Efficacy of Deep Venous Catheterization in the Management of Pneumothorax: A Clinical Study Utilizing Conventional Closed Thoracic Drainage.

Background: Currently, conventional closed thoracic drainage for pneumothorax involves a painful procedure with a higher risk and wider (1~1.5 cm) incision. Minimally invasive catheterized drainage techniques are urgently needed to address this challenge. Objective: This retrospective study aims to observe the effects of conventional closed thoracic drainage with deep venous catheterization drainage techniques on pneumothorax patients. Design: It was a retrospective study. Setting: This study was conducted at Huaian No.1 People's Hospital, Affiliated with Nanjing Medical University. Participants: A total of 105 pneumothorax patients who underwent conventional closed thoracic drainage (CCTD) or deep venous catheterization drainage technique (DVCDT) procedures at the hospital from 1st February 2020 to 30th October 2022 were selected. Interventions: Patients received either CCTD or DVCDT. Primary Outcome Measures: Included: (1) clinical variables; (2) catheterization procedure-related features; and (3) visual analogue scale (VAS) scores from pneumothorax patients. Results: Both conventional closed thoracic drainage and deep venous catheterization drainage techniques were successfully performed in all 105 (100%) patients, comprising 67 (63.8%) spontaneous pneumothorax, 20 (19%) iatrogenic pneumothorax, and 18 (17.1%) traumatic pneumothorax cases. Significant differences were observed between the enrolled spontaneous pneumothorax and traumatic pneumothorax patients in the two groups (CCTD and DVCDT) (P = .01 and P < .0001). Additionally, 55 (52.4%) patients underwent deep venous catheterization, while 50 (47.6%) patients underwent conventional closed thoracic drainage. The deep venous catheterization insertion procedure had a shorter mean timing (7.51±1.66 min) compared to the conventional closed thoracic drainage procedure (12.44±1.73 min) (P < .0001). Furthermore, VAS scores were significantly lower in pneumothorax patients undergoing deep venous catheterization (2.1±0.99) compared to conventional closed thoracic drainage (5.1±0.81) (P < .0001). Conclusion: Deep venous thoracic drainage technique appears to be safer and more beneficial than conventional closed thoracic drainage procedures for treating pneumothorax. This technique offers advantages such as minimal scarring, lower VAS scores, and shorter insertion time, thereby improving safety and surgical outcomes.

First Report of Colletotrichum fructicola Causing Leaf Spot on Smilax glabra Roxb in China.

Smilax glabra Roxb is a medicinal plant distributed in 17 countries and used in the production of food and tea (Wu et al. 2022). In May 2021, a leaf spot disease was observed on ~60% of S. glabra plants in a field (∼0.4 ha) in Qinzhou City, Guangxi Province. Initially, small, circular, brown spots appeared on the leaf surfaces, which then gradually expanded into large, sunken, dark brown necrotic areas. As disease progressed, lesions merged into large spots, eventually leading to defoliation. To determine the causal agent, six symptomatic plants were collected from the field. Small pieces (∼5 mm2) were cut from the infected leaves (n = 12), sterilized for two min in 1% NaOCl, and rinsed three times in sterile water. Then, the leaf tissues were placed on potato dextrose agar (PDA) with chloramphenicol (0.1 g/liter) and incubated for 3 days at 28°C (12-h photoperiod). Pure cultures were obtained by transferring hyphal tips from recently germinated spores or colony edges onto PDA. Among the 17 isolates, 15 exhibited similar morphologies. Two single-spore isolates (TFL45.1 and TFL46.2) were subjected to further morphological and molecular characterization. Colonies on PDA were grayish green with a white outer ring and cottony surface, and pale blackish green on the reverse side. Conidia were hyaline, aseptate, straight, and cylindrical, with rounded ends, and 11.4 to 16.5 µm × 4.1 to 6.1 µm (average 13.9 × 4.8 µm, n = 100). Appressoria were brown to dark brown, with a smooth edge and different shapes such as ovoid, elliptical or irregular, and 6.8 to 8.9 µm × 5.9 to 7.8 µm (average 7.7 × 6.6 µm, n = 25). For molecular identification, eight target gene sequences, internal transcribed spacer (ITS), glyceraldehydes-3-phosphate dehydrogenase (GAPHD), calmodulin (CAL), partial actin (ACT), chitin synthase (CHS-1), glutamine synthetase (GS), manganese superoxide dismutase (SOD2), and ß-tubulin (TUB) were selected for PCR amplification (Weir et al. 2012). The resulting sequences were deposited in GenBank (OR399160-61 and OR432537-50). BLASTn analysis of the obtained sequences showed 99-100% identity with those of the ex-type strain C. fructicola ICMP:18581 (JX010165, JX010033, FJ917508, FJ907426, JX009866, JX010095, JX010327, JX010405) (Weir et al. 2012). In addition, a phylogenetic analysis confirmed the isolates as C. fructicola. Therefore, based on morphological and molecular characteristics (Park et al. 2018; Weir et al. 2012), the isolates were identified as C. fructicola. To verify pathogenicity, three healthy leaves on each of six two-year-old S. glabra plants were inoculated with ∼5 mm2 mycelial discs or aliquots of 10 µl suspension (106 conidia/ml) of the strain TFL46.2, and six control plants were inoculated with sterile PDA discs or sterile water. All plants were enclosed in plastic bags and incubated in a greenhouse at 25°C (12-h photoperiod). Six days post-inoculation, leaf spot symptoms appeared on the inoculated leaves. No symptoms were detected in the controls. Experiments were replicated three times with similar results. To fulfill Koch's postulates, C. fructicola was consistently re-isolated from symptomatic tissue and confirmed by morphology and sequencing of the eight genes, whereas no fungus was isolated from the control plants. To our knowledge, this is the first report of C. fructicola causing leaf spot disease on S. glabra. Further studies will be needed to develop strategies against this disease based on the identification of this pathogen.

Formaldehyde-free and durable phosphorus-containing cotton flame retardant with -N=P-(N)3- and reactive ammonium phosphoric acid groups.

A flame retardant (FR) hexachlorocyclotriphosphazene diethylenetriamine ammonium phosphoric acid (HDAPA) was synthesized. Vertical flammability test and limiting oxygen index (LOI) results showed that cotton samples finished with HDAPA solutions (15 % and 20 %) could pass vertical flame retardancy test, and LOIs reached 30.1 % and 35.4 % even after 50 laundering cycles according to AATCC 61-2013 3A washing standard (3A), performing flame retardancy and washing durability. Meanwhile, Fourier transform infrared and X-ray photoelectron spectroscopy analyses suggested that HDAPA was grafted on cotton fibers through -P(=O)-O-C covalent bond. Total heat release (1.98 MJ/m2) and char residue (16.2 %) of HDAPA treated cotton were much lower than those (4.26 MJ/m2, 3.2 %) of untreated cotton. Thermogravimetry results showed HDAPA changed thermal decomposition pathway of cotton fabric, which was further supported by thermogravimetric-Fourier infrared spectrometer results, revealing HDAPA performed a condensed phase flame retardancy mechanism. Scanning electron microscopy implied HDAPA entered amorphous region of cotton fibers to react with cellulose. Mechanical properties of HDAPA treated cotton decreased a little. Although the synthesis process used formaldehyde but no free formaldehyde released. In consequence, the aforementioned results indicated that the introduction of -N=P-(N)3- and -P(=O)(O-NH4+)2 groups to FR was an viable method to improve flame retardancy and durability.

Corynoline inhibits esophageal squamous cell carcinoma growth via targeting Pim-3.

BACKGROUND: Esophageal squamous cell carcinoma (ESCC) is an aggressive and deadly malignancy characterized by late-stage diagnosis, therapy resistance, and a poor 5-year survival rate. Finding novel therapeutic targets and their inhibitors for ESCC prevention and therapy is urgently needed. METHODS: We investigated the proviral integration site for maloney murine leukemia virus 3 (Pim-3) protein levels using immunohistochemistry. Using Methyl Thiazolyl Tetrazolium and clone formation assay, we verified the function of Pim-3 in cell proliferation. The binding and inhibition of Pim-3 by corynoline were verified by computer docking, pull-down assay, cellular thermal shift assay, and kinase assay. Cell proliferation, Western blot, and a patient-derived xenograft tumor model were performed to elucidate the mechanism of corynoline inhibiting ESCC growth. RESULTS: Pim-3 was highly expressed in ESCC and played an oncogenic role. The augmentation of Pim-3 enhanced cell proliferation and tumor development by phosphorylating mitogen-activated protein kinase 1 (MAPK1) at T185 and Y187. The deletion of Pim-3 induced apoptosis with upregulated cleaved caspase-9 and lower Bcl2 associated agonist of cell death (BAD) phosphorylation at S112. Additionally, binding assays demonstrated corynoline directly bound with Pim-3, inhibiting its activity, and suppressing ESCC growth. CONCLUSIONS: Our findings suggest that Pim-3 promotes ESCC progression. Corynoline inhibits ESCC progression through targeting Pim-3.

[Identification of quality markers of Gei Herba based on analytic hierarchy process-entropy weight method and network pharmacology].

Analytic hierarchy process(AHP)-entropy weight method(EWM) and network pharmacology were employed to identify the potential quality markers(Q-markers) of Gei Herba. According to the new concept of Q-markers in traditional Chinese medicine(TCM), the AHP-EWM was applied to quantitatively identify the Q-markers of Gei Herba. The AHP was used for the weight analysis of primary indicators(factor layer), and the EWM for the analysis of literature and experimental data of secondary indicators(control layer). In addition, network pharmacology was employed to build the "component-target-disease-efficacy" network for Gei Herba, and the components showing strong associations with the Qi-replenishing, spleen-invigorating, blood-tonifying, Yin-nourishing, lung-moistening, and phlegm-resolving effects of Gei Herba were screened out. According to the results of AHP-EWM and network pharmacology, four components, i.e., ellagic acid, gallic acid, gemin G, and gemin C, were finally identified as potential Q-markers of Gei Herba. In this study, the AHP-EWM and network pharmacology were employed to screen the Q-markers of Gei Herba, which provided ideas for the quantitative evaluation and identification of Q-markers of TCM.

Efficacy of acupuncture or moxibustion in treating senile insomnia compared with a control group: A systematic review and meta-analysis.

INTRODUCTION: This systematic review and meta-analysis aimed to assess the efficacy of acupuncture or moxibustion therapy in senile insomnia patients. METHODS: A comprehensive literature search was conducted using 7 electronic databases to identify randomized controlled trials reported on the use of acupuncture or moxibustion therapy in insomnia. The time frame was set from database establishment to March 11, 2023. The RevMan (version 5.3) and STATA (version 17.0) software were used to evaluate the quality of the included randomized controlled trials and perform a meta-analysis. The methodological quality of the included studies was assessed using the Cochrane risk-of-bias tool. Subgroup analysis was performed based on different intervention methods. The I2 statistic was used to assess heterogeneity among studies. RESULTS: A total of 20 studies conducted between 2007 and 2022 were included, involving 1677 patients with senile insomnia. In terms of efficacy, acupuncture or moxibustion alone was significantly better than western drugs (RR = 1.12; 95% CI, 1.06-1.20), acupuncture combined with drugs was better than drugs alone (RR = 1.20; 95% CI, 1.12-1.29), and acupuncture combined with cognitive behavior therapy intervention (CBT-I) was significantly better than CBT-I alone (RR = 1.52; 95% CI, 1.07-2.17). In terms of Pittsburgh Sleep Quality Index scores, acupuncture or moxibustion alone was more effective than western drugs (MD = -1.82; 95% CI, -2.37 to -1.26), acupuncture combined with drugs was more effective than drugs alone (MD = -3.10; 95% CI, -4.25 to -1.95), and acupuncture was significantly more effective than sham acupuncture (MD = -4.18; 95% CI, -5.85 to -2.51) and psychological intervention (MD = -3.54; 95% CI, -4.33 to -2.75) in improving sleep quality. CONCLUSIONS: This meta-analysis revealed that acupuncture or moxibustion alone or combination with other therapies(drugs, CBT-I or psychological intervention) has high clinical efficacy and can improve the sleep quality of patients with senile insomnia. However, further well-designed studies are warranted to verify these findings.

Discovery of pyranonaphthoquinones and an eighteen-membered ring macrolide from the rhizospheric soil-derived fungus Phialocephala sp. YUD18001 by OSMAC strategy.

Two new pyranonaphthoquinones, phialoyxinones A (1) and B (2), a new eighteen-membered ring lactone, phialoyxtone (3), and five known pyranonaphthoquinone derivatives were identified from the fungus Phialocephala sp. YUD18001, which was isolated from the rhizospheric soil associated with Gastrodia elata. Their structures were unequivocally established by a comprehensive interpretation of the spectroscopic data, with the stereochemistry for 1-3 was defined by a combination of TDDFT calculations, and the DP4+ probability analysis based on NMR chemical shift calculations. All of the new compounds 1-3 were evaluated for cytotoxicity and acetylcholinesterase inhibitory, compound 2 exhibited in vitro cytotoxic activities against five human cancer cell lines (HL-60, SMMC-7721, A549, MCF-7 and SW480) with IC50 values ranging from 11.80 to 19.32 µM. Compounds 2 and 3 exhibited moderate AChE inhibitory activities. A putative biosynthetic pathway for the pyranonaphthoquinones was proposed.

Effect of Zishen pingchan granules combined with pramipexole on serum BDNF, IL-1ß, IL-6, CRP, TNF-α levels in depressed patients with Parkinson's disease: Results of a randomized, double-blind, controlled study.

INTRODUCTION: Depression is a common comorbidity in Parkinson's Disease (PD) and treatment of depression can significantly support PD management. Zishen pingchan granules (ZPG), a traditional Chinese herbal formula, may help ameliorate depressive symptoms in PD patients. However, the molecular mechanisms underlying the effects of ZPG remain unclear. This study aimed to investigate the impact of ZPG on serum levels of brain-derived neurotrophic factor (BDNF), interleukin-1ß (IL-1ß), interleukin-6 (IL-6), C-reactive protein (CRP), and tumor necrosis factor-α (TNF-α) in PD patients with depression. METHODS: Eighty PD patients treated with pramipexole but still experiencing mild to moderate depression symptoms were randomly allocated to a group receiving 12-week ZPG treatment (n = 40) or placebo (n = 40). The Hamilton Depression Scale 17 items (HAM-D-17) was utilized to evaluate changes in depressive symptoms from baseline over 12 weeks, while the Unified Parkinson's Disease Rating Scales (UPDRS) part 3 was employed to assess changes in motor symptoms over the same duration. Serum levels of BDNF, IL-1ß, IL-6, CRP, and TNF-α were measured at baseline and post-treatment. RESULTS: Seventy-one participants completed the study. Following treatment, both groups showed significantly reduced HAMD scores. The placebo group demonstrated a decrease in BDNF levels, while the ZPG group showed an increase in IL-6 levels post-treatment. In the examination of the group-time interaction, the ZPG group exhibited a greater decrease in HAMD scores and increase in IL-6 levels compared to the placebo group. Conversely, the placebo group showed a greater decrease in BDNF levels compared to the ZPG group. However, no significant group differences were observed in UPDRS part 3 change scores or serum levels of IL-1ß, CRP, or TNF-α change from baseline. CONCLUSION: ZPG may potentially ameliorate depressive symptoms in PD patients, with the potential mechanism involving mitigation of reductions in serum BDNF level and an increase in IL-6 level.

Ethnobotanical study on medicinal plants used by Bulang people in Yunnan, China.

BACKGROUND: Despite the popularity of modern medicine, medicinal plants remain a cornerstone of treatment for numerous diseases, particularly among ethnic groups and tribal communities around the globe. Ethnomedicine offers advantages such as ease of use, convenience, and economic benefits. Medicinal plant knowledge within Bulang ethnic community of southwest China is a valuable complement to Chinese ethnomedicine systems. Accumulated medical knowledge is due to the extensive length of occupation by Bulang People, considered the earliest inhabitants of Xishuangbanna; this has resulted in the development of various traditional treatment methods with local characteristics and unique curative effects. Therefore, there is exceeding value in exploring the medical knowledge of Bulang. METHODS: A total of 175 local informants participated in the interviews and distribution of questionnaires in 10 Bulang villages in Menghai County, Xishuangbanna Prefecture, Yunnan Province, China. We documented the community of Bulang's use of medicinal herbs, and we used both the informant consensus factor (ICF) and use value (UV) methodologies to analyze the data. Furthermore, we conducted a comparative study to explore the potential of Bulang traditional medicine by comparing it to traditional Dai medicine. RESULTS: The study recorded 60 medicinal plant species belonging to 41 families and 59 genera, including 22 species of herb, 22 species of shrub, nine species of trees, and seven species of liana. Araceae, Compositae, Lamiaceae and Leguminosae were found to have the highest number of species. The affordability and cultural heritage of Bulang medicine make it advantageous, Investigated Informants report that increased usage of Western medicine (88%), less availability of herbal medicine (95.43%), and the reduction in medicinal plant resources (80.57%) pose significant threats to Bulang medicine. All Bulang medicinal plants are naturally grown, with only 22 per cent being cultivated. Camellia sinensis (0.94) and Zingiber officinale (0.89) showed the highest UV values, while the function of Phyllanthus emblica L. and Houttuynia cordata Thunb. were also noted. The ICF revealed digestive system related diseases were the most commonly treated, with conditions of the motor system using the highest number of plant species. Finally, a comparison with traditional Dai medicine determined that 22 plants (36.67%) of the 60 surveyed had higher medicinal value in Bulang medicine. CONCLUSION: Bulang communities primarily source medicinal plants from the wild. Should environmental damage lead to the extinction of these medicinal plants, it could result in a shift toward modern Western medicine as a preferred medical treatment. Bulang ethnomedicine is a vital supplement to China's traditional medicine, particularly aspects of ethnic medicine relevant to daily life. Future research should emphasize inter-ethnic medical studies to reveal the untapped potential of medicinal plants.

FBXW7 in breast cancer: mechanism of action and therapeutic potential.

Breast cancer is one of the frequent tumors that seriously endanger the physical and mental well-being in women. F-box and WD repeat domain-containing 7 (FBXW7) is a neoplastic repressor. Serving as a substrate recognition element for ubiquitin ligase, FBXW7 participates in the ubiquitin-proteasome system and is typically in charge of the ubiquitination and destruction of crucial oncogenic proteins, further performing a paramount role in cell differentiation, apoptosis and metabolic processes. Low levels of FBXW7 cause abnormal stability of pertinent substrates, mutations and/or deletions in the FBXW7 gene have been reported to correlate with breast cancer malignant progression and chemoresistance. Given the lack of an effective solution to breast cancer's clinical drug resistance dilemma, elucidating FBXW7's mechanism of action could provide a theoretical basis for targeted drug exploration. Therefore, in this review, we focused on FBXW7's role in a range of breast cancer malignant behaviors and summarized the pertinent cellular targets, signaling pathways, as well as the mechanisms regulating FBXW7 expression. We also proposed novel perspectives for the exploitation of alternative therapies and specific tumor markers for breast cancer by therapeutic strategies aiming at FBXW7.

Acupuncture methods for insomnia disorder in the elderly: protocol for a systematic review and network meta-analysis.

BACKGROUND: Insomnia disorder remains one of the most common sleep disorders in the elderly, with high prevalence and substantial consequences for patients' general health. Despite that increasing clinical trials have indicated that acupuncture seems to be effective for insomnia disorder in the elderly, comparative efficacy and safety of different acupuncture methods for elderly individuals with insomnia disorder has been unclear. Therefore, this protocol outlined a plan to evaluate and rank the efficacy and safety of various acupuncture approaches for insomnia disorder in the elderly. METHODS: A systematic search of 8 bibliographic databases will be conducted from their inception to 18 June 2023, including Cochrane Library, MEDLINE (via PubMed), Embase, Web of Science, Chinese National Knowledge Infrastructure (CNKI), Wanfang Database, VIP Database, and Chinese Biomedical Literature Database (CBM). Randomized controlled trials investigating acupuncture methods for insomnia disorder in the elderly, published in English or Chinese will be included. The primary outcome is sleep quality measured by the Pittsburgh Sleep Quality Index (PSQI). Two reviewers will independently perform study selection, data extraction and risk assessment of bias. The quality of included literatures will be appraised using Cochrane risk-of-bias tool (ROB 2.0). ADDIS (Aggregate Data Drug Information System) V.1.16.8 will be used to conduct Bayesian network meta-analysis. The quality of evidence will be evaluated using the Grading of Recommendations Assessment, Development and Evaluation System (GRADE). DISCUSSION: In this study, the results will provide credible evidence to assess the efficacy and safety of acupuncture therapies for elderly patients with insomnia disorder, assisting patients, physicians and clinical research investigators to select the most appropriate acupuncture method. SYSTEMATIC REVIEW REGISTRATION: The protocol has been registered at OSF ( https://osf.io/3kjpq/ ) with a registration number https://doi.org/10.17605/OSF.IO/3KJPQ .

Isolation and Identification of a Phosphate-Solubilizing Pantoea dispersa with a Saline-Alkali Tolerance and Analysis of Its Growth-Promoting Effects on Silage Maize Under Saline-Alkali Field Conditions.

Phosphate-solubilizing bacteria (PSB) are microorganisms that can dissolve insoluble phosphorus (P) to accessible forms. This study aimed to screen saline-alkali-tolerant PSB and analyze its growth promoting properties, and evaluate its effects on the growth, quality, soil nutrient balance, and enzyme activities of silage maize in the field. We isolated six phosphate-solubilizing strains from rhizosphere soil of silage maize planted in saline-alkali land, and FC-1 with the best P-solubilizing effect was used for further study. The morphological, physiological and biochemical analysis, and 16S rDNA and housekeeping gene atpD sequencing were performed for identification. FC-1 was identified as Pantoea dispersa and had high P solubility. The phosphate solubility of FC-1 using four P sources ranged from 160.79 to 270.22 mg l-1. FC-1 produced indole-3-acetic acid (IAA) and decreased the pH of the growth media by secreting organic acids, including citric acid, malic acid, succinic acid, and acetic acid. The results of a field experiment indicated that FC-1 treatment increased the height, stem diameter, fresh weight, dry weight, starch content, crude protein content, and total P content of silage maize by 9.8, 9.2, 12.6, 11.7, 12.6, 18.3, and 17.4%, respectively. The nitrogen, potassium, phosphorus, and organic matter contents in the rhizosphere soil of silage maize increased by 29.8, 17.1, 17.9, and 25.3%, respectively; urease, catalase, sucrase, and alkaline phosphatase levels also increased by 24.7, 26.7, 24.0, and 19.5%, respectively. FC-1 promoted the growth of silage maize by improving nutrient metabolism and enzyme activities in saline-alkali soil and may be an effective alternative to fertilizers.

[Bombyx Batryticatus extract promotes microglia polarization to improve neuron injury and behaviors of cerebral ischemia/reperfusion rats].

This study aims to investigate the effect of Bombyx Batryticatus extract(BBE) on behaviors of rats with global cerebral ischemia reperfusion(I/R) and the underlying mechanism. The automatic coagulometer was used to detect the four indices of human plasma coagulation after BBE intervention for quality control of the extract. Sixty 4-week-old male SD rats were randomized into sham operation group(equivalent volume of normal saline, ip), model group(equivalent volume of normal saline, ip), positive drug group(900 IU·kg~(-1) heparin, ip), and low-, medium-, and high-dose BBE groups(0.45, 0.9, and 1.8 mg·g~(-1)·d~(-1) BBE, ip). Except the sham operation group, rats were subjected to bilateral common carotid artery occlusion followed by reperfusion(BCCAO/R) to induce I/R. The administration lasted 7 days for all the groups. The behaviors of rats were examined by beam balance test(BBT). Morphological changes of brain tissue were observed based on hematoxylin-eosin(HE) staining. Immunofluorescence method was used to detect common leukocyte antigen(CD45), leukocyte differentiation antigen(CD11b), and arginase-1(Arg-1) in cerebral cortex(CC). The protein expression of interleukin-1ß(IL-1ß), interleukin-4(IL-4), interleukin-6(IL-6), and interleukin-10(IL-10) was detected by enzyme-linked immunosorbent assay(ELISA). The non-targeted metabonomics was employed to detect the levels of metabolites in plasma and CC of rats after BBE intervention. The results of quality control showed that the BBE prolonged the activated partial thromboplastin time(APTT), prothrombin time(PT), and thrombin time(TT) of human plasma, which was similar to the anticoagulation effect of BBE obtained previously. The results of behavioral test showed that the BBT score of the model group increased compared with that of the sham operation group. Compared with the model group, BBE reduced the BBT score. As for the histomorphological examination, compared with the sham operation group, the model group showed morphological changes of a lot of nerve cells in CC. The nerve cells with abnormal morphology in CC decreased after the intervention of BBE compared with those in the model group. Compared with the sham operation group, the model group had high average fluorescence intensity of CD45 and CD11b in the CC. The average fluorescence intensity of CD11b decreased and the average fluorescence intensity of Arg-1 increased in CC in the low-dose BBE group compared with those in the model group. The average fluorescence intensity of CD45 and CD11b decreased and the average fluorescence intensity of Arg-1 increased in medium-and high-dose BBE groups compared with those in the model group. The expression of IL-1ß and IL-6 was higher and the expression of IL-4 and IL-10 was lower in the model group than in the sham operation group. The expression of IL-1ß and IL-6 was lower and the expression of IL-4 and IL-10 was higher in the low-dose, medium-dose, and high-dose BBE groups than in the model group. The results of non-targeted metabonomics showed that 809 metabolites of BBE were identified, and 57 new metabolites in rat plasma and 45 new metabolites in rat CC were found. BBE with anticoagulant effect can improve the behaviors of I/R rats, and the mechanism is that it promotes the polarization of microglia to M2 type, enhances its anti-inflammatory and phagocytic functions, and thus alleviates the damage of nerve cells in CC.

Genome-Wide Investigation and Functional Analysis Reveal That CsGeBP4 Is Required for Tea Plant Trichome Formation.

Tea plant trichomes not only contribute to the unique flavor and high quality of tea products but also provide physical and biochemical defenses for tea plants. Transcription factors play crucial roles in regulating plant trichome formation. However, limited information about the regulatory mechanism of transcription factors underlying tea plant trichome formation is available. Here, the investigation of trichome phenotypes among 108 cultivars of Yunwu Tribute Tea, integrated with a transcriptomics analysis of both hairy and hairless cultivars, revealed the potential involvement of CsGeBPs in tea trichome formation. In total, six CsGeBPs were identified from the tea plant genome, and their phylogenetic relationships, as well as the structural features of the genes and proteins, were analyzed to further understand their biological functions. The expression analysis of CsGeBPs in different tissues and in response to environmental stresses indicated their potential roles in regulating tea plant development and defense. Moreover, the expression level of CsGeBP4 was closely associated with a high-density trichome phenotype. The silencing of CsGeBP4 via the newly developed virus-induced gene silencing strategy in tea plants inhibited trichome formation, indicating that CsGeBP4 was required for this process. Our results shed light on the molecular regulatory mechanisms of tea trichome formation and provide new candidate target genes for further research. This should lead to an improvement in tea flavor and quality and help in breeding stress-tolerant tea plant cultivars.

First Report of Epicoccum latusicollum Causing Leaf Blight on Curcuma kwangsiensis in China.

Curcuma kwangsiensis S. G. Lee et C. F. Liang is a traditional Chinese medicinal plant distributed in Guangxi and Yunnan Province, China. In May 2021, a leaf blight disease on C. kwangsiensi was observed in a plantation (~ 2 ha) in Lingshan county (21°51'00″N, 108°44'00″E), Guangxi Province. Disease incidence was up to 30% (n = 200). Initially, yellow to brown, irregular, water-soaked spots appeared at the tips or margins of leaves. As the disease progressed, the lesions gradually enlarged, merged. Finally, the entire leaf wilted, leading to defoliation. To isolate the pathogen, eighteen small pieces ( ~ 5 mm2) were cut from the margin of the necrotic lesions, surface disinfected with 1% NaOCl solution for 2 min, and rinsed three times in sterile water. Then the tissues were plated onto potato dextrose agar (PDA) and incubated for 3 days at 28°C. Hyphal tips from recently germinated spores were transferred to PDA to obtain pure cultures. Twelve isolates were obtained, of which ten isolates with similar morphological characterization. Two single-spore isolates (CK45.1 and CK45.2) were subjected to further morphological and molecular characterization. Colonies on PDA were villose, had a dense growth of aerial mycelia, and appeared white to grayish eventually. Pycnidia were brown, predominantly spheroidal, and 45.0 to 205.4 µm in diameter (n = 60). Conidia were ellipsoidal, aseptate, and 3.8 to 6.1 × 1.8 to 3.6 µm (n = 90). Morphological characteristics are similar to those of Epicoccum latusicollum (Chen et al. 2017).For molecular identification, primers ITS1/ITS4 (White et al. 1990), LR0R/LR5 (Vilgalys and Hester 1990, Rehner and Samuels 1994), RPB2-Ep-F (GGTCTTGTGTGCCCCGCTGAGAC)/RPB2-Ep-R TCGGGTGACATGACAATCATGGC), and TUB2-Ep-F (GTTCACCTTCAAACCGGTCAATG)/TUB2-Ep-R (AAGTTGTCGGGACGGAAGAGCTG) were used to amplify the internal transcribed spacer (ITS), partial nuclear large subunit rDNA (LSU), RNA polymerase II second largest subunit (rpb2), and ß-tubulin (tub2) genes, respectively. The obtained ITS (OP788080-81), LSU (OP811325-26), rpb2 (OP811267-68) and tub2 (OP811269-70) sequences showed 99.8% (478/479, and 478/479 bp), 99.9% (881/882, and 870/871 bp), 99.8 to 100% (429/431, and 429/430 bp), and 99.7% (332/333, and 332/333 bp) identity with those of ex-type strain E. latusicollum CGMCC 3.18346 (KY742101, KY742255, KY742174, KY742343). In addition, a phylogenetic analysis confirmed the isolates as E. latusicollum. Therefore, based on morphological and molecular characteristics, the isolates were identified as E. latusicollum. To verify pathogenicity, healthy leaves on nine plants (1 leaf per plant) were inoculated with mycelial discs from 5-day-old water-agar medium (WA) cultures of the strain CK45.1. Each leaf had four inoculation sites, two were inoculated with a representative strain, and two treated with pollution-free WA discs served as control. Plants were covered with transparent plastic bags and maintained in a greenhouse at 25°C with a 12 h photoperiod. Six days post-inoculation, the inoculated sites of leaves showed brown lesions, while the control remained healthy. The experiments repeated three times showed similar results. Koch's postulates were fulfilled by re-isolation of E. latusicollum from the lesions. To our knowledge, this is the first report of E. latusicollum causing leaf blight of C. kwangsiensi in China. This report might provide important information for growers to manage this disease.

Transcriptome profiling of transcription factors in Ganoderma lucidum in response to methyl jasmonate.

Ganoderma lucidum is a traditional Chinese medicine and its major active ingredients are ganoderma triterpenoids (GTs). To screen for transcription factors (TFs) that involved in the biosynthetic pathway of GTs in G. lucidum, the chemical composition in mycelia, primordium and fruiting body were analyzed, and the transcriptomes of mycelia induced by methyl jasmonate (MeJA) were analyzed. In addition, the expression level data of MeJA-responsive TFs in mycelia, primordia and fruiting body were downloaded from the database, and the correlation analysis was carried out between their expression profiles and the content of total triterpenoids. The results showed that a total of 89 components were identified, and the content of total triterpenoids was the highest in primordium, followed by fruiting body and mycelia. There were 103 differentially expressed TFs that response to MeJA-induction including 95 upregulated and 8 downregulated genes. These TFs were classified into 22 families including C2H2 (15), TFII-related (12), HTH (9), fungal (8), bZIP (6), HMG (5), DADS (2), etc. Correlation analysis showed that the expression level of GL23559 (MADS), GL26472 (HTH), and GL31187 (HMG) showed a positive correlation with the GTs content, respectively. While the expression level of GL25628 (fungal) and GL26980 (PHD) showed a negative correlation with the GTs content, respectively. Furthermore, the over expression of the Glmhr1 gene (GL25628) in Pichia pastoris GS115 indicated that it might be a negative regulator of GT biosynthesis through decreasing the production of lanosterol. This study provided useful information for a better understanding of the regulation of TFs involved in GT biosynthesis and fungal growth in G. lucidum.

Benefits of Tai Chi Quan on neurodegenerative diseases: A systematic review.

BACKGROUND: Neurodegenerative diseases have become an important concern with the accelerated aging process. Tai Chi Quan (TCQ) has positive benefits for brain health and chronic diseases. The aim of this study was to summarize the protective effects of TCQ for motor function, cognition, quality of life, and mood in patients with neurodegenerative diseases. METHODS: A systematic search was conducted via PubMed database and the Web of Science core collection database until August 20, 2021. The available English systematic reviews, meta-analyses, and clinical trials were included. Two reviewers completed the screening and assessment process independently. RESULTS: A total of 28 studies on Parkinson's disease, 21 on cognitive impairment, and 9 on multiple sclerosis met the included criteria. The study found that TCQ remarkably improved general motor function and balance, and prevented falls for Parkinson's disease. TCQ significantly improved global cognitive function for cognitive impairment. TCQ was likely safe and beneficial for multiple sclerosis as result of heterogeneous outcomes and small samples. CONCLUSION: TCQ exercise can effectively improve the motor function, global cognitive function, and falls in patients with neurodegenerative diseases. However, the positive effects of TCQ on the quality of life and mood of patients with neurodegenerative diseases need further evidence.

Identification of Neofusicoccum parvum as the causative agent of leaf spot disease on Bletilla striata in China.

Bletilla striata (Thunb.) Rchb. f. (Orchidaceae) is an essential traditional Chinese medicinal plant used to treat hemorrhage, swelling, inflammation, ulcers, and pulmonary diseases (Xu et al. 2019). In April of 2020, an unknown leaf spot disease was observed on B. striata in a plantation (~ 0.2 ha) in Nanning, Guangxi province, China. Disease incidence was estimated at approximately 25% (n = 150 plants). The initial symptoms were small brown circular spots, which then expanded into reddish to brown, circular to irregular lesions 5-10 mm in diameter. As the disease developed, the whole leaf became densely covered with lesions. Finally, the lesions coalesced, killing the leaf and resulting in defoliation. To isolate the causal agent, six symptomatic leaves were collected from individual plants. Small pieces (~ 5 mm2) were cut from the margin of the necrotic lesions (n = 18), disinfected in 1% NaOCl for 2 min before rinsing three times in sterile water, and placed on potato dextrose agar (PDA) at 26°C for 3 days. Hyphal tips from the resulting cultures were transferred to PDA to obtain pure cultures. Fifteen isolates were obtained, of which twelve isolates exhibited similar morphology. Colonies on PDA were initially white, then turned dark gray after 7 days. Pycnidia were produced on the surface of PDA after 50 days. Conidia were hyaline, aseptate, ellipsoidal to fusiform, externally smooth, thin-walled, and measuring 11.5 to 15.2 × 4.9 to 6.1 µm (mean ± SD: 13.4 ± 1.0 × 5.4 ± 0.3 µm, n = 60). Morphological features were similar to N. parvum (Phillips et al. 2013). For further molecular identification, the internal transcribed spacer (ITS) region, partial translational elongation factor subunit 1-α (EF-1α), ß-tubulin (TUB2) genes were amplified and sequenced using the primer pairs ITS1/ITS4 (White et al. 1990), EF1-728F (Carbone and Kohn 1999)/EF-2 (O'Donnell et al. 1998), and Bt2a/Bt2b (Glass and Donaldson 1995), respectively. Sequences of the two isolates BJ-111.1 and BJ-111.4 were deposited in NCBI GenBank under the following accession numbers: OM348509-10, OM397537-40. The obtained ITS, EF1-α, and TUB2 sequences showed 99% (514/516, and 513/516 bp), 99% (275/276, and 274/275 bp), and 99% (429/431, and 429/430 bp) homology with several GenBank sequences of the ex-type strain N. parvum CMW 9081 (AY236943, AY236888, and AY236917, respectively) (Zhang et al. 2017). In addition, a phylogenetic analysis confirmed the isolates as N. parvum. Therefore, the isolates were identified as N. parvum based on morphological and molecular evidence. Furthermore, pathogenicity tests were carried out on 1.5-year-old B. striata plants. Healthy leaves on six plants (1 leaf per plant) were inoculated with a 10-µl droplet of conidial suspensions (106 conidia/mL). Three plants treated with sterile water served as the control. All plants were covered with transparent plastic bags and incubated in a greenhouse at 26°C with a 12 h photoperiod. Six days post-inoculation, the inoculated leaves showed leaf spot symptoms, while the control plants remained healthy. The experiments repeated three times showed similar results. Finally, N. parvum was consistently re-isolated from the infected leaves and confirmed by morphology and sequencing, fulfilling Koch's postulates. No fungus was isolated from the controls. To our knowledge, this is the first report of N. parvum causing leaf spot of B. striata worldwide. This result will help develop disease management strategies against this pathogen.

Zishen pingchan granules combined with pramipexole in the improvement of depressive symptoms in Parkinson's disease: a prospective, multicenter, randomized, double-blind, controlled clinical study.

BACKGROUND AND OBJECTIVE: Zishen Pingchan granule (ZPG), a traditional Chinese herbal recipe for treating Parkinson's disease (PD), is usually used as an add-on drug with some antiparkinsonian drugs in China. The objectives of this study were to evaluate the efficacy, safety, and tolerability of ZPG combined with pramipexole in the treatment of depression in PD (dPD). METHODS: A 12-week, multicenter, randomized, double-blind, and placebo-controlled study on ZPG was performed on a total of 200 patients who were treated with pramipexole but still had mild to moderate depressive symptoms. Patients were randomly divided into ZPG (n = 100) or placebo (n = 100). The primary effective result was the mean change from the baseline on the Hamilton Depression Scale 17 items (HAM-D-17) over 12 weeks and the clinical efficacy rate. Secondary endpoints were the mean change from the baseline in the Geriatric Depression Scale (GDS-15), Unified Parkinson's disease rating scale Part III (UPDRS III), Parkinson's quality of life scale (PDQ-8), and Parkinson's disease sleep scale (PDSS-2) over 12 weeks. RESULTS: After 12 weeks of treatment, ZPG significantly reduced the mean [95% confidence interval] HAMD score vs. placebo (- 1.43 scores [- 2.50, - 0.36]; p = 0.009). The clinical remission rate and responders of the ZPG group were higher than those of the placebo (46.1% vs. 31.0%; p = 0.041; 34.8% vs. 18.4%; p = 0.014). A significant improvement in the PDSS-2 score was also observed in the ZPG group compared with that in the placebo group (- 3.56 scores [- 5.77, - 1.35]; p = 0.002). A total of 7 patients (7.1%) in the ZPG group had mild adverse events (AEs) vs 9 patients (9%) in the placebo group. No severe AEs were observed in either group. The randomization and controlled clinical study revealed that ZPG was effective, safe, and well-tolerated. CONCLUSION: ZPG combined with pramipexole further reduced the depressive symptoms and improved the sleeping quality of PD patients. Trial registration The protocol was retrospectively registered at the Chinese Clinical Trial Registry, Unique identifier: ChiCTR1800019942, date of registration: December 9, 2018; http://www.chictr.org.cn/showproj.aspx?proj=30432.