Analysis on safety assessment of Tephrosia vogelii Hook to Apis cerana cerana.

Tephrosia vogelii Hook was excellent insecticidal plant, it was introduced into China and planted over a large area in Guangdong province. The main active components of T. vogelii was rotenone and it widely found in leaves and pods of T. vogelii. This paper study of the safety assessment of T. vogelii flowers to worker bees. In this paper, the content of rotenone in T. vogelii petal, nectar, pollen, pistil, and stamen samples were investigated by HPLC, and tested the toxicity of T. vogelii flowers for Apis cerana cerana during 24 h. The dissipation and dynamic of rotenone in A. c. cerana different biological compartments were investigated under indoor conditions during 24 h. The results showed, The LT50 of T. vogelii flowers to worker bees were collected from the eastern, western, southern, northern and top were 13.95, 24.17, 12.55, 26.48, and 18.84 h, the haemolymph of worker bees have the highest content of rotenone, the least accumulation of rotenone in workers bee's thorax, and the rate of dissipation was slowly during the whole study. In conclusion, the results showed the T. vogelii create security risks to worker bees under some ecosystems.

Changes in the range of the medicinal herb Eriocaulon buergerianum Körnicke. (Eriocaulaceae) under climate change.

Eriocaulon buergerianum Körnicke. (Eriocaulaceae) is one of the most common and least expensive herbal medicines for eye disease. This species is facing potential threats from climate change. Insufficient biogeographic knowledge of this plant species can hinder its effective management for long-term population survival. We integrated ecological niche modelling (Biomod2) with 70 records of E. buergerianum and eight environmental variables to estimate changes in distribution over time. A core area Zonation algorithm was introduced to identify conservation priority areas. Our results indicate that the range of E. buergerianum will likely decrease in the future: the overall range change on average is -44.36 ± 21.56% (-3.70% to -77.73%); values of range loss and range gain are 45.79 ± 20.30% (9.29-78.19%) and 1.43 ± 1.53% (0.18-5.59%), respectively. According to conservation priority analysis, the mandatory reserve (top 5%), negotiable reserve (0.95-0.9) and partial reserve (0.9-0.8) areas are 19,799, 19,799 and 39,597 km2 , respectively. The areas identified as conservation priority are located in the southeast, especially in northern Taiwan and the Wuyi Mountains. Based on these results, we suggest a re-evaluation of the threatened status of this species, with a potential upgrade to the vulnerable (VU) category. To overcome the adverse conditions faced by populations of E. buergerianum in China, we propose a multi-faceted conservation strategy involving more complete resource assessment, a monitoring system, medical research focused on revealing medicinal components or substitutes, and a regional development plan that considers both wildlife and socio-economic issues.

Effect of single nucleotide polymorphisms on CDK4 and Zn supplementation in children with growth hormone deficiency.

OBJECTIVE: Precision medicine is a personalized disease prevention and treatment program combining modern genetic technology, molecular imaging techniques, and biological information with patients' living environment and clinical data, for accurate classification and diagnosis of diseases. CASE REPORT: Our study presents the case of a 7-year-old female patient with clinical manifestations of growth hormone (GH) deficiency. After treatment with recombinant human GH for 2 years, the patient showed a reduced growth rate. Then single nucleotide polymorphisms according to GHD was analyzed, and the 6009 site within cyclin-dependent kinase 4 gene showed a weak response to IGF-1 which was a downstream signal molecules of GH. CONCLUSIONS: Based on these results, both Zn and GH were supplied to the patients, and the growth rate increased significantly. Precision medicine needs more studies on patients to make accurate treatment.

First Report of Fig mosaic virus Infecting Common Fig (Ficus carica) in China.

The common fig (Ficus carica) is one of the earliest plants domesticated by humans. It has been cultivated in China ever since the early seventh century. Fig fruit is an important traditional Chinese medicine and a fine health food, featuring a unique flavor and rich nutrients. In addition to its great medicinal values, its abundant availability in the Xinjiang province of China has made the fig one of the most popular fruits in the country. One of the major diseases that affect figs is the fig mosaic disease (FMD) (1,4), which was reported in China in 1935 (3). A causal agent of this disease is associated with the Fig mosaic virus (FMV), a negative-strand RNA virus with six RNA segments (2). In 2013, and later during a survey in 2014, fig plants in several orchards in Xinjiang displayed symptoms of a virus-like disease, which was characterized as FMD. These symptoms included chlorotic clearing as well as banding of leaf veins along with various patterns of discoloration, severely distorted leaves, and deformed fruits. Total RNA extracts (TRIzol reagent, Ambion) from 18 symptomatic and four asymptomatic leaf samples were subjected to reverse reaction (RT) assays using M-MLV reverse transcriptase (Promega, Fitchburg, WI) with primer FMV-GP-R (TATTACCTGGATCAACGCAG). PCR analysis of the synthesized cDNA was performed using FMV-specific primers FMV-GP-F (ACTTGCAAAGGCAGATGATA) and FMV-GP-R. Amplicons of 706 bp produced by RT-PCR assays were obtained from most (15 out of 18) of the symptomatic samples; however, none was obtained from the four asymptomatic leaves. The purified amplicons were cloned and sequenced. BLAST analysis of these sequences revealed more than 94% nucleotide identity with glycoprotein precursor (GP) genes of an FMV-Serbia isolate (SB1). One sequence was deposited in NCBI databases, and one sequence was submitted to GenBank (Accession No. KM034915). RNA segments 2 to 6 of FMV were also amplified by RT-PCR and sequenced. These sequences showed 94 to 96% identity with FMV sequences deposited in the NCBI databases. The collected samples were further detected by Northern-blot hybridization with a digoxigenin-labeled RNA probe, which targets the RNA1 genome of the FMV. The result was in line with RT-PCR detection. To our knowledge, this is the first report of FMV in fig trees in China. Considering the economic importance of fig plants and the noxious nature of FMV, this virus poses a great threat to the economy of the fig industry of Xinjiang. Thus, it is important to develop immediate effective quarantine and management of this virus to reduce any further predictable loss. References: (1) T. Elbeaino et al. J. Gen. Virol. 90:1281, 2009. (2) K. Ishikawa et al. J. Gen. Virol. 93:1612, 2012. (3) H. A. Pittman. J. West Aust. Dept. Agric. 12:196, 1935. (4) J. J. Walia et al. Plant Dis. 93:4, 2009.

Studies on the chemical constituents of Valeriana fauriei Briq.

Nine compounds were isolated from the roots of Valeriana fauriei Briq, of which one is a new germacrane-type sesquiterpenoid named as valerianin E and its structure was elucidated as bicyclo[8, 1, 0] 5beta-hydroxyl-7beta-acetoxyl-5alpha,11, 11'-trimethyl-E-1(10)-ene-4alpha, 15-olide (1). In addition, two were first reported from this genus and the others were isolated for the first time from the title plant.

Phytochemical and antiinflammatory studies on Terminalia catappa.

The antiinflammatory activity of Terminalia catappa leaves ethanolic extract was studied using 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced ear edema in acute and chronic models. A bioassay-oriented fractionation procedure showed that the activity concentrates in the chloroform fraction. Ursolic acid (1) and 2alpha,3beta,23-trihydroxyurs-12-en-28-oic acid (2), isolated from the chloroform fraction, exhibited strong antiinflammatory activities. The results suggest that the triterpenic acids 1 and 2 are responsible for the antiinflammatory activity of T. catappa leaves.

[Effect of combination of ligustrazine and nitrendipine on hemodynamics in patients with chronic obstructive pulmonary disease].

OBJECTIVE: To find the drugs for lowering the pulmonary vascular resistance in patients of chronic obstructive pulmonary disease (COPD) but would not increase its side-effect. METHODS: Changes of some hemodynamic parameters in 15 patients of COPD in stable stage treated by nitrendipine and ligustrazine were observed by right heart floating catheterization. RESULTS: The mean pulmonary arterial pressure reduced by 1.4% immediately after the combined treatment, and reduced by 17.0%, 20.0% and 18.0% in 15 mins, 30 mins and 60 mins after treatment. In the responding time, the pulmonary vascular resistance reduced by 15.2%, 36.2%, 43.0% and 34.6%, the systemic vascular resistance reduced by 7.9%, 19.2%, 17.9% and 20.8%, and the cardiac output increased by 15.8%, 22.6%, 22.2%, and 33.8% respectively. The changes of systemic arterial pressure and heart rate were of no statistical significance. CONCLUSION: Combination therapy of nitrendipine and ligustrazine could lower the pulmonary arterial pressure and pulmonary vascular resistance effectively and has a selective effect on pulmonary circulation in patients with COPD.

[Therapeutic mechanism of combination therapy of ligustrazine and nitrendipine in treating patients with chronic obstructive pulmonary disease].

OBJECTIVE: To study the therapeutic mechanism of combination therapy of ligustrazine and nitrendipine in treating patients with chronic obstructive pulmonary disease (COPD). METHODS: Thirty COPD patients divided in to 3 groups (10 in each) were treated with ligustrazine, nitrendipine and ligustrazine plus nitrendipine respectively, and the changes of hemorrheologic parameters, plasma endothelin (ET-1), thromboxane A2(TXA2) and platelet-P-selectin (CD62P) before and after treatment were observed. RESULTS: The combination therapy of ligustrazine and nitrendipine could lower the levels of plasma ET-1, TXA2, CD62P and the hemorrheologic parameters. CONCLUSION: Combination of ligustrazine and nitrendipine showed a therapeutic effect better than that of the two drugs used separately. Its effect in lowering pulmonary circulation resistance is related with the lowering of plasma vaso-contrictive factor and the changing of hemorrheologic properties. The integrated traditional Chinese and western medical therapy is valuable in treating COPD.

[HPLC determination of oleanolic acid and llrolic acid in Chinese medicinal herbs].

OBJECTIVE: To develop a new method for simultaneous determination of oleanolic acid and llrolic acid in Chinese medicinal herbs at the same time. METHOD: HPLC was carried out on a Shim-pack CLC-ODS column using MeOH-H2O-HOAc-TEA (83:17:0.04:0.02). RESULT AND CONCLUSION: The average recovery of oleanolic acid and llrolic acid was 103.3 +/- 2.07% and 102.7% +/- 0.65% respectively.

New pregnane glycosides from Sinomarsdenia incisa.

Five new pregnane glycosides, sinomarinosides A (1), B (2), C (3), D (4), and E (5), have been isolated from Sinomarsdenia incisa (Asclepiadaceae). The structures of these compounds were elucidated by NMR and mass spectroscopic methods and chemical evidence.

Recombinant, chimaeric live, attenuated vaccine (ChimeriVax) incorporating the envelope genes of Japanese encephalitis (SA14-14-2) virus and the capsid and nonstructural genes of yellow fever (17D) virus is safe, immunogenic and protective in non-human primates.

Yellow fever 17D virus, a safe and effective live, attenuated vaccine, was used as a vector for genes encoding the protective antigenic determinants of a heterologous member of the genus Flavivirus, Japanese encephalitis (JE) virus, the leading cause of acute viral central nervous system infection and death throughout Asia. The viral envelope (prM and E) genes of a full-length cDNA clone of YF 17D virus were replaced with the corresponding genes of JE SA14-14-2, a strain licensed as a live, attenuated vaccine in China. Full-length RNA transcripts of the YF/JE chimaera were used to transfect Vero cells. The progeny virus (named 'ChimeriVax-JE'), was used to define safety after intracerebral (i.c.) inoculation of rhesus monkeys. Monkeys (N = 3) inoculated with a high dose (6.6 log10 pfu) developed a brief viremia, showed no signs of illness, developed high titers of anti-JE neutralizing antibody, and had minimal brain and spinal cord lesion scores according to criteria specified in the WHO monkey neurovirulence test. A control group of 3 monkeys that received a lower dose (4.2 log10 pfu) of commercial YF 17D vaccine had slightly higher lesion scores. To develop a lethal monkey model of JE for vaccine protection tests, we inoculated groups of monkeys i.c. or intranasally (i.n.) with a JE virus strain found to be highly neurovirulent and neuroinvasive for mice. Monkeys inoculated i.c., but not i.n., developed severe encephalitis after an incubation period of 8-13 days. The ChimeriVax-JE virus was passed in a cell line acceptable for human use (diploid fetal rhesus lung) and 4.3 or 5.3 log10 pfu were inoculated into groups of 3 monkeys by the subcutaneous route. All 6 animals developed brief viremias (peak titer < 2.0 log10 pfu/ml) and subsequently had anti-JE but no yellow fever neutralizing antibodies. On day 64, the monkeys were challenged i.c. with 5.5 log10 pfu of virulent JE virus. The immunized animals had no detectable viremia post-challenge, whereas 4 unimmunized controls became viremic. Only 1 of 6 (17%) vaccinated monkeys but 4 of 4 (100%) unvaccinated controls developed encephalitis. Histopathological examination 30 days after challenge confirmed that the protected, immunized animals had no or minimal evidence of encephalitis. These data demonstrated the ability of the ChimeriVax-JE to induce a rapid humoral immune response and to protect against a very severe, direct intracerebral virus challenge. Target areas of neuronal damage and inflammation in monkeys infected IC with wild-type JE, the chimaeric virus and YF 17D were similar, indicating that the histopathological scoring system used for the WHO yellow fever monkey neurovirulence test will be applicable to control testing of chimaeric seed viruses and vaccines.

Antiviral drug therapy of filovirus infections: S-adenosylhomocysteine hydrolase inhibitors inhibit Ebola virus in vitro and in a lethal mouse model.

Ebola (subtype Zaire) viral replication was inhibited in vitro by a series of nine nucleoside analogue inhibitors of S-adenosylhomocysteine hydrolase, an important target for antiviral drug development. Adult BALB/c mice lethally infected with mouse-adapted Ebola virus die 5-7 days after infection. Treatment initiated on day 0 or 1 resulted in dose-dependent protection, with mortality completely prevented at doses > or =0.7 mg/kg every 8 h. There was significant protection (90%) when treatment was begun on day 2, at which time, the liver had an average titer of 3 x 10(5) pfu/g virus and the spleen had 2 x 10(6) pfu/g. Treatment with 2.2 mg/kg initiated on day 3, when the liver had an average titer of 2 x 10(7) pfu/g virus and the spleen had 2 x 10(8) pfu/g, resulted in 40% survival. As reported here, Carbocyclic 3-deazaadenosine is the first compound demonstrated to cure animals from this otherwise lethal Ebola virus infection.

Evidence that folliculo-stellate cells mediate the inhibitory effect of Japanese kampo medicine, unkei-to, on growth hormone secretion in rat anterior pituitary cell cultures.

PROBLEM: Cytokine-induced neutrophil chemoattractant (CINC) was reported to influence anterior pituitary hormone release. We recently found that Unkei-to, one of the Japanese Kampo medicines, stimulated CINC secretion by rat anterior pituitary cells and the pituitary folliculo-stellate (FS)-like cell line (TtT/GF). Therefore, the effect of Unkei-to on growth hormone (GH) secretion by rat anterior pituitary cells was investigated. METHOD OF STUDY: Dispersed normal anterior pituitary cells, the folliculo-stellate-like cell line TtT/GF, and the GH3 cell were used to test the effect of Unkei-to on GH secretion. In reconstitutive coculture experiments, TtT/GF cells were mixed with GH3 cells at a ratio (TtT/GF cells: GH3 cells) of 1:99. From this mixture, cells were seeded onto plates at a density of 10(4) cells/well and were cultured for 5 days. The cells were then used in the experiments. RESULTS: Unkei-to at 20 micrograms/ml significantly inhibited GH secretion by normal anterior pituitary cells within 12 hr of incubation. In contrast Unkei-to stimulated GH secretion by GH3 cells in a time- and dose-dependent manner, suggesting that an accessory cell type was involved. To assess the contribution of CINC as a paracrine factor, an experiment using a reconstitutive coculture system was performed, and Unkei-to was found to inhibit GH secretion when GH3 cells were cocultured with TtT/GF cells. The addition of anti-CINC antibody to the reconstitutive coculture system antagonized Unkei-to-inhibited GH secretion. CONCLUSION: CINC, which was secreted from FS cells by Unkei-to, may be responsible for mediating the inhibitory effect of Unkei-to on GH secretion by rat anterior pituitary cells.

The herbal medicine unkei-to stimulates cytokine-induced neutrophil chemoattractant production in the pituitary folliculo-stellate-like cell line (TtT/GF).

PROBLEM: We previously reported that a cytokine-induced neutrophil chemoattractant (CINC) was produced in the pituitary gland and that it influenced anterior pituitary hormone release. In this study we investigated the effect of Unkei-to, a Japanese herbal medicine, on CINC production in the rat anterior pituitary gland and the pituitary folliculo-stellate-like cell line (TtT/GF). METHOD OF STUDY: Dispersed normal anterior pituitary cells and the folliculo-stellate-like cell line TtT/GF were used to test the effect of Unkei-to on CINC secretion and CINC mRNA accumulation. Concentrations of CINC in the conditioned media were measured by an enzyme-linked immunosorbent assay, and levels of CINC mRNA were analyzed by Northern blot analysis. RESULTS: Unkei-to (20 micrograms/ml) significantly increased the secretion of CINC by normal anterior pituitary cells within 12 hr of incubation. Unkei-to also stimulated CINC secretion from TtT/GF cells in a time- and dose-dependent manner. Unkei-to (20 micrograms/ml) increased CINC mRNA accumulation in TtT/GF cells within 3 hr of incubation and also caused a 13-fold increase in the secretion of CINC from TtT/GF cells compared with the vehicle group within 24 hr of incubation. Finally, we found that some of the Unkei-to's ingredients, Evodiae fructus and Pinelliae tuber, markedly stimulated CINC secretion from TtT/GF cells. CONCLUSIONS: Our results will help to elucidate the mechanism behind the clinical effect of Unkei-to on the anterior pituitary gland. They also suggested the presence of special substances, which stimulate CINC secretion, within Unkei-to's ingredients such as E. fructus and P. tuber.

[Progress in the study of mammalian selenoprotein].

Selenium is an essential trace element for animals and humans. Selenium exerts its biological function largely through selenoproteins. Up to now nine selenoproteins' cDNAs have been cloned and sequenced, which are cellular glutathione peroxidase (cGPX), extracellular glutathine peroxidase(eGPX), phospholipid hydroperoxidase glutathione peroxidase(PHGPX), gastrointestinal glutathione peroxidase (GPX-GI), type I iodothyronine 5'-deiodinase (ID I), type 2 iodothyronine 5'-deiodinase(ID II), type III iodothyronine 5-deiodinase(ID III), selenoprotein P (Se-P) and selenoprotein W. In all these selenoproteins Se is incorporated into the protein molecule via the selenocysteinyl-tRNA which recognizes the specific UGA codons in mRNA to insert selenocysteine into the primary structure of selenoproteins.

Antagonistic effects of extract from leaves of ginkgo biloba on glutamate neurotoxicity.

AIM: To determine whether the extract of leaves of Ginkgo biloba L (EGb) and several active constituents of EGb have protective effects against glutamate (Glu)-induced neuronal damage. METHODS: Microscopy and image analysis of nucleus areas in the arcuate nuclei (AN) of mice were made. The neuronal viability in primary cultures from mouse cerebral cortex was assessed using MTT [3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyl tetrazolium bromide] staining and the intracellular free calcium concentration ([Ca2+]i) of single neuron was measured using Fura-2. RESULTS: EGb (2.5 mg.L-1) and its constituent ginkgolide B (Gin B, 2 mg.L-1) protected the neuronal viability against Glu-induced injury, and prevented the Glu-induced elevation in [Ca2+]i. EGb (3-10 mg.kg-1) attenuated the decrease of nucleus areas in arcuate nuclei induced by Glu (1 g.kg-1, s.c.). CONCLUSION: EGb and Gin B prevent neurons from Glu neurotoxicity through reduction of the rise in [Ca2+]i.

[Colonic dialysis therapy of Chinese herbal medicine in abstinance of heroin addicts--report of 75 cases].

OBJECTIVE: To observe the efficacy of the colonic dialysis therapy of Chinese medicine in abstinance of heroin addicts. METHODS: One hundred and twenty five cases of heroin addicts were randomly divided into two groups: group A was treated with combined dihydroetorphine (DHE) and methadon therapy; group B, besides DHE and methadon, the addicts were given colon dialysis with Chinese herbal medicine from third day of the treatment through to the eighth day. RESULTS: The effect of group B was superior to that of group A in that the patients heroin abstinance symptoms disappeared more rapidly, the course of the disease was shorter and the effective rate raised to 100%. CONCLUSION: The cutaneous pigmentation could be removed through dialysis quickly which suggested that the method was able to remove toxic substances in the body and it would benefit the abstinance of heroin addicts.

Neuron degeneration induced by verapamil and attenuated by EGb761.

Calcium channel blockers are used as neuroprotective agents, as glutamate antagonists. However, it has been found that calcium channel blockers may compromise neuronal survival after long-term exposure. To explore the mechanisms of the toxicity of calcium channel blockers on neurons, we studied the morphological characteristics and biochemical changes of cultured cortical neurons treated with verapamil, a calcium channel blocker. We now report that cerebral cortical cultures exposed to verapamil for 48 h undergo neuronal degeneration in both concentration-dependent and time-dependent fashion, possibly partially through the activation of apoptosis. On the other hand, it was found that Ginkgo biloba extract (EGb761) attenuated verapamil-induced neuronal injury, suggesting the possibility of using verapamil combined with EGb761 clinically. Furthermore, both B-50 immunoactivity (BIA) and the concentration of intracellular calcium in single neurons ([Ca2+]i) decreased after a 48-h exposure to verapamil, suggesting that the mechanisms of verapamil-induced degeneration may be associated with the disruption of intracellular calcium homeostasis and the inhibition of normal axonal elongation.

[Effects of dihydroxyacetophenone on pulmonary hemodynamics and plasma ANP as well as cAMP/cGMP level in patients with chronic obstructive pulmonary disease].

In order to study the effect of dihydroxyacetophenone (DHAP) on pulmonary hemodynamics and its relationship to plasma ANP as well as cAMP/cGMP level in chronic obstructive pulmonary disease (COPD), 11 COPD patients were examined with the right heart catheterisation, and the plasma ANP and cAMP/cGMP were measured with radioimmunoassay at the same time. The results showed that intravenous given DHAP 640 mg could decrease mean pulmonary arterial pressure, pulmonary vascular resistance and systemic vascular resistance (P < 0.05), but increase the cardiac output from 4.10 +/- 1.08 L/min to 5.13 +/- 1.19 L/min (P > 0.05) and not affect systemic arterial pressure (P > 0.05) as well as blood gas analysis; it also reduce the plasma ANP and cGMP level from 0.73 +/- 0.42 pg/ml to 0.41 +/- 0.33 pg/ml (P < 0.01) and from 9.82 +/- 5.75 pm/ml to 8.01 +/- 4.80 pm/ml (P < 0.05) respectively, but did not affect the plasma cAMP level (P > 0.05). It is suggested that DHAP may relax pulmonary vessels by regulating the ratio of cAMP to cGMP, and the lowering of plasma ANP level might be a secondary reaction. So we consider that DHAP is a fast-acting, safe and potential drug in treating pulmonary arterial hypertension by COPD.

[Enhancing effects of Herpesvirus hominis on sodium glutamate neurotoxicity].

The neurotoxic effects of sodium glutamate (MSG, 2.5 g.kg-1 sc) and the enhancing effects of neurotropic Herpesvirus hominis (HVH, 0.2 ml/mouse ip) on MSG toxicity were studied through histomorphological observations, together with detection of the concentration of both mitochondrial protein bound Ca2+ and intracellular free Ca2+ ([Ca2+]i) by the Tb3+ fluorescent probe and Ca2+ indicator Fura-2/AM, respectively. It was found that in 10-d-old mice the neurons in arcuate hypothalamic nucleus degenerated severely after treatment with HVH+MSG, showing swollen edematous cytoplasm, dark pyknotic nuclei as well as a decrease in the amount of the neurons. The hypothalamic and spinal cord mitochondrial Tb3+ relative fluorescent intensity increased from 20 +/- 3 and 20 +/- 1 to 28 +/- 5 and 34 +/- 6, ie, the mitochondrial protein bound Ca2+ reduced significantly. MSG elevated the [Ca2+]i levels from 0.11 +/- 0.03 to 0.69 +/- 0.19 mumol.L-1 by not only stimulating the Ca2+ influx but also releasing the Ca2+ from intracellular stores. These findings suggested that MSG neurotoxicity was probably related to the overloading of neuroplasmic Ca2+, the destruction of neuronal abilities to deplete or sequester the intracellular Ca2+, as well as the irreversible neuronal injury and death.