18s rDNA characterization and morphological investigation of the medicinal leech Hirudo medicinalis from Felaw Pond.

Hirudinea leeches are obligate parasites on a variety of vertebrates and have recently gained attention for their medicinal purposes. The present study aimed to improve the presence of Hirudo medicinalis in Kurdistan and Iraq (especially because it is regarded as a native species in this region). A total of 23 leech specimens were collected from Felaw Pond during January-July 2023. The collected specimens were investigated morphologically and their species were confirmed according to their partial sequence of 18s rDNA. Primers used were universal, C1 (ACCCGCTGAATTTAAGCAT) (forward primer), and C3 (CTCTTCAGAGTACTTTTCAAC) (reverse primer). The results of the morphological study and molecular sequencing of partial 18s rDNA demonstrated that all these leech specimens belonged to Hirudo medicinalis with an abundance of 0.13 leech/ m2. The present record was the first one investigating this species in Iraq.

Transcriptomic profiling and the first spatial expression analysis of candidate genes in the salivary gland of the East Asian medicinal leech, Hirudo nipponia.

Hirudo nipponia, a blood-sucking leech native to East Asia, possesses a rich repertoire of active ingredients in its saliva, showcasing significant medical potential due to its anticoagulant, anti-inflammatory, and antibacterial effects against human diseases. Despite previous studies on the transcriptomic and proteomic characteristics of leech saliva, which have identified medicinal compounds, our knowledge of tissue-specific transcriptomes and their spatial expression patterns remains incomplete. In this study, we conducted an extensive transcriptomic profiling of the salivary gland tissue in H. nipponia based on de novo assemblies of tissue-specific transcriptomes from the salivary gland, teeth, and general head region. Through gene ontology (GO) analysis and hierarchical clustering, we discovered a novel set of anti-coagulant factors-i.e., Hni-Antistasin, Hni-Ghilanten, Hni-Bdellin, Hni-Hirudin-as well as a previously unrecognized immune-related gene, Hni-GLIPR1 and uncharacterized salivary gland specific transcripts. By employing in situ hybridization, we provided the first visualization of gene expression sites within the salivary gland of H. nipponia. Our findings expand on our understanding of transcripts specifically expressed in the salivary gland of blood-sucking leeches, offering valuable resources for the exploration of previously unidentified substances with medicinal applications.

The effect of blood human, domestic and small laboratory animals on the viability and behavior of the medicinal leech.

Medicinal leeches are used for therapeutic purposes in the prevention and treatment of many diseases. Because they have a large amount of biologically active substances in their body. Each of these substances has many therapeutic effects. In natural conditions, they are mostly are fed of blood by wild animals. In laboratory conditions, the blood of domestic animals is mostly used.  Currently, medicinal leeches are mostly bred in laboratory conditions. Because there are very few of them in nature. They are listed in the Red Book. Scientists of various specialties are looking  for optimal conditions for their life and breeding. That became our research goal. To identify the influence of blood human, domestic animals (pigs and chickens) and small laboratory animals (rats) on the viability and behavior of medicinal leeches Hirudo verbana Carena, 1820 and Hirudo orientalis Utevsky & Trontelj, 2005. According to this, 8 groups of sexually mature animals were formed: 1 and 2 - human blood; 3, 4 - blood of a domestic pig; 5, 6 - blood of domestic chickens; 7, 8 - blood of a non-linear laboratory rat. As a result of the study, it was found that the blood of pigs and chickens is the most suitable for feeding the medical leech for normal life and behavior. Mortality of leeches was observed when feeding on rat and human blood. It should be noted that at the beginning of feeding animals with blood human. The percentage of cannibalism in animals increased.

Structural insights into thrombolytic activity of destabilase from medicinal leech.

Destabilase from the medical leech Hirudo medicinalis belongs to the family of i-type lysozymes. It has two different enzymatic activities: microbial cell walls destruction (muramidase activity), and dissolution of the stabilized fibrin (isopeptidase activity). Both activities are known to be inhibited by sodium chloride at near physiological concentrations, but the structural basis remains unknown. Here we present two crystal structures of destabilase, including a 1.1 Å-resolution structure in complex with sodium ion. Our structures reveal the location of sodium ion between Glu34/Asp46 residues, which were previously recognized as a glycosidase active site. While sodium coordination with these amino acids may explain inhibition of the muramidase activity, its influence on previously suggested Ser49/Lys58 isopeptidase activity dyad is unclear. We revise the Ser49/Lys58 hypothesis and compare sequences of i-type lysozymes with confirmed destabilase activity. We suggest that the general base for the isopeptidase activity is His112 rather than Lys58. pKa calculations of these amino acids, assessed through the 1 µs molecular dynamics simulation, confirm the hypothesis. Our findings highlight the ambiguity of destabilase catalytic residues identification and build foundations for further research of structure-activity relationship of isopeptidase activity as well as structure-based protein design for potential anticoagulant drug development.

Therapeutic effects of Hirudo medicinalis extract antigens on modulation of CD4+CD25+Foxp3 T cell activity in murine eimeriosis.

Eimeriosis is a common parasitic disease in the chicken industry. The aim of this study was to assess the protective role of Hirudo extract antigens (HEA) against murine eimeriosis induced by Eimeria papillate. The oocyst output, developmental stages, goblet cells and oxidative stress, were investigated. Immunohistochemistry was used to detect anti-apoptotic Bcl2 marker and the number of both CD4+ and CD25+ cells in jejunal tissue, while ELISA was used to quantify TGF-ß, IL-10 and IL-22 in jejunal tissue homogenate. Real-time PCR was also used to detect mRNA expression of mucin 2 (MUC2), inducible nitric oxide synthase (iNOS), IL-1ß, IFN-γ, TNF-α, IL-6, and FoxP3. The most effective dose (5 µg/mice) reduced the oocyst output by 82.95 ± 1.02% (P ˂ 0.001). Similarly, the same dose reduced the jejunal developmental stages by 66.67 ± 0.49% (P ˂ 0.001). Furthermore, HEA therapy increased the number of jejunal goblet cells by 12.8 ± 1 (P ˂ 0.001) and the expression of MUC2 by 0.83 ± 0.06 (P ˂ 0.001). In contrast, TNF-α, IFN-γ, IL-6, iNOS, and IL-1ß expression as well as apoptosis were reduced. The number of CD4+ and CD25+ in the jejunal tissue was increased (14.6 ± 1.2 (P ˂ 0.001), 6.84 ± 1 (P ˂ 0.01), respectively) after HEA therapy. The molecular analysis showed an increased expression of intestinal Foxp3 (3.2 ± 0.13 (P ˂ 0.001), while IL-22 was reduced (124 ± 10 (P ˂ 0.001)) versus an increase in TGF-ß (250 ± 17 (P ˂ 0.01)) and IL-10 (236 ± 16 (P ˂ 0.001)) after HEA treatment in comparison to the non-treated infected group. With respect to the infected group, HEA reduced lipid peroxidation (LPO) (15.7 ± 1.12 (P ˂ 0.001)) and nitric oxide (NO) (13 ± 1.3 (P ˂ 0.001)) but increased reduced glutathione (GSH) (3.7 ± 0.26 (P ˂ 0.001)). In conclusion, HEA therapy protected against intestinal tissue damage by activation of CD4+CD25+Foxp3 cells which showed anti-inflammatory action. Hence, HEA can be recommended as a therapeutic treatment for eimeriosis.

Make it double: identification and characterization of a Tandem-Hirudin from the Asian medicinal leech Hirudinaria manillensis.

Haematophagous leeches express a broad variety of secretory proteins in their salivary glands, among them are hirudins and hirudin-like factors. Here, we describe the identification, molecular and initial functional characterization of Tandem-Hirudin (TH), a novel salivary gland derived factor identified in the Asian medicinal leech, Hirudinaria manillensis. In contrast to the typical structure of hirudins, TH comprises two globular domains arranged in a tandem-like orientation and lacks the elongated C-terminal tail. Similar structures of thrombin inhibitors have so far been identified only in kissing bugs and ticks. Expression of TH was performed in both cell-based and cell-free bacterial systems. A subsequent functional characterization revealed no evidence for a thrombin-inhibitory potency of TH.

Serotonin mediates stress-like effects on responses to non-nociceptive stimuli in the medicinal leech Hirudo verbana.

Noxious stimuli can elicit stress in animals that produce a variety of adaptations including changes in responses to nociceptive and non-nociceptive sensory input. One example is stress-induced analgesia that may be mediated, in part, by the endocannabinoid system. However, endocannabinoids can also have pro-nociceptive effects. In this study, the effects of electroshock, one experimental approach for producing acute stress, were examined on responses to non-nociceptive mechanical stimuli and nociceptive thermal stimuli in the medicinal leech (Hirudo verbana). The electroshock stimuli did not alter the leeches' responses to nociceptive stimuli, but did cause sensitization to non-nociceptive stimuli, characterized by a reduction in response threshold. These experiments were repeated with drugs that either blocked synthesis of the endocannabinoid transmitter 2-arachidonoylglycerol (2-AG) or transient receptor potential vanilloid (TRPV) channel, which is known to act as an endocannabinoid receptor. Surprisingly, neither treatment had any effect on responses following electroshock. However, the electroshock stimuli reliably increased serotonin (5-hydroxytryptamine or 5HT) levels in the H. verbana CNS. Injection of 5HT mimicked the effects of the electroshocks, sensitizing responses to non-nociceptive stimuli and having no effect on responses to nociceptive stimuli. Injections of the 5HT receptor antagonist methysergide reduced the sensitization effect to non-nociceptive stimuli after electroshock treatment. These results indicate that electroshocks enhance response to non-nociceptive stimuli but do not alter responses to nociceptive stimuli. Furthermore, while 5HT appears to play a critical role in this shock-induced sensitizing effect, the endocannabinoid system seems to have no effect.

The effects of substrate porosity, mechanical substrate properties and loading conditions on the attachment performance of the Mediterranean medicinal leech (Hirudo verbana).

The ectoparasitic lifestyle of the Mediterranean medicinal leech (Hirudo verbana) requires reliable functioning of its attachment organs (i.e. anterior and posterior suction discs) on multiple habitat- and host-specific surfaces under both normal and shear stresses. In addition to some intrinsic properties of the attachment devices, however, only a few extrinsic factors (e.g. substrate roughness and porosity) have been considered in previous studies on leech suckers. Using centrifugal force experiments, we analysed the attachment performance of H. verbana under different types of loading on artificial substrates differing in porosity and their mechanical properties. Whereas the substrate porosity significantly influenced leech attachment under normal and shear loading, the different mechanical properties did not noticeably affect attachment within the considered parameter limits. Furthermore, suction was confirmed to be the primary attachment mechanism independent of the prevailing loading condition. The question of whether the suction cups of H. verbana are adapted to a specific loading condition could not be answered. In any case, our results again highlight the high functional resilience of leech suckers guaranteeing a successful ectoparasitic lifestyle.

The genome of medicinal leech (Whitmania pigra) and comparative genomic study for exploration of bioactive ingredients.

BACKGROUND: Leeches are classic annelids that have a huge diversity and are closely related to people, especially medicinal leeches. Medicinal leeches have been widely utilized in medicine based on the pharmacological activities of their bioactive ingredients. Comparative genomic study of these leeches enables us to understand the difference among medicinal leeches and other leeches and facilitates the discovery of bioactive ingredients. RESULTS: In this study, we reported the genome of Whitmania pigra and compared it with Hirudo medicinalis and Helobdella robusta. The assembled genome size of W. pigra is 177 Mbp, close to the estimated genome size. Approximately about 23% of the genome was repetitive. A total of 26,743 protein-coding genes were subsequently predicted. W. pigra have 12346 (46%) and 10295 (38%) orthologous genes with H. medicinalis and H. robusta, respectively. About 20 and 24% genes in W. pigra showed syntenic arrangement with H. medicinalis and H. robusta, respectively, revealed by gene synteny analysis. Furthermore, W. pigra, H. medicinalis and H. robusta expanded different gene families enriched in different biological processes. By inspecting genome distribution and gene structure of hirudin, we identified a new hirudin gene g17108 (hirudin_2) with different cysteine patterns. Finally, we systematically explored and compared the active substances in the genomes of three leech species. The results showed that W. pigra and H. medicinalis exceed H. robusta in both kinds and gene number of active molecules. CONCLUSIONS: This study reported the genome of W. pigra and compared it with other two leeches, which provides an important genome resource and new insight into the exploration and development of bioactive molecules of medicinal leeches.

Hirudotherapy in Wound Healing.

Leeches are hermaphrodite, bloodsucking parasitic worms usually found in places with fresh water. Leech therapy existed 3000 years, and it is being used at a different scope. Several species of leeches have been used in medicine, and the most common species used is Hirudo medicinalis. Leeches suck the excess blood, reduce the swelling in the tissues, and promote healing by allowing fresh oxygenated blood to reach the area until normal circulation can be restored. Pain relief from leech therapy is rapid, effective, and long-lasting in many conditions. The aim of this study was to evaluate the efficacy and duration of healing utilizing sterile medicinal leeches, Hirudinaria manillensis, in the management of pain and wound healing. Leech was taken out from its sterile tube by using a pair of non-tooth sterile plastic forceps and gloved hands. Each leech was left in place for as long as it was feeding. Leeches were removed only after they became detached from the patient. The specimen jars containing the used leeches were sealed in either a biohazard bag or in a small yellow clinical waste bin liner securely fastened with a cable tie. The leech was killed by using 70% alcohol prior to disposal into a yellow hazard bin, which undergoes incineration. All 3 patients had improvements in their condition, especially in terms of reduction in the pain and improvement in their sense of balance. All the wounds healed well. Therefore, leech therapy is effective in reducing pain and increasing perfusion to allow the wounds to heal quickly. However, a more robust trial is needed to show significance as the sample size is small.

Comparison of body wall histologic structure of two medicinal leeches Hirudo sulukii and Hirudo verbana (Hirudinida: Hirudinidae).

In this study, it was aimed to determine secretory cell types using histochemical properties of secretory cells and epidermis histology in the body wall of two medicinal leech species, Hirudo verbana and Hirudo sulukii. In addition, areas of epidermis epithelial cells, secretory cell types, and secretion areas of secretory cells stained with histochemical stains were statistically compared in both species. Epidermis is composed of single layer of cylindrical epithelium and secretory cells. The cuticle layer covers the epithelial layer. Some Type 1 cells within and close to the epidermis were determined as pear-shaped secretory cells. Type 2a and Type 2b secretory cells were found in large groups in the inner parts of the body wall, especially around muscles. While Type 1 cells were stained weakly with PAS and AB, Type 2b cells were stained darker than Type 2a cells. Statistical calculations showed that areas of epithelial and secretory cells were generally larger in H. sulukii than in H. verbana. Therefore, H. sulukii was thought to be a more resistant species compared to H. verbana. As secretion areas of secretory cells reacting with PAS and AB stains were generally larger in H. sulukii, it was concluded that mucus composition between the two species has different concentration.

Short tail stories: the hirudin-like factors HLF6 and HLF7 of the Asian medicinal leech, Hirudinaria manillensis.

The leech-derived hirudins and hirudin-like factors (HLFs) share a common molecule structure: a short N-terminus, a central globular domain, and an elongated C-terminal tail. All parts are important for function. HLF6 and HLF7 were identified in the Asian medicinal leech, Hirudinaria manillensis. The genes of both factors encode putative splice variants that differ in length and composition of their respective C-terminal tails. In either case, the tails are considerably shorter compared to hirudins. Here we describe the functional analyses of the natural splice variants and of synthetic variants that comprise an altered N-terminus and/or a modified central globular domain. All natural splice variants of HLF6 and HLF7 display no detectable thrombin-inhibitory potency. In contrast, some synthetic variants effectively inhibit thrombin, even with tails as short as six amino acid residues in length. Our data indicate that size and composition of the C-terminal tail of hirudins and HLFs can vary in a great extent, yet the full protein may still retain the ability to inhibit thrombin.

Spectral responses across a dorsal-ventral array of dermal sensilla in the medicinal leech.

How do animals use visual systems to extract specific features of a visual scene and respond appropriately? The medicinal leech, Hirudo verbana, is a predatory, quasi-amphibious annelid with a rich sensorium that is an excellent system in which to study how sensory cues are encoded, and how key features of visual images are mapped into the CNS. The leech visual system is broadly distributed over its entire body, consisting of five pairs of cephalic eyecups and seven segmentally iterated pairs of dermal sensilla in each mid-body segment. Leeches have been shown to respond behaviorally to both green and near ultraviolet light (UV, 365-375 nm). Here, we used electrophysiological techniques to show that spectral responses by dermal sensilla are mapped across the dorsal-ventral axis, such that the ventral sensilla respond strongly to UV light, while dorsal sensilla respond strongly to visible light, broadly tuned around green. These results establish how key features of visual information are initially encoded by spatial mapping of photo-response profiles of primary photoreceptors and provide insight into how these streams of information are presented to the CNS to inform behavioral responses.

Functional morphology of the suckers and teeth of the medicinal leech Hirudo verbana Carena, 1820 (Annelida; Clitellata; Hirudinida): A scanning electron microscope study.

In this study, the triple jaws and suckers of the leeches belonging to the Hirudo verbana Carena, 1820 (Annelida; Clitellata; Hirudinida) were examined using the stereomicroscopy and scanning electron microscopy. In H. verbana, suckers are seen on the first annulus and last annulus of the body. The mouth opens in the center of the front suction cup, and behind this opening is a movable triple jaw apparatus with many teeth. The posterior sucker disc consists of the last seven body segments and lacks an opening. The shape of the jaw is trignatous. The pharynx is equally located around of the three muscular jaws. The jaws are muscular covered with cuticle and carry a row of teeth arranged at the tip. In this study, it was determined that secretory canal holes were identified between the teeth. The results show that the size of teeth determines long-term bleeding so revealing the structure and working mechanism of the teeth has importance for medicinal leeches. At the same time, the difference of teeth and jaw structures of leeches may be a criterion in the classification of medicinal leeches.

Clinical efficacy of medicinal leech therapy in treating third- and fourth-degree hemorrhoids / Eficácia clínica da hirudoterapia no tratamento de hemorroidas de terceiro e quarto graus

Abstract Objectives Hemorrhoids are characterized by bleeding, mucous discharge, itching, pain, and prolapse. This condition is known as bawaseer in Unani medicine, and Hirudinaria granulosa has been used for its treatment in Irsal-e Alaq, or medicinal leech therapy (MLT), for centuries. Hirudinaria granulosa with antithrombotic and antiinflammatory action is used in the treatment of chronic venous disease and hemorrhoids. The present study was aimed to investigate the efficacy of MLT in third and fourth-degree hemorrhoids. Methods A single-centre prospective, clinical trial with a pre and postanalysis design was conducted at the hospital of the National Institute of UnaniMedicine. Twenty male and female patients, with a mean age of 38 years, presenting moderate symptoms assessed with the colorectal evaluation of clinical therapeutics scale (CORECTS) questionnaire were included in the study. Hirudinaria granulosa were applied around the pile mass for 15 minutes weekly, for 4 weeks. The efficacy of the treatment was measured by an objective and subjective assessment using the CORECTS. Results When analyzed by the clinician, MLT reduced the symptoms' severity score in the following domains: pain (55% improvement; p < 0.001); anorectal itching (30% improvement; p < 0.10); and bleeding (10% improvement; p < 0.7963). Significant improvement (p < 0.001) was reported in the CORECTS score in relation to pain (44.09% improvement; p < 0.001), itching (38.55% improvement; p < 0.001), swelling (44% improvement; p < 0.001), bleeding (17.28% improvement; p < 0.007), discomfort (34.01% improvement; p < 0.001), and wellbeing (32.35 % improvement; p < 0.001), giving an average overall opinion on the therapy of 4/10. Conclusion The results of the study albeit smaller in sample size show that MLT is an effective and safe therapeutic option in reducing the symptoms of 3rd and 4th degree haemorrhoids.

Resumo Objetivos As hemorroidas são caracterizadas por sangramento, secreção mucosa, prurido, dor e prolapso. Esta condição é conhecida como bawaseer namedicina Unani, e a Hirudinaria granulosa tem sido usada para seu tratamento na Irsal-e Alaq, ou hirudoterapia, há séculos. A H. granulosa, devido à sua ação antitrombótica e antiinflamatória, é utilizada no tratamento de doenças venosas crônicas e hemorroidas. O presente estudo teve como objetivo investigar a eficácia da hirudoterapia em hemorroidas de terceiro e quarto graus. Métodos Este ensaio clínico prospectivo e unicêntrico com delineamento pré e pósanálise foi conduzido no hospital do National Institute of Unani Medicine. Foram incluídos no estudo 20 pacientes de ambos os sexos, com média de idade de 38 anos, que apresentavam sintomas moderados avaliados pelo questionário colorectal evaluation of clinical therapeutics scale (CORECTS). Espécimes de H. granulosa foram aplicadas em volta da área afetada por um período de 15 minutos semanais, durante 4 semanas. A eficácia do tratamento foi medida por uma avaliação objetiva e subjetiva usando o questionário CORECTS. Resultados Quando analisada pelo clínico, a hirudoterapia reduziu o escore de gravidade dos sintomas nos seguintes domínios: dor (55% de melhora; p < 0,001); prurido anorretal (melhora de 30%; p < 0,10); e sangramento (melhora de 10%; p < 0,7963). Melhora significativa (p < 0,001) foi relatada no escore CORECTS em relação à dor (44,09% de melhora; p < 0,001), prurido (38,55% de melhora; p < 0,001), inchaço (44% de melhora; p < 0,001), sangramento (17,28 % de melhora; p < 0,007), desconforto (34,01% de melhora; p < 0,001) e bem-estar (32,35% de melhora; p < 0,001), o que resultou em uma opinião geral média sobre a terapia de 4/10. Conclusão Os resultados do estudo, embora com tamanho de amostra pequeno, mostram que a hirudoterapia é uma opção terapêutica eficaz e segura na redução dos sintomas de hemorroidas de terceiro e quarto graus.

Arterial only anastomosis associated with modified Baudet technique in ear replantation: Case reports and literature review.

BACKGROUND: Total ear amputation is a relatively rare trauma with an absolute indication for surgical treatment. Numerous techniques for auricular reconstruction have been described. When local and general conditions allow microsurgical replantation, this must be the first choice. We propose the association of microsurgical techniques with some modification (modified Baudet technique) to obtain higher survival rate of the reimplanted stump. METHODS: This study included cases of 3 male patients with total ear amputation, the injuries and their mechanism (workplace accident) being identical. Chief complaints were pain, bleeding, important emotional impact due by an unaesthetic appearance. The established diagnosis was traumatic complete ear amputation (grade IV auricular injury according to Weerda classification). Microsurgical replantation was performed only with arteriorraphy, and no vein anastomosis. Cartilage incisions and skin excisions were made to enlarge the cartilage-recipient site contact area. Medicinal leeches were used to treat venous congestion, to which systemic anticoagulant therapy was added. RESULTS: The results showed the survival of the entire replanted segment in all cases, with good function and esthetical appearance. Patients were fully satisfied with the final outcome. CONCLUSION: Microsurgical replantation is the gold standard, for the surgical treatment of total ear amputation. We believe that cartilage incisions and the increased surface of contact between cartilage and recipient site has an adjuvant role in revascularization of the amputated stump (with only arterial anastomosis) and the use of hirudotherapy helps to relieve early venous congestion.

Effects of calcium-activated potassium channel modulators on afterhyperpolarizing potentials in identified motor and mechanosensory neurons of the medicinal leech.

Calcium-activated potassium (KCa) channels contribute to multiple neuronal properties including spike frequency and afterhyperpolarizing potentials (AHPs). KCa channels are classified as KCa1.1, KCa2, or KCa3.1 based on single-channel conductance and pharmacology. Ca2+-dependent AHPs in vertebrates are categorized as fast, medium, or slow. Fast and medium AHPs are generated by KCa1.1 and KCa2 channels, respectively. The KCa subtype responsible for slow AHPs is unclear. Prolonged, Ca2+-dependent AHPs have been described in several leech neurons. Unfortunately, apamin and other KCa blockers often prove ineffective in the leech. An alternative approach is to utilize KCa modulators, which alter channel sensitivity to Ca2+. Vertebrate KCa2 channels are targeted selectively by the positive modulator CyPPA and the negative modulator NS8593. Here we show that AHPs in identified motor and mechanosensory leech neurons are enhanced by CyPPA and suppressed by NS8593. Our results indicate that KCa2 channels underlie prolonged AHPs in these neurons and suggest that KCa2 modulators may serve as effective tools to explore the role of KCa channels in leech physiology.

Leech extract: A candidate cardioprotective against hypertension-induced cardiac hypertrophy and fibrosis.

ETHNOPHARMACOLOGICAL RELEVANCE: The prevalence of cardiovascular diseases (CVDs) has been increasing worldwide. Despite significant improvements in therapeutics and on-going developments of novel targeted-treatment regimens, cardiac diseases lack effective preventive and curative therapies with minimal side effects. Therefore, there is an urgent need to identify and propagate alternative and complementary therapies against cardiovascular diseases. Some traditional Chinese medicines can contribute to the prevention and treatment of CVDs and other chronic diseases, with few side effects. Hirudo, a medicinal leech, has been acclaimed for improving blood circulation and overcoming blood stagnation; however, the precise molecular mechanisms of leech extract treatment against pathological cardiac remodeling remain elusive. In this study, we aimed to delineate the molecular mechanisms of medicinal leech extract in the treatment of cardiac hypertrophy and fibrosis, using both in vitro and in vivo assessments. MATERIALS AND METHODS: We conducted in vitro and in vivo animal experiments, including cell-viability assays, fluorescence microscopy, immunoblotting, immunohistochemistry, and Masson's trichrome staining. RESULTS: Pre-treatment with leech extract conferred a survival benefit to spontaneously-hypertensive rats (SHRs) and significantly reduced angiotensin II (ANG II)-induced cardiac hypertrophy and fibrosis. ANG II-stimulated cardiac hypertrophy markers were attenuated by leech extract treatment, versus controls. Translational expression of stress-associated mitogen-activated protein kinases (MAPKs) was also repressed. In vivo, leech extract treatment significantly ameliorated the cardiac hypertrophy phenotype in SHRs and diminished interstitial fibrosis, accompanied with reduced fibrosis markers. CONCLUSION: Leech extract treatment under a hypertensive condition exerted significant cardio-protective benefits by reducing the expression of cardiac hypertrophy-related transcription factors, stress-associated MAPKs, and fibrosis mediators. Our findings imply that medicinal leach extract may be effective against hypertension-induced cardiac hypertrophy and fibrosis.