RESUMEN
Five undescribed eremophilane-type sesquiterpenes, remophilanetriols E-I (1-5), along with seven known compounds (6-12) were isolated from the fresh roots of Rehmannia glutinosa. Their structures were characterized by extensive spectroscopic data analysis and their absolute configurations were determined by comparing their calculated electronic circular dichroism (ECD) spectra and experimental ECD spectra. The anti-pulmonary fibrosis activities of all compounds were evaluated in vitro by MTT methods, and compounds 2, 8, 10, and 12 exhibited excellent anti-pulmonary fibrosis activities. In addition, compound 2 can reduce the levels of ROS and apoptosis in TGF-ß1-induced BEAS-2B cells.
Asunto(s)
Fitoquímicos , Raíces de Plantas , Rehmannia , Raíces de Plantas/química , Estructura Molecular , Rehmannia/química , Humanos , Fitoquímicos/farmacología , Fitoquímicos/aislamiento & purificación , Sesquiterpenos/farmacología , Sesquiterpenos/aislamiento & purificación , Sesquiterpenos/química , Apoptosis/efectos de los fármacos , Línea Celular , Especies Reactivas de Oxígeno/metabolismo , China , Sesquiterpenos Policíclicos/farmacología , Sesquiterpenos Policíclicos/aislamiento & purificación , Sesquiterpenos Policíclicos/químicaRESUMEN
Salvia miltiorrhiza, a widely used medicinal herb renowned for its properties in promoting blood circulation, removing blood stasis and alleviating pain, is currently facing quality degradation due to excessive heavy metal levels, posing a threat to medication safety. In order to investigate the effects of microbial inoculant, microalgae and biochar on the growth of Salvia miltiorrhiza under copper (Cu) stress, as well as its Cu absorption, antioxidant activity, active component contents and rhizosphere microbial community, a pot experiment was conducted. Salvia miltiorrhiza plants were cultivated in the soil containing 400 mg/kg of Cu for six months and treated with microbial inoculant, microalgae and biochar, either individually or in combination. Almost all soil amendment treatments led to an increase in root biomass. Notably, co-application of microbial inoculant and microalgae had the optimal effect with a 63.07 % increase compared to the group treated solely with Cu. Moreover, when microbial inoculant was applied alone or in combination with microalgae, the Cu content in plant roots was reduced by 19.29 % and 25.37 %, respectively, whereas other treatments failed to show a decreasing trend. Intriguingly, Cu stress increased the active component contents in plant roots, and they could also be enhanced beyond non-stress levels when microbial inoculant and microalgae were applied together or in combination with biochar. Analyses of plant antioxidant activity, soil properties and rhizosphere microorganisms indicated that these amendments may alleviate Cu stress by enhancing peroxidase activity, facilitating plant nutrient absorption, and enriching beneficial microorganisms capable of promoting plant growth and mitigating heavy metal-induced damage. This study suggests that the combined application of microbial inoculant and microalgae can reduce Cu levels in Salvia miltiorrhiza while enhancing its quality under Cu stress.
Asunto(s)
Inoculantes Agrícolas , Microalgas , Salvia miltiorrhiza , Rizosfera , Antioxidantes/metabolismo , Salvia miltiorrhiza/metabolismo , Carbón Orgánico/metabolismo , Suelo , Cobre/toxicidad , Cobre/metabolismoRESUMEN
BACKGROUND: Perimenopausal insomnia (PMI) has a high global incidence, which is common in middle-aged women and is more severe than nonmenopausal insomnia. Effective treatments with fewer side effects and more consistent repeatable results are needed. Acupuncture, a therapy based on traditional Chinese medicine, is safe and may be effective for PMI. It is widely accepted in Western countries, and evidence supports the use of acupuncture as a main or supplementary therapy. Cognitive behavioral therapy is also used to improve sleep quality. It has structured sessions and has been recommended as a first-line treatment for insomnia (cognitive behavioral therapy for insomnia [CBT-I]) by the American Association of Physicians. However, few randomized controlled trials have been conducted to compare the effectiveness of these 2 therapies. This study will be performed in perimenopausal women with insomnia to determine the efficacy of electroacupuncture (EA) versus CBT-I. OBJECTIVE: This study aimed to compare the preliminary effectiveness and safety of EA and CBT-I for PMI through a randomized controlled noninferiority study design. METHODS: This study is designed as an assessor-blinded, noninferiority, randomized controlled trial. A total of 160 eligible participants with PMI will be randomly divided into 2 groups to receive either EA or CBT-I. Participants in the EA group will receive electroacupuncture for 8 weeks. The intervention will be delivered 3 times weekly for a total of 12 sessions and 2 times weekly for the next 4 weeks. Meanwhile, participants in the control group will undergo CBT-I (once a week) for 8 weeks. Treatment will use 7 main acupoints (GV20, DU24, EX-HN3, EX-HN18, EX-CA1, RN6, and RN4) and an extra 4 acupoints based on syndrome differentiation. The primary outcome is the Insomnia Severity Index. The secondary outcome measures are the Pittsburgh Sleep Quality Index; Menopause-Specific Quality of Life; Menopause Rating Scale; Hamilton Depression Scale; Hamilton Anxiety Scale; hot flash score; and the level of estradiol, follicle-stimulating hormone, and luteinizing hormone in serum. Sleep architecture will be assessed using polysomnograms. RESULTS: Participants are currently being recruited. The first participant was enrolled in January 2023, marking the initiation of the recruitment phase. The recruitment process is expected to continue until January 2025, at which point data collection will commence. CONCLUSIONS: This trial represents a pioneering effort to investigate the efficacy and safety of EA and CBT-I as interventions for PMI. It is noteworthy that this study is conducted solely within a single center and involves Chinese participants, which is a limitation. Nonetheless, the findings of this study are expected to contribute valuable insights for clinicians engaged in the management of PMI. TRIAL REGISTRATION: Chinese Clinical Trial Registry ChiCTR2300070981; https://www.chictr.org.cn/showprojEN.html?proj=194561. INTERNATIONAL REGISTERED REPORT IDENTIFIER (IRRID): DERR1-10.2196/51767.
RESUMEN
Trace elements play a crucial role in the growth and bioactive substance content of medicinal plants, but their utilization efficiency in soil is often low. In this study, soil and Aconitum carmichaelii samples were collected and measured from 22 different locations, followed by an analysis of the relationship between trace elements and the yield and alkaloid content of the plants. The results indicated a significant positive correlation between zinc, trace elements in the soil, and the yield and alkaloid content of A. carmichaelii. Subsequent treatment of A. carmichaelii with both bulk zinc oxide (ZnO) and zinc oxide nanoparticles (ZnO NPs) demonstrated that the use of ZnO NPs significantly enhanced plant growth and monoester-type alkaloid content. To elucidate the underlying mechanisms responsible for these effects, metabolomic analysis was performed, resulting in the identification of 38 differentially expressed metabolites in eight metabolic pathways between the two treatments. Additionally, significant differences were observed in the rhizosphere bacterial communities, with Bacteroidota and Actinobacteriota identified as valuable biomarkers for ZnO NP treatment. Covariation analysis further revealed significant correlations between specific microbial communities and metabolite expression levels. These findings provide compelling evidence that nanoscale zinc exhibits much higher utilization efficiency compared to traditional zinc fertilizer.
Asunto(s)
Aconitum , Alcaloides , Microbiota , Oligoelementos , Óxido de Zinc , Óxido de Zinc/farmacología , Rizosfera , Zinc , Bacterias , SueloRESUMEN
Three pairs of undescribed diarylpentanoid enantiomers (1-3) and five undescribed phenylpropanoids (4-8), along with seven known compounds, were isolated from the roots of Anthriscus sylvestris. The structures of compounds (1-8) were determined by analysis of their 1D and 2D NMR spectra, HRESIMS, and electronic circular dichroism. In addition, the inhibitory activities against hypoxia-stimulated pulmonary arterial smooth muscle cells abnormal proliferation were evaluated by MTT assay. The mRNA expression levels of Bcl-2, BAX, Caspase3, and IL-6 were detected by quantitative real-time PCR. The results showed that compounds (-)-1, (+)-1, (-)-2, (+)-3, 4, 8-10, 14, and 15 inhibited the abnormal proliferation of PASMCs by regulating the levels of apoptosis and inflammatory factors.
Asunto(s)
Apiaceae , Extractos Vegetales , Extractos Vegetales/química , Arteria Pulmonar , Proliferación CelularRESUMEN
Vaccariae Semen, derived from the dried ripe seed of Vaccaria segetalis (Neck.) Garcke, has various therapeutic characteristics in traditional Chinese medicine (TCM), containing promoting blood circulation and unblocking meridians. It exhibits significant anti-cancer activity and is therapeutically utilized to treat and reduce chemotherapy adverse effects in cancer patients, notably those with lung cancer. However, the active ingredients responsible for its anti-lung cancer efficacy remain unknown. In this study, we used A549 cell fishing in conjunction with UHPLC-LTQ Orbitrap MS to screen for anti-lung cancer active components in Vaccariae Semen. The cell counting Kit-8 (CCK-8) assay revealed that the n-butanol extract substantially reduced A549 cell growth. Through the cell fishing assay, we found 14 A549 cell-binding compounds in the n-butanol extract, all of which were identified as triterpenoid saponins. The total saponins of Vaccariae Semen were subsequently purified using macroporous adsorption resin (MAR), and they showed a significant inhibitory effect on the proliferation of A549 lung cancer cells, as well as alterations in cell morphology, apoptosis, and fragmentation. In conclusion, saponins were discovered as the key active components responsible for the anti-lung cancer activity of Vaccariae Semen.
Asunto(s)
Detección Precoz del Cáncer , Neoplasias Pulmonares , Humanos , 1-Butanol , Células A549 , Cromatografía Líquida de Alta Presión , Neoplasias Pulmonares/tratamiento farmacológico , SemillasRESUMEN
Introduction: The Aristolochia, as an important genus comprised of over 400 species, has attracted much interest because of its unique chemical and pharmacological properties. However, the intrageneric taxonomy and species identification within Aristolochia have long been difficult because of the complexity of their morphological variations and lack of high-resolution molecular markers. Methods: In this study, we sampled 11 species of Aristolochia collected from distinct habitats in China, and sequenced their complete chloroplast (cp) genomes. Results: The 11 cp genomes of Aristolochia ranged in size from 159,375bp (A. tagala) to 160,626 bp (A. tubiflora), each containing a large single-copy (LSC) region (88,914-90,251 bp), a small single-copy (SSC) region (19,311-19,917 bp), and a pair of inverted repeats (IR) (25,175-25,698 bp). These cp genomes contained 130-131 genes each, including 85 protein-coding genes (CDS), 8 ribosomal RNA genes, and 37-38 transfer RNA genes. In addition, the four types of repeats (forward, palindromic, reverse, and complement repeats) were examined in Aristolochia species. A. littoralis had the highest number of repeats (168), while A. tagala had the lowest number (42). The total number of simple sequence repeats (SSRs) is at least 99 in A. kwangsiensis, and, at most, 161 in A. gigantea. Interestingly, we detected eleven highly mutational hotspot regions, including six gene regions (clpP, matK, ndhF, psbT, rps16, trnK-UUU) and five intergenic spacer regions (ccsA-ndhD, psbZ-trnG-GCC, rpl33-rps18, rps16-trnQ-UUG, trnS-GCU-trnG-UCC). The phylogenetic analysis based on the 72 protein-coding genes showed that 11 Aristolochia species were divided into two clades which strongly supported the generic segregates of the subgenus Aristolochia and Siphisia. Discussion: This research will provide the basis for the classification, identification, and phylogeny of medicinal plants of Aristolochiaceae.
RESUMEN
Seven new diterpenoids quinones (1-6), together with five known ones (7-11), were isolated from the roots of Salvia miltiorrhiza Bunge. Their structures were elucidated by using 1D and 2D NMR data, while the relative and absolute configurations were confirmed by interpretations of the NOESY correlations and comparison of the experimental and calculated ECD spectra. In the evaluation of bioactivities, salviamilthiza C (3), significantly increased cell viability and decreased the expression of IL-1ß in LPS-induced BEAS-2B cells.
Asunto(s)
Diterpenos , Salvia miltiorrhiza , Salvia , Salvia miltiorrhiza/química , Quinonas/farmacología , Estructura Molecular , Diterpenos/farmacología , Diterpenos/química , Pulmón , Raíces de Plantas/química , Salvia/químicaRESUMEN
Reynoutria multiflora roots are a classical herbal medicine with unique nourishing therapeutic effects. Anomalous vascular bundle (AVB) forming "cloudy brocade patterns" is a typical morphological feature of R. multiflora roots and has been empirically linked to its quality classification. However, scientific evidence, especially for AVB-specific specialised metabolites, has not been comprehensively revealed thus far. Herein, desorption electrospray ionization-mass spectrometry imaging (DESI-MSI) analysis was applied to carry out an in situ analysis of specialised metabolites distributed specifically at the AVB and cork of R. multiflora roots. To enlarge the scope of compounds by DESI detection, various solvent systems including acetone, acetonitrile, methanol, and water were used to assist in the discoveries of 40 specialised metabolites with determined localization. A series of bioactive constituents including stilbenes, flavonoids, anthraquinones, alkaloids, and naphthalenes were found specifically around the brocade patterns. Notably, phospholipids were detected from R. multiflora roots by in situ analysis for the first time and were found mainly in the phloem of AVB (PAB). This is the first study to use gradient solvent systems in DESI-MSI analysis to locate the specialised metabolites distribution. The discovery of feature-specific compounds will bridge the empirical identification to precision quality control of R. multiflora roots.
Asunto(s)
Alcaloides , Espectrometría de Masa por Ionización de Electrospray , Espectrometría de Masa por Ionización de Electrospray/métodos , Reynoutria , Solventes , AguaRESUMEN
INTRODUCTION: Eleutherococcus senticosus fruit (ESF) is a natural health supplement resource that has been extensively applied as a tonic for the nervous system. The structures and neural bioactivities of triterpenoid saponins (TS), which are the major constituents of ESF, have not been comprehensively analyzed thus far. OBJECTIVE: We conducted a complete in-depth MS/MS molecular networking (MN)-based targeted analysis of TS from the crude extract of ESF and investigated its neuroprotective value. METHODS: An MS/MS MN-guided strategy was used to rapidly present a series of precursor ions (PIs) of TS in a compound cluster as TS-targeted information used in the discovery and characterization of TS. In addition, a prepared TS-rich fraction of ESF was assayed for its restraining effects on ß-amyloid-induced inhibition of neurite outgrowth. RESULTS: A total of 87 TS were discovered using a PI tracking strategy, 28 of which were characterized as potentially undescribed structures according to their high-resolution MS values. Furthermore, the TS-rich fraction can significantly reduce ß-amyloid-induced damage to neural networks by promoting the outgrowth of neurites and axons. CONCLUSION: Our findings reveal the richness of TS in ESF and will accelerate their application in the treatment of neurodegenerative diseases.
Asunto(s)
Eleutherococcus , Saponinas , Triterpenos , Espectrometría de Masas en Tándem , Extractos Vegetales/química , Eleutherococcus/química , Saponinas/química , Frutas/química , Triterpenos/análisisRESUMEN
Medicinal plants (MPs) are important resources widely used in the treatment and prevention of diseases and have attracted much attention owing to their significant antiviral, anti-inflammatory, antioxidant and other activities. However, soil degradation, caused by continuous cropping, excessive chemical fertilizers and pesticide residues and heavy metal contamination, seriously restricts the growth and quality formation of MPs. Microorganisms, as the major biota in soil, play a critical role in the restoration of the land ecosystem. Rhizosphere microecology directly or indirectly affects the growth and development, metabolic regulation and active ingredient accumulation of MPs. Microbial resources, with the advantages of economic efficiency, harmless to environment and non-toxic to organisms, have been recommended as a promising alternative to conventional fertilizers and pesticides. The introduction of beneficial microbes promotes the adaptability of MPs to adversity stress by enhancing soil fertility, inhibiting pathogens and inducing systemic resistance. On the other hand, it can improve the medicinal quality by removing soil pollutants, reducing the absorption and accumulation of harmful substances and regulating the synthesis of secondary metabolites. The ecological and economic benefits of the soil microbiome in agricultural practices are increasingly recognized, but the current understanding of the interaction between soil conditions, root exudates and microbial communities and the mechanism of rhizosphere microecology affecting the secondary metabolism of MPs is still quite limited. More research is needed to investigate the effects of the microbiome on the growth and quality of different medicinal species. Therefore, the present review summarizes the main soil issues in medicinal plant cultivation, the functions of microbes in soil remediation and plant growth promotion and the potential mechanism to further guide the use of microbial resources to promote the ecological cultivation and sustainable development of MPs.
RESUMEN
Nerium oleander is one of the most poisonous plants, and its accidental ingestion has frequently occurred in humans and livestock. It is vital to develop a rapid and accurate identification method for the timely rescue of oleander-poisoned patients and the investigation of poisoning cases. In this study, a specific and highly sensitive quantitative real-time PCR (qPCR)-based method was developed to identify oleander in mixture systems and simulated forensic specimens (SFS). First, a new pair of oleander-specific primers, JZT-BF/BR, was designed and validated. Then, a qPCR method was developed using the primers, and its detective sensitivity was examined. The results showed that JZT-BF/BR could specifically identify oleander in forage and food mixtures, and qPCR was capable of accurate authentication even at a low DNA concentration of 0.001 ng/µL. This method was further applied to the analysis of SFS containing different ratios of N. oleander. The method was confirmed to be applicable to digested samples, and the detection limit reached 0.1% (w/w) oleander in mixture systems. Thus, this study undoubtedly provides strong support for the detection of highly toxic oleander and the diagnosis of food poisoning in humans and animals.
Asunto(s)
Nerium , Venenos , Animales , Humanos , Nerium/genética , Reacción en Cadena en Tiempo Real de la Polimerasa , Plantas Tóxicas , Cartilla de ADN/genéticaRESUMEN
Eleutherococcus senticosus is a medicinal plant widely used in traditional medicine and edible remedies with effects on anti-fatigue, sleep improvement, and memory enhancement. Recently, the application of E. senticosus to neurological disorders has been a focus. However, its overall pharmacological effect on neural diseases and relevant mechanisms are needed in an in-depth summary. In this review, the traditional uses and the therapeutic effect of E. senticosus on the treatment of fatigue, depression, Alzheimer's disease, Parkinson's disease, and cerebral ischemia were summarized. In addition, the underlying mechanisms involved in the anti-oxidative damage, anti-inflammation, neurotransmitter modulation, improvement of neuronal growth, and anti-apoptosis were discussed. This review will accelerate the understanding of the neuroprotective effects brought from the E. senticosus, and impetus its development as a phytotherapy agent against neurological disorders.
Asunto(s)
Eleutherococcus , Enfermedades del Sistema Nervioso , Plantas Medicinales , Antiinflamatorios/farmacología , Enfermedades del Sistema Nervioso/tratamiento farmacológico , Fitoterapia , Extractos Vegetales/farmacología , Extractos Vegetales/uso terapéuticoRESUMEN
Calcium-dependent protein kinase (CDPK) is a Ca2+ sensor that can phosphorylate and regulate respiratory burst oxidase homolog (Rboh), inducing the production of O2-. However, little is known about how StCDPK23 affects ROS production in the deposition of suberin at potato tuber wounds by regulating StRbohs. In this study, we found that StCDPK23 was induced significantly by the wound in potato tubers, which contains a typical CDPK structure, and was highly homologous to AtCDPK13 in Arabidopsis. Subcellular localization of results showed that StCDPK23 was located in the nucleus and plasma membrane of N. benthamiana epidermis cells. StCDPK23-overexpressing plants and tubers were obtained via Agrobacterium transformation. The expression of StCDPK23 was significantly upregulated in the overexpressing tubers during healing and increased 2.3-fold at 5 d. The expression levels of StRbohs (A-E) were also upregulated in the overexpressing tubers. Among them, StrbohA showed significant expression in the early stage of healing, which was 16.3-fold higher than that of the wild-type tubers at 8 h of healing. Moreover, the overexpressing tubers produced more O2- and H2O2, which are 1.1-fold and 3.5-fold higher than that of the wild-type at 8 h, respectively. More SPP deposition was observed at the wounds of the overexpressing tubers. The thickness of SPP cell layers was 53.2% higher than that of the wild-type after 3 d of the wound. It is suggested that StCDPK23 may participate in the wound healing of potato tubers by regulating Strbohs, which mainly contributes to H2O2 production during healing.
Asunto(s)
Solanum tuberosum , Peróxido de Hidrógeno/metabolismo , Proteínas de Plantas/genética , Proteínas de Plantas/metabolismo , Tubérculos de la Planta/genética , Tubérculos de la Planta/metabolismo , Solanum tuberosum/metabolismo , Cicatrización de Heridas/genéticaRESUMEN
OBJECTIVE: Hypophosphatemia might cause respiratory and heart failure and even death. We aimed to evaluate risk factors for hypophosphatemia and refeeding-related hypophosphatemia in patients requiring parental nutrition (PN). METHODS: This was a single-center, retrospective study. Clinical parameters were obtained from medical records. Serum phosphate (inorganic phosphorus) was measured by photometric analysis. Hypophosphatemia was confirmed when serum phosphate level was less than 0.8 mmol/L (≈2.5 mg/dl). Refeeding related hypophosphatemia was confirmed if serum phosphate level had a decrease of 0.16 mmol/L or more from baseline and if the final assessment was below 0.65 mmol/L. RESULTS: A total number of 655 (426 men and 229 women, aged 62.8 ± 14.8 years) hospitalized patients requiring PN were included in the study, and 60.6% of them were patients with cancer. The average body mass index (BMI) was 21.1 ± 4.1 kg/m2 and the median of serum phosphate was 0.9 mmol/L (quartile range: 0.68 mmol/L, 1.11 mmol/L). The prevalence of hypophosphatemia was 37.6% (246/655). Older age (≥ 65 years vs. < 65 years), lower serum level of pre-albumin (< 160 mg/L vs. ≥ 160 mg/L), calcium (< 2.11 mmol/L vs. ≥ 2.11 mmol/L), and magnesium (< 0.75 mmol/L vs. ≥ 0.75 mmol/L) were associated with high risk of hypophosphatemia by multivariate logistic regression (OR ranged from 1.43 to 3.06, all p < 0.05). Refeeding related hypophosphatemia was 9.5% (16/168). Serum level of calcium at baseline was significantly lower in participants with refeeding related hypophosphatemia than those without it. Total calorie and nitrogen delivered during first week of PN period showed no obvious difference between patients with and without refeeding related hypophosphatemia. CONCLUSIONS: Hypophosphatemia is common (37.6%) in hospitalized patients requiring PN. Monitoring of serum level of phosphorus is necessary to facilitate early treatment of hypophosphatemia.
Asunto(s)
Calcio , Hipofosfatemia , Calcio/uso terapéutico , Femenino , Humanos , Hipofosfatemia/epidemiología , Hipofosfatemia/etiología , Masculino , Padres , Fosfatos/uso terapéutico , Fósforo/uso terapéutico , Prevalencia , Estudios RetrospectivosRESUMEN
Chinese patent medicines (CPMs) are of great value for the prevention and treatment of diseases. However, adulterants and pesticide residues in CPMs have become the "bottleneck" impeding the globalization of traditional Chinese medicine. In this study, 12 batches of commercially available Qipi pill (a famous CPM recorded in Chinese Pharmacopeia) from different manufacturers were investigated to evaluate their authenticity and quality safety. Considering the severely degraded DNA in CPMs, kompetitive allele specific PCR (KASP) technology combined with DNA mini-barcodes was proposed for the quality regulation of a large number of products in CPM market. The residues of four kinds of pesticides including pentachloronitrobenzene (PCNB), hexachlorocyclohexane (HCH), aldrin, and dichlorodiphenyltrichloroethane (DDT) were quantified using gas chromatography and tandem mass spectrometry (GC-MS/MS). The results indicated that in two of the 12 batches of Qipi pill, the main herbal ingredient Panax ginseng was completely substituted by P. quinquefolius, and one sample was partially adulterated with P. quinquefolius. The PCNB residue was detected in 11 batches of Qipi pill, ranging from 0.11 to 0.46 mg/kg, and the prohibited pesticide HCH was present in four samples. Both adulteration and banned pesticides were found in two CPMs. This study suggests that KASP technology combined with DNA mini-barcodes can be used for the quality supervision of large sample size CPMs with higher efficiency but lower cost. Our findings also provide the insight that pesticide residues in CPMs should be paid more attention in the future.
RESUMEN
Ephedra plants generally contain ephedrine alkaloids, which are the critical precursor compounds of methamphetamine (METH). METH could cause serious physical and mental damage, and therefore Ephedra materials are strictly in supervision internationally. However, unlawful utilization of Ephedra herbs and its products still exist. Thus, it is imperative to establish a universal method for monitoring Ephedra ingredients in complex mixtures and processed products. In this study, 224 ITS2 sequences representing 59 taxa within Ephedra were collected, and a 23-bp genus-level nucleotide signature (GTCCGGTCCGCCTCGGCGGTGCG) was developed for the identification of the whole genus. The specific primers MH-1F/1R were designed, and 125 individuals of twelve Ephedra species/varieties were gathered for applicability verification of the nucleotide signature. Additionally, seven batches of Chinese patent medicines containing Ephedra herbs were used to test the application of the nucleotide signature in complex and highly processed materials. The results demonstrated that the 23-bp molecular marker was unique to Ephedra and conserved within the genus. It can be successfully utilized for the detection of Ephedra components in complex preparations and processed products with severe DNA degradation. The method developed in this study could undoubtedly serve as a strong support for the supervision of illegal circulation of Ephedra-containing products.
Asunto(s)
Alcaloides , Ephedra , Metanfetamina , Alcaloides/metabolismo , Ephedra/genética , Ephedra/metabolismo , Efedrina/metabolismo , Humanos , Nucleótidos , Extractos VegetalesRESUMEN
Taxifolin is a bioflavonoid which has been used to treat Inflammatory Bowel Disease. However, taxifolin on DSS-induced colitis and gut health is still unclear. Here, we studied the effect of taxifolin on DSS-induced intestinal mucositis in mice. We measured the degree of intestinal mucosal injury and inflammatory response in DSS treated mice with or without taxifolin administration and studied the changes of fecal metabolites and intestinal microflora using 16S rRNA. The mechanism was further explored by fecal microbiota transplantation. The results showed that the weight loss and diarrhea score of the mice treated with taxifolin decreased in DSS-induced mice and longer colon length was displayed after taxifolin supplementation. Meanwhile, the expression of GPR41 and GPR43 in the colon was significantly increased by taxifolin treatment. Moreover, the expression of TNF-α, IL-1ß, and IL-6 in colon tissue was inhibited by taxifolin treatment. The fecal metabolism pattern changed significantly after DSS treatment, which was reversed by taxifolin treatment. Importantly, taxifolin significantly increased the levels of butyric acid and isobutyric acid in the feces of DSS-treated mice. In terms of gut flora, taxifolin reversed the changes of Akkermansia, and further decreased uncultured_bacterium_f_Muribaculaceae. Fecal transplantation from taxifolin-treated mice showed a lower diarrhea score, reduced inflammatory response in the colon, and reduced intestinal mucosal damage, which may be related to the increased level of butyric acid in fecal metabolites. In conclusion, this study provides evidence that taxifolin can ameliorate DSS-induced colitis by altering gut microbiota to increase the production of SCFAs.
Asunto(s)
Colitis Ulcerosa , Microbioma Gastrointestinal , Animales , Ácido Butírico/farmacología , Colitis Ulcerosa/inducido químicamente , Colitis Ulcerosa/tratamiento farmacológico , Colitis Ulcerosa/metabolismo , Sulfato de Dextran/farmacología , Ratones , Quercetina/análogos & derivados , ARN Ribosómico 16SRESUMEN
Baiyangdian Lake is the largest shallow lake in the North China Plain. Due to the increases in upstream water consumption in recent decades, the amount of natural water entering the lake has decreased, resulting in a significant drop in the water level of Baiyangdian Lake. Severe eutrophication has occurred in Baiyangdian Lake owing to the discharge of domestic sewage around the sub-lakes. With the establishment of the Xiong'an New Area in 2017, the importance of environmental governance and protection of Baiyangdian Lake has been unprecedentedly increased. The implementation of ecological water supplement from upstream reservoirs and other basins has significantly increased water level of Baiyangdian Lake. Moreover, domestic sewage from surrounding rural areas was collected. In order to understand the current state of water quality in Baiyangdian Lake, and to evaluate the effects of the previous water replenishment and pollution control projects, we investigated water physicochemical variables and aquatic organisms of Baiyangdian Lake in August 2019. We evaluated water quality status of Baiyangdian Lake based on water quality, phytoplankton, zooplankton and macrozoobenthos, by comparing with the evaluation based on the survey data in 2010. In addition, submerged macrophytes were used to evaluate the water ecological status. The results showed that the water quality state of Baiyangdian Lake in 2019 was greatly improved compared with 2010. Among them, total phosphorus concentration decreased by 88.6%, total nitrogen concentration decreased by 83.9%, chlorophyll a concentration decreased by 47.8%, and the Seechi depth increased by 43.4%. The diversity of zooplankton and macrozoobenthos were significantly increased, the density of phytoplankton was significantly reduced, the dominant species of phytoplankton changed from a general highly eutrophic type to a eutrophic type, and the distribution of the clean-type submerged macrophytes was narrowed. The evaluation methods based on submerged macrophytes species and based on zooplankton diversity were not suitable for water quality evaluation in Baiyangdian Lake. In the early stage, the pollution source of Baiyangdian Lake was concentrated in the west, which led to lower water quality. Nowadays, due to the water replenishment from the west, north and south, the hydrodynamic conditions changed significantly. In the west, pollution control projects were carried out, and the spatial distribution of water quality in Baiyangdian Lake are showing a characteristics of homogenization.
Asunto(s)
Conservación de los Recursos Naturales , Lagos , China , Clorofila A , Monitoreo del Ambiente , Política Ambiental , Eutrofización , Fósforo/análisis , Fitoplancton , Calidad del AguaRESUMEN
Drug affinity responsive target stability (DARTS) is a novel target discovery approach and is particularly adept at screening small molecule (SM) targets without requiring any structural modifications. The DARTS method is capable of revealing drug-target interactions from cells or tissues by tracking changes in the stability of proteins acting as receptors of bioactive SMs. Due to its simple operation and high efficiency, the DARTS method has been applied to uncover the drug-action mechanism. This review summarized analytical principles, protocols, validation approaches, applications, and challenges involved in the DARTS method. Due to the innate advantages of the DARTS method, it is expected to be a powerful tool to accelerate SM target discovery, especially for bioactive natural products with unknown mechanisms.