a possible mechanism of action of CMARE.

Wide-scale pollen banking of ornamental plants through cryopreservation.

BACKGROUND: Cryopreservation has been proved to be an efficient method for the long-term storage of pollen, based on our previous studies establishing cryo pollen banks for Camellia, Paeonia, and Prunus mume. OBJECTIVE: In the present study, we aimed to extend and verify the applicability of the cryopreservation protocol for ornamental plants. MATERIALS AND METHODS: 71 species or cultivars from 19 families were cryopreserved using the established protocol. RESULTS: Pollen from 60 species or cultivars (85% of those experimented on) retained viability after 1 year's cryopreservation; of these, 36 (51% of the total investigated) retained a sufficiently high germination capability compared with fresh pollen to enable longer term cryopreservation. CONCLUSION: This study confirms that wide-scale pollen banking of ornamental plants is feasible.

First Report of the Root-Knot Nematode Meloidogyne enterolobii Infecting Jujube in China.

Jujube (Ziziphus jujuba Mill.) is an economically-important fruit crop grown in Europe, Australia, and southern/eastern Asia. In China, it is often called red date and the fruit is used in traditional Chinese herbal medicine and wine. In February 2014, jujube plants growing in a sandy soil in Sanya, Hainan Province, China, were observed exhibiting symptoms of decline, including stunting, wilting, and no flowering or fruit set. Roots systems of sick plants (n = 20) had many galls, the typical symptoms of root-knot nematode infection, and the incidence of infection was 100%. These galls were formed in the primary, secondary, and tertiary roots. Meloidogyne spp. females and egg masses were dissected from the symptomatic roots. Each root contained about 72 females on average (n = 20). The perineal patterns of females (n = 10) were oval shaped with moderate to high dorsal arches and mostly lacking obvious lateral lines. Second-stage juveniles (n = 20) had large and triangular lateral lips and broad, bluntly rounded tail tips. These morphological characteristics are the same as those for Meloidogyne enterolobii Yang & Eisenback 1983 (5). Identification was further confirmed after DNA extraction from 12 nematodes. Part of the rDNA spanning the internal transcribed spacer (ITS) 1, 5.8S gene, and ITS2 was amplified with primers V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (4). A 764-bp fragment was amplified, which was 100% identical to sequences of M. enterolobii (GenBank Accession Nos. KJ146863, KF418369, JQ082448, and JX024149) in GenBank. Species identification was confirmed by using PCR to amplify mitochondrial (mt) DNA and rDNA intergenic spacers (IGS) 2 with primers C2F3/1108 (GGTCAATGTTCAGAAATTTGTGG/TACCTTTGACCAATCACGCT) (3) and M. enterolobii specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC), respectively (2). The PCR products were approximately 700 bp for mtDNA and 200 bp for rDNA-IGS2, which were also identical to those previously reported for M. enterolobii (2,3). M. enterolobii is considered as one of the most damaging root-knot nematode species due to its wide host range, high reproduction rate, and ability to overcome the resistance genes (Mi-1, Mh, Mir1, N, Tabasco, and Rk) in several crops (1). It is reported that over 20 plant species from eight families (Annonaceae, Apiaceae, Cucurbitaceae, Convolvulaceae, Fabaceae, Marantaceae, Myrtaceae, and Solanaceae) in China are hosts for M. enterolobii. To our knowledge, this is the first report of jujube as a host of M. enterolobii and the first record of M. enterolobii as a parasite of a plant in the family Rhamnaceae in China. References: (1) P. Castagnone-Sereno. Nematology 14:133, 2002. (2) H. Long et al. Acta Phytopathol. Sinica 36:109, 2006. (3) T. O. Powers and T. S. Harris. J. Nematol. 25:1, 1993. (4) T. C. Vrain et al. Fundam. Appl. Nematol. 15:565, 1992. (5) B. Yang and J. D. Eisenback. J. Nematol. 15:381, 1983.

Effects of konjac flour inclusion in gestation diets on the nutrient digestibility, lactation feed intake and reproductive performance of sows.

This study was conducted to investigate the effects of konjac flour (KF) inclusion in gestation diets of sows on nutrients digestibility, lactation feed intake, reproductive performance of sows and preweaning performance of piglets. Two isoenergetic and isonitrogenous gestation diets were formulated: a control diet and a 2.1% KF-supplemented diet (KF diet). Both diets had the same NDF and insoluble fiber (ISF) levels, but the KF diet had higher soluble fiber (SF) level. The day after breeding, 96 multiparous sows were assigned to the two dietary treatments. Restrict-fed during gestation, in contrast, all sows were offered the same lactation diet ad libitum. Response criteria included sow BW, backfat depth, lactation feed intake, weaning-to-estrus interval, litter size and piglet's weight at parturition and day 21 of lactation. On day 60 of gestation, 20 sows were used to measure nutrient digestibility. Results showed that the digestibility of dry matter, gross energy, crude fiber and ADF were not affected by the dietary treatments. The inclusion of KF in gestation diets increased NDF digestibility (P<0.05) and tended to increase the digestibility of CP (P=0.05) compared with the control diet group. In addition, dietary treatment during gestation did not affect litter size, BW and backfat gain during gestation, lactation weight, backfat loss or weaning-to-estrus interval of sows. However, sows fed the KF diet consumed more (P<0.05) lactation diet per day than sows in the control group. Accordingly, sows fed the KF diet showed greater average piglet weights on day 21 of lactation (P=0.09), and the litter weight of sows fed the KF diet on day 21 of lactation increased by 3.95 kg compared with sows fed the control diet (not significant). In conclusion, the inclusion of KF in gestation diets increased lactation feed intake of sows and tended to improve litter performance.

Development and comparison of a new personalized warfarin stable dose prediction algorithm in Chinese patients undergoing heart valve replacement.

BACKGROUND: Pharmacogenetics-based algorithms would be especially desirable for patients undergoing heart valve replacement (HVR), who are particularly sensitive to warfarin during the initial treatment phase following surgery. We aimed to derive a warfarin dosing algorithm from data of Chinese patients undergoing HVR, and to compare it with previously published dosing algorithms as applied to our HVR patients. METHODS: 641 Chinese HVR patients on stable maintenance dose of warfarin were enrolled from a single clinic site. Data of 321 patients were used to derive a warfarin dosing algorithm using stepwise multiple linear regression analysis. Previously published algorithms were selected from Pubmed database for comparison. The performance of all the algorithms was characterized according to mean absolute error (MAE) and percentage of predicted doses falling within +/- 20% of clinically observed doses (percentage of ideal prediction) in the other 320 patients. RESULTS: The newly developed algorithm included eight factors: VKORC1-1639G > A, CYP2C9*3, BSA, age, number of increasing INR drugs, smoking habit, preoperative stroke history and hypertension. Our algorithm accounted for 56.4% of variations in the inter-patient warfarin stable doses. All the algorithms showed better performance in a medium-dose (1.88-4.38 mg/day) and high-dose (> or = 4.38 mg/day) groupings than in a low-dose (< or = 1.88 mg/day) grouping. Compared with the 14 previously published algorithms, our algorithm had the lowest MAE (-0.07 mg/day) and the highest percentage of ideal prediction (62.8%) in the total validation cohort. CONCLUSIONS: Our warfarin dosing algorithm is potentially useful for patients whose population profiles are similar to those of our patients.

Mechanism of earthquake simulation as a prenatal stressor retarding rat offspring development and chinese medicine correcting the retardation: hormones and gene-expression alteration.

We aimed to investigate the mechanism of shaking as a prenatal stressor impacting the development of the offspring and Chinese medicines correcting the alterations. Pregnant rats were randomized into earthquake simulation group (ESG), herbal group (HG) which received herbal supplements in feed after shaking, and control group (CG). Findings revealed body weight and open field test (OFT) score of ESG offspring were statistically inferior to the CG and HG offspring. The corticosterone levels of ESG were higher than those of CG but not than HG. The dopamine level of ESG was slightly lower than that of the CG and of HG was higher than that of ESG. The 5-HT of ESG was higher than CG and HG. The growth hormone level of the ESG was significantly lower than ESG but not than CG. Gene expression profile showed 81 genes upregulated and 39 genes downregulated in ESG versus CG, and 60 genes upregulated and 28 genes downregulated in ESG versus HG. Eighty-four genes were found differentially expressed in ESG versus CG comparison and were normalized in ESG versus HG. We conclude that maternal shaking negatively affected physical and nervous system development, with specific alterations in neurohormones and gene expression. Chinese herbal medicine reduced these negative outcomes.