Fire acupuncture for plaque psoriasis case series.

OBJECTIVE: To investigate the clinical efficacy of fire acupuncture (FA) on plaque psoriasis (PP), exploring its suitable syndrome types, in order to achieve better therapeutic effects, accelerate the possibility of psoriasis skin lesion recovery, and provide assistance for clinical treatment. METHODS: A total of 8 patients with PP aged between 18 and 60 years were recruited and treated with FA once a week, and the lesion area and severity index (PASI), visual analog scale and pruritus were measured before, 2, 4 and 8 weeks after treatment and at the follow-up period (week 12), respectively. Visual analog scale, and dermoscopy were used for assessment. RESULTS: All patients showed improvement in pruritus after 1 FA treatment, and lesions were reduced to varying degrees after 2 weeks. Except for patients 5 and 8, who only achieved effective results due to severe disease, all other patients with psoriasis achieved significant results at 8 weeks after treatment. CONCLUSION: FA can significantly control the development of lesions, reduce the symptoms of PP lesions and pruritus, and help prevent psoriasis recurrence.

Structural and Compositional Changes in Two Marine Shell Traditional Chinese Medicines: A Comparative Analysis Pre- and Post-Calcination.

BACKGROUND: Arcae concha and Meretricis concha cyclinae concha are two marine shellfish herbs with similar composition and efficacy, which are usually calcined and used clinically. OBJECTIVE: This study investigated variations in the inorganic and organic components of Arcae concha and Meretricis concha cyclinae concha from different production regions, both Arcae concha and Meretricis concha cyclinae concha. The aim was to enhance the understanding of these two types of marine shell traditional Chinese medicine (msTCM) and provide a foundation for their future development and application. METHOD: Spectroscopic techniques, including infrared spectroscopy, X-ray spectroscopy, and X-ray fluorescence spectroscopy, were used to analyze the calcium carbonate (CaCO3) crystal and trace elements. Thermogravimetric analysis was used to investigate the decomposition process during heating. The proteins were quantified using the BCA protein assay kit. Principal component analysis (PCA) was used to classify inorganic elements in the two marine shellfish traditional Chinese medicines. RESULTS: No significant differences were found among the various production regions. The crystal structure of CaCO3 in the raw products was aragonite, but it transformed into calcite after calcination. The contents of Ca, Na, Sr, and other inorganic elements were highest. The protein content was significantly reduced after calcination. Therefore, these factors cannot accurately reflect the internal quality of TCM, rendering qualitative identification challenging. CaCO3 dissolution in the decoction of Arcae concha and Meretricis concha cyclinae concha increased after calcination, aligning with the clinical application of calcined shell TCM. PCA revealed the inorganic elements in them, indicating that the variation in trace element composition among different drugs leads to differences in their therapeutic focus, which should be considered during usage. CONCLUSIONS: This study clarifies the composition and structure changes of corrugated and clam shell before and after calcining, and it lays the foundation for the comprehensive utilization of marine traditional Chinese medicine. HIGHLIGHTS: These technical representations reveal the differences between raw materials and processed products, which will provide support for the quality control of other shellfish TCM.

The modern scientific mystery of traditional Chinese medicine processing--take some common traditional Chinese medicine as examples.

The processing of traditional Chinese medicine (TCM) is a unique traditional pharmaceutical technology in China, which is the most important feature that distinguishes Chinese medicine from natural medicine and plant medicine. Since the record in Huangdi Neijing (Inner Canon of the Yellow Emperor), till now, the processing of TCM has experienced more than 2000 years of inheritance, innovation, and development, which is a combination of TCM theory and clinical practice, and plays an extremely important position in the field of TCM. In recent years, as a clinical prescription of TCM, Chinese herbal pieces have played a significant role in the prevention and control of the COVID-19 and exhibited their unique value, and therefore they have become the highlight of China's clinical treatment protocol and provided Chinese experience and wisdom for the international community in the prevention and control of the COVID-19 epidemic. This paper outlines the research progress in the processing of representative TCM in recent years, reviews the mechanism of the related effects of TCM materials after processing, such as changing the drug efficacy and reducing the toxicity, puts forward the integration and application of a variety of new technologies and methods, so as to reveal the modern scientific mystery of the processing technology of TCM.

First Report of Colletotrichum fructicola Causing Leaf Spot on Smilax glabra Roxb in China.

Smilax glabra Roxb is a medicinal plant distributed in 17 countries and used in the production of food and tea (Wu et al. 2022). In May 2021, a leaf spot disease was observed on ~60% of S. glabra plants in a field (∼0.4 ha) in Qinzhou City, Guangxi Province. Initially, small, circular, brown spots appeared on the leaf surfaces, which then gradually expanded into large, sunken, dark brown necrotic areas. As disease progressed, lesions merged into large spots, eventually leading to defoliation. To determine the causal agent, six symptomatic plants were collected from the field. Small pieces (∼5 mm2) were cut from the infected leaves (n = 12), sterilized for two min in 1% NaOCl, and rinsed three times in sterile water. Then, the leaf tissues were placed on potato dextrose agar (PDA) with chloramphenicol (0.1 g/liter) and incubated for 3 days at 28°C (12-h photoperiod). Pure cultures were obtained by transferring hyphal tips from recently germinated spores or colony edges onto PDA. Among the 17 isolates, 15 exhibited similar morphologies. Two single-spore isolates (TFL45.1 and TFL46.2) were subjected to further morphological and molecular characterization. Colonies on PDA were grayish green with a white outer ring and cottony surface, and pale blackish green on the reverse side. Conidia were hyaline, aseptate, straight, and cylindrical, with rounded ends, and 11.4 to 16.5 µm × 4.1 to 6.1 µm (average 13.9 × 4.8 µm, n = 100). Appressoria were brown to dark brown, with a smooth edge and different shapes such as ovoid, elliptical or irregular, and 6.8 to 8.9 µm × 5.9 to 7.8 µm (average 7.7 × 6.6 µm, n = 25). For molecular identification, eight target gene sequences, internal transcribed spacer (ITS), glyceraldehydes-3-phosphate dehydrogenase (GAPHD), calmodulin (CAL), partial actin (ACT), chitin synthase (CHS-1), glutamine synthetase (GS), manganese superoxide dismutase (SOD2), and ß-tubulin (TUB) were selected for PCR amplification (Weir et al. 2012). The resulting sequences were deposited in GenBank (OR399160-61 and OR432537-50). BLASTn analysis of the obtained sequences showed 99-100% identity with those of the ex-type strain C. fructicola ICMP:18581 (JX010165, JX010033, FJ917508, FJ907426, JX009866, JX010095, JX010327, JX010405) (Weir et al. 2012). In addition, a phylogenetic analysis confirmed the isolates as C. fructicola. Therefore, based on morphological and molecular characteristics (Park et al. 2018; Weir et al. 2012), the isolates were identified as C. fructicola. To verify pathogenicity, three healthy leaves on each of six two-year-old S. glabra plants were inoculated with ∼5 mm2 mycelial discs or aliquots of 10 µl suspension (106 conidia/ml) of the strain TFL46.2, and six control plants were inoculated with sterile PDA discs or sterile water. All plants were enclosed in plastic bags and incubated in a greenhouse at 25°C (12-h photoperiod). Six days post-inoculation, leaf spot symptoms appeared on the inoculated leaves. No symptoms were detected in the controls. Experiments were replicated three times with similar results. To fulfill Koch's postulates, C. fructicola was consistently re-isolated from symptomatic tissue and confirmed by morphology and sequencing of the eight genes, whereas no fungus was isolated from the control plants. To our knowledge, this is the first report of C. fructicola causing leaf spot disease on S. glabra. Further studies will be needed to develop strategies against this disease based on the identification of this pathogen.

Disease-Related Factors Associated with Acupuncture Response in Patients with Chronic Tension-Type Headache: A Secondary Analysis of A Randomized Controlled Trial.

OBJECTIVE: To explore the demographic and disease-related factors associated with acupuncture response in patients with chronic tension-type headache (CTTH). METHODS: Using data from a randomized clinical trial (218 cases) consisting of 4 weeks of baseline assessment, 8 weeks of treatment, and 24 weeks of follow-up, participants were regrouped into responders (at least a 50% reduction in monthly headache days at week 16 compared with baseline) and non-responders. Twenty-three demographic and disease-related factors associated with acupuncture response in 183 participants were analyzed by multivariable logistic regression. RESULTS: One hundred and nineteen (65.0%) participants were classified as responders. Four factors were significantly independently associated with acupuncture response, including treatment assignment, headache intensity at baseline, and 2 domains [general health (GH) and social functioning (SF)] from the 36-Item Short Form Health Survey quality of life questionnaire. Treatment assignment was associated with non-response: participants receiving true acupuncture were 3-time more likely to achieve a CTTH response than those receiving superficial acupuncture [odds ratio (OR) 0.322, 95% confidence interval (CI) 0.162 to 0.625, P=0.001]. Compared with patients with mild-intensity headache, patients with moderate-intensity headache were twice as likely to respond to acupuncture (OR 2.001, 95% CI 1.020 to 4.011, P=0.046). The likelihood of non-response increased by 4.5% with each unit increase in the GH grade (OR 0.955, 95% CI 0.917 to 0.993, P=0.024) while decreased by 3.8% with each unit increase in the SF grade (OR 1.038, 95% CI 1.009 to 1.069, P=0.011). CONCLUSIONS: Greater headache intensity, lower GH score, and higher SF score were associated with better acupuncture responses in CTTH patients. These 3 factors require independent validation as predictors of acupuncture effectiveness in CTTH.

Natural products in traditional Chinese medicine: molecular mechanisms and therapeutic targets of renal fibrosis and state-of-the-art drug delivery systems.

Renal fibrosis (RF) is the end stage of several chronic kidney diseases. Its series of changes include excessive accumulation of extracellular matrix, epithelial-mesenchymal transition (EMT) of renal tubular cells, fibroblast activation, immune cell infiltration, and renal cell apoptosis. RF can eventually lead to renal dysfunction or even renal failure. A large body of evidence suggests that natural products in traditional Chinese medicine (TCM) have great potential for treating RF. In this article, we first describe the recent advances in RF treatment by several natural products and clarify their mechanisms of action. They can ameliorate the RF disease phenotype, which includes apoptosis, endoplasmic reticulum stress, and EMT, by affecting relevant signaling pathways and molecular targets, thereby delaying or reversing fibrosis. We also present the roles of nanodrug delivery systems, which have been explored to address the drawback of low oral bioavailability of natural products. This may provide new ideas for using natural products for RF treatment. Finally, we provide new insights into the clinical prospects of herbal natural products.

Scurvy presenting as difficulty in walking in a child.

Scurvy, a disease caused by ascorbic acid (vitamin C) deficiency, is a rare disease in the modern world. We report a case of a boy in middle childhood, with a background of autism, presenting bed-bound due to progressive bilateral lower limb pain, with concomitant rashes, bleeding gums and worsening lethargy. Detailed dietary history revealed a severely restricted diet. Physical examination showed bilateral lower limb ecchymoses, perifollicular hemorrhages, perifollicular hyperkeratosis and cockscrew hairs which are pathognomonic features of scurvy. A low serum ascorbic acid level confirmed the diagnosis. Therapy with oral vitamin C supplement and rehabilitation with multidisciplinary care was successful, with complete resolution of symptoms. This case emphasises the importance of thorough dietary evaluation in children with autism and food selectivity presenting with non-specific symptoms. Physician awareness of nutritional deficiencies avoids unnecessary extensive investigations and sub-specialty referrals and translates to savings in medical expenses.

Efficacy of Acupuncture for Chronic Spontaneous Urticaria : A Randomized Controlled Trial.

BACKGROUND: The effectiveness of acupuncture for patients with chronic spontaneous urticaria (CSU), reported in a few small-scale studies, is not convincing. OBJECTIVE: To investigate whether acupuncture leads to better effects on CSU than sham acupuncture or waitlist control. DESIGN: A multicenter, randomized, sham-controlled trial. (Chinese Clinical Trial Registry: ChiCTR1900022994). SETTING: Three teaching hospitals in China from 27 May 2019 to 30 July 2022. PARTICIPANTS: 330 participants diagnosed with CSU. INTERVENTION: Participants were randomly assigned in a 1:1:1 ratio to receive acupuncture, sham acupuncture, or waitlist control over an 8-week study period (4 weeks for treatment and another 4 weeks for follow-up). MEASUREMENTS: The primary outcome was the mean change from baseline in the Weekly Urticaria Activity Score (UAS7) at week 4. Secondary outcomes included itch severity scores, self-rated improvement, and Dermatology Life Quality Index scores. RESULTS: The mean change in UAS7 (range, 0 to 42) for acupuncture from baseline (mean score, 23.5 [95% CI, 21.8 to 25.2]) to week 4 (mean score, 15.3 [CI, 13.6 to 16.9]) was -8.2 (CI, -9.9 to -6.6). The mean changes in UAS7 for sham acupuncture and waitlist control from baseline (mean scores, 21.9 [CI, 20.2 to 23.6] and 22.1 [CI, 20.4 to 23.8], respectively) to week 4 (mean scores, 17.8 [CI, 16.1 to 19.5] and 20.0 [CI, 18.3 to 21.6], respectively) were -4.1 (CI, -5.8 to -2.4) and -2.2 (CI, -3.8 to -0.5), respectively. The mean differences between acupuncture and sham acupuncture and waitlist control were -4.1 (CI, -6.5 to -1.8) and -6.1 (CI, -8.4 to -3.7), respectively, which did not meet the threshold for minimal clinically important difference. Fifteen participants (13.6%) in the acupuncture group and none in the other groups reported adverse events. Adverse events were mild or transient. LIMITATION: Lack of complete blinding, self-reported outcomes, limited generalizability because antihistamine use was disallowed, and short follow-up period. CONCLUSION: Compared with sham acupuncture and waitlist control, acupuncture produced a greater improvement in UAS7, although the difference from control was not clinically significant. Increased adverse events were mild or transient. PRIMARY FUNDING SOURCE: The National Key R&D Program of China and the Science and Technology Department of Sichuan Province.

Effects and potential mechanism of dietary vitamin C supplementation on hepatic lipid metabolism in growing laying hens under chronic heat stress.

The adverse effects of chronic heat stress (CHS)-induced fatty liver syndrome on laying hens during the egg-producing stages have been wildly documented. However, until nowadays, the CHS responses of growing laying hens as well as its alleviating effects of vitamin C are rarely reported. In this study, 12-wk-old laying hens were subjected to CHS at 36 °C for 10 h/d for 3 wk with or without dietary supplementation of 300 mg/kg vitamin C. Results showed that CHS significantly impaired the growth performances and the liver functions of birds, as characterized by reduced feed intake and body weight, increased hepatic lipid accumulation and serum concentrations of TG, ALT, and AST, as well as the abnormal expression patterns of the lipid metabolism-related genes. Vitamin C supplementation successfully mitigated the lipid accumulation, while showing no alleviating effect on the serum contents of ALT or AST, which are two key indicators of liver functions. Metabolomic analysis based on UPLC-Q-TOF/MS identified 173 differential metabolites from the HS and HSV group samples, and they are mainly enriched in the pathways related to the cellular components, vitamin and amino acid metabolism and energy substance metabolism. The results indicate that CHS-induced hepatic lipid deposition in growing laying hens is effectively alleviated by dietary supplementation of vitamin C, which is probably resulted from the alterations of hepatocellular metabolic patterns.

Chronic heat stress (CHS)-induced fatty liver syndrome (FLS) is one of the major problems faced in poultry industry. However, the heat stress response as well as the alleviating strategies for growing laying hens is rarely concerned until nowadays. In this study, 12-wk-old laying hens were subjected to the CHS condition with or without dietary supplementation of 300 mg/kg vitamin C, we found that CHS can also remarkably impair the growth performance and liver functions and induce the hepatic lipid metabolism disorders in the growing laying hens. Vitamin C supplementation successfully mitigated the hepatic lipid accumulation, while showed no alleviating effect on the liver functions. Metabolomic analysis further identified 173 differential metabolites between CHS and HSV groups, which are mainly enriched in the pathways including the cellular components, vitamin and amino acid metabolism and the energy substance metabolism. The results suggest that vitamin C supplementation can effectively alleviate the hepatic lipid deposition in growing laying hens under CHS probably through altering their energy metabolism patterns.

Acupuncture as an adjunctive therapy for gastric ulcer: A modified Delphi consensus study.

BACKGROUND: Acupuncture is often used as an adjunctive therapy for gastric ulcer (GU). However, there is still a lack of evidence on the appropriate and optimal interventions for acupuncture. This study aimed to optimize the acupuncture treatment of gastric ulcers based on expert consensus for guiding acupuncturists in clinical practice. METHODS: To conduct this study, research evidence was gathered from databases in both Chinese and English. After discussion, preliminary clinical questions were developed. Following three rounds of multidisciplinary clinical expert consultation, the initial consensus questionnaire was formed after testing and modification by team members. A Delphi consensus was ultimately reached to answer the questionnaire and develop guidance for acupuncture treatment. A 9-point Likert-type scale was used to measure the agreement of expert consensus, where a score of 80% between 7 and 9 was defined as "agreement." RESULTS: After two rounds of Delphi voting, a total of 35 items reached an agreement. These items can be roughly divided into 6 domains. According to expert consensus, the application of acupuncture for gastric ulcer should follow a semistandardized approach. Based on the syndrome differentiation, the main acupoints recommended are Zusanli (ST36), Zhongwan (CV12), Neiguan (PC6), and Sanyinjiao (SP6), while the adjunct acupoints include Taichong (LR3), Guanyuan (CV4), Xuehai (SP10), and Taixi (KI3). In the experience of experts, adverse events associated with acupuncture are typically mild and often manifest as subcutaneous hematomas. CONCLUSION: There is a lack of definitive acupuncture guidelines that can effectively determine the optimal therapeutic approach for the treatment of gastric ulcer. This expert consensus provides recommendations for clinical research and practice of acupuncture, with a particular focus on the selection of acupoints. However, further exploration through rigorous studies is necessary due to the limited availability of clinical evidence.

Risk factors of systemic lupus erythematosus: an overview of systematic reviews and Mendelian randomization studies.

BACKGROUND: The etiology of systemic lupus erythematosus is complex and incurable. A large number of systematic reviews have studied the risk factors of it. Mendelian randomization is an analytical method that uses genetic data as tool variables to evaluate the causal relationship between exposure and outcome. OBJECTIVE: To review the systematic reviews and Mendelian randomization studies that focused on the risk factors of systemic lupus erythematosus and shed light on the development of treatments for its prevention and intervention. METHODS: From inception to January 2022, we systematically searched MEDLINE (via PubMed) and Embase for related systematic reviews and Mendelian randomization studies. Extract relevant main data for studies that meet inclusion criteria. The quality of systematic reviews was assessed by using Assessment of Multiple Systematic Reviews 2 (AMSTAR-2). Finally, the risk factors are scored comprehensively according to the results' quantity, quality, and consistency. RESULTS: Our study involved 64 systematic reviews and 12 Mendelian randomization studies. The results of systematic reviews showed that diseases (endometriosis, atopic dermatitis, allergic rhinitis), lifestyle (smoking, drinking, vaccination), and gene polymorphism influenced the incidence of systemic lupus erythematosus. The results of Mendelian randomization studies identified the role of disease (periodontitis, celiac disease), trace elements (selenium, iron), cytokines (growth differentiation factor 15), and gut microbiome in the pathogenesis of systemic lupus erythematosus. CONCLUSION: We should pay attention to preventing and treating systemic lupus erythematosus in patients with endometriosis, celiac disease, and periodontitis. Take appropriate dietary supplements to increase serum iron and selenium levels to reduce the risk of systemic lupus erythematosus. There should be no excessive intervention in lifestyles such as smoking and drinking.

Acupuncture for Patients with Chronic Spontaneous Urticaria: A Randomized, Sham-Controlled Pilot Trial.

OBJECTIVE: To determine the feasibility of conducting a full-scale randomized controlled trial (RCT) and investigate the basic information and safety of acupuncture for patients with chronic spontaneous urticaria (CSU). METHODS: A total of 80 participants with CSU from July 2018 to July 2019 were randomly assigned to receive active acupuncture (n=41) on a fixed prescription of acupoints or sham acupuncture (n=39) with superficial acupuncture on non-acupuncture points through the completely randomized design. Patients in both groups received 5 sessions per week for 2 weeks, and participants were followed for a further 2 weeks. Feasibility was assessed by recruitment and randomization rates, retention of participants, treatment protocol adherence, and the incidence of adverse events (AEs). The clinical primary outcome was the changes from baseline weekly urticaria activity scores (UAS7) after treatment at 2 weeks. Secondary outcomes included the Visual Analogue Scale (VAS) score of itching intensity, Dermatology Life Quality Index (DLQI), Hamilton Depression Scale (HAMD), and Hamilton Anxiety Scale (HAMA). RESULTS: A total of 80 participants were enrolled. The recruitment rate of 24.02%, randomization rate of 100%, a loss rate of 6.25%, and no obvious AEs were observed in either group. The decrease from baseline in the mean UAS7 total score at week 2 in the active acupuncture group was -8.63 (95%CI, -11.78 to -5.49) and -6.21 (95%CI, -9.43 to -2.98) in the sham acupuncture group for a between-group difference of -2.42 (95% CI, -6.93 to 2.07). The change in the DLQI, VAS of itching intensity, HAMA, and HAMD were a slightly better improvement trend in the active acupuncture group than the sham acupuncture group, but the between-group difference was not significant. CONCLUSIONS: Active acupuncture had a better improvement trend in alleviating symptoms, improving quality of life and regulating the mood of anxiety and depression in patients with CSU than sham acupuncture. (Registration Nos. AMCTR-ICR-18000190 and ChiCTR2100054776).

Vitamin D supplementation reduced blood inflammatory cytokines expression and improved graft function in kidney transplant recipients.

Background: Chronic allograft dysfunction(CAD) is the leading cause of graft loss in kidney transplant recipients (KTRs). Inflammatory process is believed to be one of the major contributors to CAD. The aim of this study is to explore the anti-inflammatory effect of vitamin D (VD) supplementation in KTRs and its role in the graft function improvement(protection). Methods: A retrospective cohort of 39 KTRs with chronic antibody mediated rejection(CAMR)or stable renal function and a prospective cohort of 42 KTRs treated or untreated with VD were enrolled. Serum levels of vitamin D metabolism and serum inflammatory cytokines, renal graft function, and routine blood biomarkers were tested and dynamically tracked within 12 months post-transplant. Results: Compared with the stable group, the CAMR group exhibited significantly elevated serum levels of inflammatory cytokines IL-1ß, IFN-γ, IL-2, IL-10, IP-10, and HMGB1 (P <0.05). The supplementation of vitamin D effectively increased the serum concentration of vitamin D in kidney transplant recipients (KTRs) in the treated group. During the course of treatment, the treated group exhibited a gradual increase in eGFR levels, which were significantly higher than those observed in the untreated group at 12 months post-transplant (p<0.05). Notably, as eGFR improved, there was a significant decrease in levels of IL-1ß, IFN-γ, IL-2, IL-10, IP-10 and HMGB1 in the treated group compared to the untreated group (P<0.05). Conclusion: This study confirmed that immune-inflammation is a crucial factor in the development of CAD in KTRs.VD deficiency impairs its anti-inflammatory activity. By assisting in the regulation of excessive immune inflammation and restoration of immune homeostasis, effective VD supplementation contributes to protection and maintenance of graft function in KTRs.

Efficacy of acupuncture for tension-type headache prophylaxis: systematic review and meta-analysis with trial sequential analysis.

BACKGROUND: Acupuncture has been shown to reduce tension-type headache (TTH) frequency in previous studies. Nevertheless, repeated significance testing might inflate type I error. We aimed to verify the effectiveness and safety of acupuncture in reducing TTH frequency by meta-analysis and trial sequential analysis (TSA). METHODS: Ovid Medline, Embase, and Cochrane Library were searched until September 29, 2022. Randomized controlled trials comparing acupuncture with sham acupuncture, no acupuncture, or other active therapies in adults with TTH were included. The primary outcome was TTH frequency. The secondary outcomes were responder rate and adverse event. RESULTS: Fourteen studies involving 2795 participants were included. Acupuncture had more reduction than sham acupuncture in TTH frequency, both after treatment (standardized mean difference [SMD] - 0.80, 95% CI - 1.36 to - 0.24, P = 0.005) and at the follow-up period (SMD - 1.33, 95% CI - 2.18 to - 0.49, P = 0.002), while TSA showed the included sample size did not exceed required information size (RIS). Acupuncture was superior over no acupuncture after treatment (SMD - 0.52, 95% CI - 0.63 to - 0.41, P < 0.001), and cumulative sample size reached RIS. In terms of responder rate, acupuncture had a higher responder rate compared with sham acupuncture both after treatment (relative ratio [RR] 1.28, 95% CI 1.12 to 1.46, P = 0.0003) and the follow-up period (RR 1.37, 95% CI 1.19 to 1.58, P < 0.0001), but the sample size is inadequate. CONCLUSION: Acupuncture is an efficacious and safe treatment for TTH prevention, but this conclusion might be limited by the generally very low to low quality evidence. TSA suggested that high-quality trials are needed to verify the efficacy and safety of acupuncture compared to sham acupuncture.

l-Type amino acid transporter 1 in hypothalamic neurons in mice maintains energy and bone homeostasis.

Hypothalamic neurons regulate body homeostasis by sensing and integrating changes in the levels of key hormones and primary nutrients (amino acids, glucose, and lipids). However, the molecular mechanisms that enable hypothalamic neurons to detect primary nutrients remain elusive. Here, we identified l-type amino acid transporter 1 (LAT1) in hypothalamic leptin receptor-expressing (LepR-expressing) neurons as being important for systemic energy and bone homeostasis. We observed LAT1-dependent amino acid uptake in the hypothalamus, which was compromised in a mouse model of obesity and diabetes. Mice lacking LAT1 (encoded by solute carrier transporter 7a5, Slc7a5) in LepR-expressing neurons exhibited obesity-related phenotypes and higher bone mass. Slc7a5 deficiency caused sympathetic dysfunction and leptin insensitivity in LepR-expressing neurons before obesity onset. Importantly, restoring Slc7a5 expression selectively in LepR-expressing ventromedial hypothalamus neurons rescued energy and bone homeostasis in mice deficient for Slc7a5 in LepR-expressing cells. Mechanistic target of rapamycin complex-1 (mTORC1) was found to be a crucial mediator of LAT1-dependent regulation of energy and bone homeostasis. These results suggest that the LAT1/mTORC1 axis in LepR-expressing neurons controls energy and bone homeostasis by fine-tuning sympathetic outflow, thus providing in vivo evidence of the implications of amino acid sensing by hypothalamic neurons in body homeostasis.

[Effect of Shugan Tiaoshen acupuncture combined with western medication on depression-insomnia comorbidity due to COVID-19 quarantine: a multi-central randomized controlled trial].

OBJECTIVE: To observe the effect of Shugan Tiaoshen acupuncture (acupuncture for soothing the liver and regulating the mentality) combined with western medication on depression and sleep quality in the patients with depression-insomnia comorbidity due to COVID-19 quarantine, and investigate the potential mechanism from the perspective of cortical excitability. METHODS: Sixty patients with depression-insomnia comorbidity due to COVID-19 quarantine were randomly divided into an acupuncture group and a sham-acupuncture group, 30 cases in each one. The patients of both groups were treated with oral administration of sertraline hydrochloride tablets. In the acupuncture group, Shugan Tiaoshen acupuncture was supplemented. Body acupuncture was applied to Yintang (GV 24+), Baihui (GV 20), Hegu (LI 4), Zhaohai (KI 6), Qihai (CV 6), etc. The intradermal needling was used at Xin (CO15), Gan (CO12) and Shen (CO10). In the sham-acupuncture group, the sham-acupuncture was given at the same points as the acupuncture group. The compensatory treatment was provided at the end of follow-up for the patients in the sham-acupuncture group. In both groups, the treatment was given once every two days, 3 times a week, for consecutive 8 weeks. The self-rating depression scale (SDS) and insomnia severity index (ISI) scores were compared between the two groups before and after treatment and 1 month after the end of treatment (follow-up) separately. The cortical excitability indexes (resting motor threshold [rMT], motor evoked potential amplitude [MEP-A], cortical resting period [CSP]) and the level of serum 5-hydroxytryptamine (5-HT) were measured before and after treatment in the two groups. RESULTS: After treatment and in follow-up, SDS and ISI scores were decreased in both groups compared with those before treatment (P<0.05), and the scores in the acupuncture group were lower than those in the sham-acupuncture group (P<0.05), and the decrease range in the acupuncture group after treatment was larger than that in the sham-acupuncture group (P<0.05). After treatment, rMT was reduced (P<0.05), while MEP-A and CSP were increased (P<0.05) in the acupuncture group compared with that before treatment. The levels of serum 5-HT in both groups were increased compared with those before treatment (P<0.05). The rMT in the acupuncture group was lower than that in the sham-acupuncture group, while MEP-A and CSP, as well as the level of serum 5-HT were higher in the acupuncture group in comparison with the sham-acupuncture group (P<0.05). CONCLUSION: Shugan Tiaoshen acupuncture combined with western medication can relieve depression and improve sleep quality in the patients with depression-insomnia comorbidity due to COVID-19 quarantine, which is probably related to rectifying the imbalanced excitatory and inhibitory neuronal functions.

First Report of Epicoccum latusicollum Causing Leaf Blight on Curcuma kwangsiensis in China.

Curcuma kwangsiensis S. G. Lee et C. F. Liang is a traditional Chinese medicinal plant distributed in Guangxi and Yunnan Province, China. In May 2021, a leaf blight disease on C. kwangsiensi was observed in a plantation (~ 2 ha) in Lingshan county (21°51'00″N, 108°44'00″E), Guangxi Province. Disease incidence was up to 30% (n = 200). Initially, yellow to brown, irregular, water-soaked spots appeared at the tips or margins of leaves. As the disease progressed, the lesions gradually enlarged, merged. Finally, the entire leaf wilted, leading to defoliation. To isolate the pathogen, eighteen small pieces ( ~ 5 mm2) were cut from the margin of the necrotic lesions, surface disinfected with 1% NaOCl solution for 2 min, and rinsed three times in sterile water. Then the tissues were plated onto potato dextrose agar (PDA) and incubated for 3 days at 28°C. Hyphal tips from recently germinated spores were transferred to PDA to obtain pure cultures. Twelve isolates were obtained, of which ten isolates with similar morphological characterization. Two single-spore isolates (CK45.1 and CK45.2) were subjected to further morphological and molecular characterization. Colonies on PDA were villose, had a dense growth of aerial mycelia, and appeared white to grayish eventually. Pycnidia were brown, predominantly spheroidal, and 45.0 to 205.4 µm in diameter (n = 60). Conidia were ellipsoidal, aseptate, and 3.8 to 6.1 × 1.8 to 3.6 µm (n = 90). Morphological characteristics are similar to those of Epicoccum latusicollum (Chen et al. 2017).For molecular identification, primers ITS1/ITS4 (White et al. 1990), LR0R/LR5 (Vilgalys and Hester 1990, Rehner and Samuels 1994), RPB2-Ep-F (GGTCTTGTGTGCCCCGCTGAGAC)/RPB2-Ep-R TCGGGTGACATGACAATCATGGC), and TUB2-Ep-F (GTTCACCTTCAAACCGGTCAATG)/TUB2-Ep-R (AAGTTGTCGGGACGGAAGAGCTG) were used to amplify the internal transcribed spacer (ITS), partial nuclear large subunit rDNA (LSU), RNA polymerase II second largest subunit (rpb2), and ß-tubulin (tub2) genes, respectively. The obtained ITS (OP788080-81), LSU (OP811325-26), rpb2 (OP811267-68) and tub2 (OP811269-70) sequences showed 99.8% (478/479, and 478/479 bp), 99.9% (881/882, and 870/871 bp), 99.8 to 100% (429/431, and 429/430 bp), and 99.7% (332/333, and 332/333 bp) identity with those of ex-type strain E. latusicollum CGMCC 3.18346 (KY742101, KY742255, KY742174, KY742343). In addition, a phylogenetic analysis confirmed the isolates as E. latusicollum. Therefore, based on morphological and molecular characteristics, the isolates were identified as E. latusicollum. To verify pathogenicity, healthy leaves on nine plants (1 leaf per plant) were inoculated with mycelial discs from 5-day-old water-agar medium (WA) cultures of the strain CK45.1. Each leaf had four inoculation sites, two were inoculated with a representative strain, and two treated with pollution-free WA discs served as control. Plants were covered with transparent plastic bags and maintained in a greenhouse at 25°C with a 12 h photoperiod. Six days post-inoculation, the inoculated sites of leaves showed brown lesions, while the control remained healthy. The experiments repeated three times showed similar results. Koch's postulates were fulfilled by re-isolation of E. latusicollum from the lesions. To our knowledge, this is the first report of E. latusicollum causing leaf blight of C. kwangsiensi in China. This report might provide important information for growers to manage this disease.

Matching adjusted indirect comparison of acupuncture versus fremanezumab in the preventive treatment of episodic migraine.

OBJECTIVE: Acupuncture and fremanezumab are second-line treatments for migraine prophylaxis. We aimed to compare acupuncture with fremanezumab in the preventive treatment of episodic migraine by using a matching-adjusted indirect comparison analysis (MAIC). METHODS: We acquired participant-level data from an acupuncture trial recruiting 302 participants and summary-level data from a fremanezumab trial recruiting 875 participants (290 participants received monthly fremanezumab [MF] and 291 received single-dose fremanezumab [SF]). The primary outcome was the mean reduction in monthly headache days. The secondary outcomes were the mean reduction in monthly moderate-to-severe headache days, days with acute medication, and the adverse events rate. RESULTS: Before matching, the acupuncture arm had significantly lower BMI, fewer headache days with at least moderate severity, and fewer days with acute medication. After matching, the baseline variables were comparable between groups. The three arms had no difference in the change of monthly migraine days (MF vs. acupuncture: mean difference 0.3, 95%CI -0.5 to 1.1, p-value = 0.473; SF vs. acupuncture: mean difference 0.5, 95%CI -0.3 to 1.3, p-value = 0.214). The results were similar in the analyses of secondary outcomes sensitivity analyses. Thirty-six (25%) participants in the acupuncture arm reported adverse events, versus 192(66%) participants in the MF arm and 193 (66%) in the SF arm. CONCLUSION: The preventive treatment effect of acupuncture is equivalent to fremanezumab, and it presented with a lower adverse event rate, which indicates that acupuncture can be an alternative to fremanezumab.

Protection of Taohong Siwu Decoction on PC12 cells injured by oxygen glucose deprivation/reperfusion via mitophagy-NLRP3 inflammasome pathway in vitro.

ETHNOPHARMACOLOGICAL RELEVANCE: Taohong Siwu Decoction (THSWD) is a traditional Chinese medicine formula used to invigorate blood circulation and resolve blood stasis. It consists of Paeonia lactiflora Pall., Conioselinum anthriscoides (H.Boissieu) Pimenov & Kljuykov, Rehmannia glutinosa (Gaertn.) DC., Prunus persica (L.) Batsch, Angelica sinensis (Oliv.) Diels, and Carthamus creticus L. in the ratio of 3:2:4:3:3:2. THSWD is a common prescription for the treatment of ischemic stroke. AIM OF THE STUDY: To study the protective effect and mechanism of Taohong Siwu Decoction (THSWD) on PC12 cells damaged by oxygen glucose deprivation/reperfusion (OGD/R). MATERIALS AND METHODS: OGD/R model of PC12 cells was used to simulate ischemia-reperfusion (I/R) injury of nerve cells in vitro. The experiment was grouped as follows: control, OGD/R and OGD/R + THSWD (5%, 10% and 15%) group. Oxygen and glucose was restored for 24 h after 4-6 h of deprivation. The severity of damage to PC12 cells was evaluated by CCK8, flow cytometry and lactate dehydrogenase (LDH). Mitochondrial morphology and function were examined by transmission electron microscopy (TEM), ATP and mitochondrial membrane potential (MMP) assay kits. Cellular autophagy and NLRP3 inflammasome-associated proteins were detected by Western blot and immunofluorescence staining. RESULTS: THSWD treatment improved the survival rate of PC12 cells injured by OGD/R, reduced cell damage and apoptosis. Moreover, ATP, MMP and the expression of autophagy marker proteins (LC3-II/LC3-I, Beclin1, Atg5) and mitophagy marker proteins (Parkin and PINK-1) was significantly elevated. The reactive oxygen species (ROS), NLRP3 inflammasome and pro-inflammatory cytokines induced by OGD/R were distinctly reduced. In contrast, these above beneficial effects of THSWD on mitochondrial autophagy and NLRP3 inflammasome were reversed by mitochondrial division inhibitory factor 1 (Mdivi-1). CONCLUSION: THSWD protects PC12 cells against OGD/R injury by heightening mitophagy and suppressing the activation of NLRP3 inflammasome.

Effect of Shugan Tiaoshen acupuncture combined with western medication on depression-insomnia comorbidity due to COVID-19 quarantine: a multi-central randomized controlled trial / 中国针灸

OBJECTIVE@#To observe the effect of Shugan Tiaoshen acupuncture (acupuncture for soothing the liver and regulating the mentality) combined with western medication on depression and sleep quality in the patients with depression-insomnia comorbidity due to COVID-19 quarantine, and investigate the potential mechanism from the perspective of cortical excitability.@*METHODS@#Sixty patients with depression-insomnia comorbidity due to COVID-19 quarantine were randomly divided into an acupuncture group and a sham-acupuncture group, 30 cases in each one. The patients of both groups were treated with oral administration of sertraline hydrochloride tablets. In the acupuncture group, Shugan Tiaoshen acupuncture was supplemented. Body acupuncture was applied to Yintang (GV 24+), Baihui (GV 20), Hegu (LI 4), Zhaohai (KI 6), Qihai (CV 6), etc. The intradermal needling was used at Xin (CO15), Gan (CO12) and Shen (CO10). In the sham-acupuncture group, the sham-acupuncture was given at the same points as the acupuncture group. The compensatory treatment was provided at the end of follow-up for the patients in the sham-acupuncture group. In both groups, the treatment was given once every two days, 3 times a week, for consecutive 8 weeks. The self-rating depression scale (SDS) and insomnia severity index (ISI) scores were compared between the two groups before and after treatment and 1 month after the end of treatment (follow-up) separately. The cortical excitability indexes (resting motor threshold [rMT], motor evoked potential amplitude [MEP-A], cortical resting period [CSP]) and the level of serum 5-hydroxytryptamine (5-HT) were measured before and after treatment in the two groups.@*RESULTS@#After treatment and in follow-up, SDS and ISI scores were decreased in both groups compared with those before treatment (P<0.05), and the scores in the acupuncture group were lower than those in the sham-acupuncture group (P<0.05), and the decrease range in the acupuncture group after treatment was larger than that in the sham-acupuncture group (P<0.05). After treatment, rMT was reduced (P<0.05), while MEP-A and CSP were increased (P<0.05) in the acupuncture group compared with that before treatment. The levels of serum 5-HT in both groups were increased compared with those before treatment (P<0.05). The rMT in the acupuncture group was lower than that in the sham-acupuncture group, while MEP-A and CSP, as well as the level of serum 5-HT were higher in the acupuncture group in comparison with the sham-acupuncture group (P<0.05).@*CONCLUSION@#Shugan Tiaoshen acupuncture combined with western medication can relieve depression and improve sleep quality in the patients with depression-insomnia comorbidity due to COVID-19 quarantine, which is probably related to rectifying the imbalanced excitatory and inhibitory neuronal functions.